Skip to main content

Table 2 Amount of template ISPs after emulsion PCR with different amounts of dsDNA added

From: Next-Generation Sequencing of Phage-Displayed Peptide Libraries

Library Amount added (pmol) Templated ISPs (%) (successful (+)/unsuccessful (−)) Polyclonal population (% of total) Usable population (% of total)
Ph.D.-7 0.325 54.3 (−) N/A N/A
Ph.D.-7 0.1 20 (+) 38.8 37.5
Ph.D.-7 0.075 11.3 (+) 20.4 59.3
Library 1 0.15 25.1 (+) 25.8 61.7
Ph.D.-7 0.075 10.4 (+) 40.7 47.2
Library 2 0.075 8.64 (+) 16.5 73.4
Library 3 0.075 6.64 (+) 7.4 72.5
  1. Ion Torrent recommends not sequencing ISPs if more than 25 % are templated because >50 % will be a polyclonal population
  2. The following are lists of library 1–3 structures (5′–3′) with the number of bases indicating the variable library region and the forward and reverse primers used in sequencing
  3. Library 1
  4. GTACTCAGGAGGTTTAGT—88-bases—CCACCACCCTCATTTTC
  5. F-primer: CCTCTCTATGGGCAGTCGGTGAT GTACTCAGGAGGTTTAGT
  6. R-primer: CCATCTCATCCCTGCGTGTCTCCGACTCAG AAGAGGATTC GAAAATGAGGGTGGTGG
  7. Library 2
  8. GAAAGGGACTGAA—51-bases—GTCAAGTTCAACAAACCC
  9. F-primer: CCTCTCTATGGGCAGTCGGTGAT GAAAGGGACTGAA
  10. R-primer: CCATCTCATCCCTGCGTGTCTCCGACTCAG AAGAGGATTC GGGTTTGTTGAACTTGACGTCAAGTTC
  11. Library 3
  12. GGCCAGTCTGGCCAG—45-bases—GGCGGTTCTGGTGGCAGC
  13. F-primer: CCTCTCTATGGGCAGTCGGTGAT GGCCAGTCTGGCCAG
  14. R-primer: CCATCTCATCCCTGCGTGTCTCCGACTCAG AAGAGGATTC GCTGCCACCAGAACCGCC