Key words

1 Introduction

The discovery that human somatic cells can be reprogrammed into induced pluripotent stem cells (hiPSCs) has boosted research on stem cells, disease modeling, and regenerative medicine [1,2,3]. hiPSCs can now be generated from a wide variety of somatic cells that can be obtained in a relatively easy manner, including skin, blood, urine, hair, and teeth [4,5,6,7]. Initial reprogramming protocols were quite inefficient and methods to culture hiPSCs required time-consuming protocols, thus confining hiPSC work to specialized laboratories. Today, improved protocols for the generation and maintenance of hiPSCs have made hiPSC technology more broadly accessible [2, 8, 9]. In addition, the development of improved protocols for the differentiation of hiPSCs into distinct cell types is progressing [4, 5].

Research involving hiPSCs is augmented by developments made in the field of gene editing. Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR )-associated protein 9 (Cas9) has become the gene editing platform of choice in many laboratories because of its speed, low costs, and relative high efficiency compared to other gene editing methods such as transcription activator-like effector nucleases (TALENs) or zinc-finger nucleases (ZFNs). The first clinical trials involving gene editing are already ongoing [3]. Application of gene editing in hiPSCs enables the introduction or removal of disease-associated variants, gene knockouts, large deletions (>1 kb), or the introduction of cDNAs in a safe harbor (a location in the genome that can be safely targeted without adverse cellular effects and that allows high expression of a transgene) for the generation of disease models and their isogenic controls or for mechanistic studies on gene regulation [10, 11]. The generation of isogenic controls is instrumental in the correction for differences in genetic backgrounds, which appear to be very large among humans [12, 13]. Other applications of gene editing in hiPSCs include the introduction of reporter constructs to monitor a biological process of interest, for example, by using fluorescent proteins and research in the field of regenerative medicine, in which patient-derived hiPSCs are gene corrected and its differentiated derivatives are transplanted into disease models with the aim to replace tissue that has been lost due the disease [3, 7, 14].

Here, we describe gene editing strategies applicable to hiPSCs utilizing CRISPR-Cas9 for the introduction of indels (using one single guide RNA (sgRNA)), the deletion of larger (>1 kb) regions (using two sgRNAs), and the insertion of large donor templates (using one sgRNA and a universal donor template) in a safe harbor while maintaining the integrity and differentiation potential of hiPSCs.

A general timeline for gene editing of hiPSCs is shown in Fig. 1. The time required from target design to passaging of positive clones typically takes 19–33 days, depending on the application. On average, colonies can be picked around 14 days after nucleofection. Usually, DNA can be isolated and used for genotyping after 4–5 days, before the colonies need to be passaged, but an additional passaging step may be required to obtain sufficient material for genotyping.

Fig. 1
figure 1

Timeline of gene editing in hiPSCs. This protocol is focused on the use of hiPSCs cultured in the presence of mouse embryonic fibroblasts (MEFs). However, with minor adjustments to the protocol provided at the end of this manuscript, this strategy can also be applied to hiPSCs cultured under feeder-free conditions

Full size image

2 Generation of the Targeting Plasmid

The targeting plasmid contains the sgRNA that guides the Cas protein to the target sequence. In silico prediction tools should be used to identify the optimal target sequence, assessing both on- and off-target activity [10, 15]. Once the optimal target sequence has been determined in silico, the presence of this exact sequence should be verified by Sanger sequencing in the hiPSCs that will be used in the experiment. This is important because the presence of single-nucleotide polymorphisms (SNPs) in the target sequence will reduce targeting efficiency. Single-stranded oligonucleotides can then be ordered, annealed, and inserted into the plasmid containing two BbsI restriction sites for the sgRNA cloning (Fig. 2). Transcription of the sgRNA is driven by the U6 promotor. To allow efficient transcription, the 20th base of the guide sequence (5′ from the PAM sequence) should be a guanine, if not substitute this base with a guanine. We have used the following targeting sequence for the insertion of a cDNA in the AAVS1 locus: 5′-GTCACCAATCCTGTCCCTAG-3′, using the donor construct described in Subheading 3 [16].

Fig. 2
figure 2

Scheme for the cloning of the sgRNA sequence into the targeting plasmid. The DNA oligonucleotide duplex (in green) is formed by annealing two complementary single-stranded oligonucleotides containing the target sequence and an overhang. The 20th base of the guide sequence should be a guanine, indicated by the small g. Using the BbsI restriction enzyme, the pCRII-BbsI-sgRNA scaffold plasmid (we designed this plasmid based on Ran et al. [17]) is digested, producing two asymmetric overhangs (indicated with the scissors). This allows the oligonucleotide duplex to be inserted unidirectionally into the pCRII-BbsI-sgRNA scaffold

Full size image

2.1 Materials

  • 10× Annealing buffer (100 mM Tris, pH 7.5–8.0, 500 mM NaCl, 10 mM EDTA).

  • Forward oligonucleotide (the target sequence and ACCG overhang, see Fig. 2).

  • Reverse oligonucleotide (the target sequence and CAAA overhang, see Fig. 2).

  • Milli-Q water.

  • Cutsmart buffer (NEB, B7204S or supplied with BbsI-HF).

  • BbsI-HF (NEB, R3539).

  • pCRII-BbsI-sgRNA scaffold vector (Addgene, 159352).

  • Agarose (Sigma, A9539).

  • 10× TAE Buffer (40 mM Tris, 20 mM acetic acid, 1 mM EDTA).

  • Gel extraction kit (Qiagen, 28704).

  • T4 DNA Ligase (NEB, B0202S).

  • T4 DNA Ligase Buffer (10×) (NEB, M0202 or supplied with T4 DNA Ligase).

  • Heat shock competent cells (One Shot TOP10, Invitrogen, C4040).

  • LB agar plates with 100μg/mL Ampicillin and/or 50μg/mL kanamycin selection.

  • M13 forward primer (TGTAAAACGACGGCCAGT) or T7 sequence primer (TAATACGACTCACTATAGGG).

  • Miniprep kit (Qiagen, 27106).

  • Midi or Maxiprep kit (Qiagen, 740410, or 740414).

2.2 Procedure

2.2.1 Annealing of the Complementary Oligonucleotides to Form an Oligonucleotide Duplex

  1. 1.

    Mix the two single-stranded oligonucleotides in equimolar concentrations as described below.

    Oligonucleotide annealing mix for one reaction

    XμL

    Forward oligonucleotide (100μM final concentration)

    XμL

    Reverse oligonucleotide (100μM final concentration)

    2μL

    10× Annealing buffer

    XμL

    Milli-Q water

    20μL

    Total volume

  2. 2.

    Efficient annealing can be achieved by one of the two following methods:

    1. (a)

      Oligonucleotide annealing method 1:

      • Prepare and mix oligonucleotides in a 1.5-mL microfuge tube.

      • Heat to 95 °C for 5 min in a heating block.

      • Turn off the heating block and allow to slowly cool to room temperature (~45 min).

    2. (b)

      Oligonucleotide annealing method 2:

      • Prepare and mix oligonucleotides in a PCR tube.

      • Place the mixture in the thermocycler and use the following PCR program.

        Annealing program

        (1)

        95 °C 5:00

        (2)

        95 °C (ramp down @ −1 °C/cycle) 2:00

        (3)

        20 °C ∞

        (4)

        End

  3. 3.

    The resulting oligonucleotide duplex can be stored at 4 °C for short term (1 week) or at −20 °C for long term (up to 12 months).

2.2.2 Digestion of the pCRII-BbsI-sgRNA Scaffold Plasmid

  1. 1.

    Perform a restriction reaction with the BbsI restriction enzyme on the pCRII-BbsI-sgRNA scaffold plasmid as described below:

    BbsI-HF restriction mix for one reaction

    X μL (~2μg)

    pCRII-BbsI-sgRNA scaffold plasmid

    5 μL

    Cutsmart buffer

    X μL

    Milli-Q water

    2 μL

    BbsI-HF

    50 μL

    Total volume

  2. 2.

    Incubate the reaction mix for 60 min at 37 °C.

  3. 3.

    Run the restriction reaction on a 0.75% agarose TAE gel.

  4. 4.

    Cut the linearized plasmid (size 4407 bp) from the gel using a scalpel. Note: use a low intensity UV source to visualize the DNA to prevent UV-induced damage.

  5. 5.

    Perform a gel extraction to isolate the product following the manufacturer’s protocol .

  6. 6.

    Quantify the gel-purified DNA using a spectrophotometer.

2.2.3 Ligation of the Oligonucleotide Duplex into the pCRII-BbsI-sgRNA Scaffold Plasmid

  1. 1.

    Dilute the oligonucleotide duplex 200-fold in Milli-Q water.

  2. 2.

    Prepare and mix the T4 DNA ligation mix as described below:

    T4 DNA ligase reaction mix for one reaction

    2 μL

    T4 DNA Ligase Buffer (10×)

    X μL (50 ng)

    Digested pCRII-BbsI-sgRNA scaffold plasmid

    2 μL

    200-fold diluted duplex oligonucleotide mix

    15–X μL

    Milli-Q water

    1 μL

    T4 DNA Ligase

    20 μL

    Total volume

  3. 3.

    Incubate for 60 min at room temperature or overnight at 16 °C or over the weekend at 4 °C (choose one of these three conditions; include a negative control ligation reaction that lacks the oligonucleotide duplex).

  4. 4.

    Transform 10μL of the ligation into competent cells using the heat shock method according to manufacturer’s protocol .

  5. 5.

    Plate the transformed cells onto LB agar plates with ampicillin (100μg/mL) and/or kanamycin (50μg/mL) selection and incubate overnight at 37 °C.

  6. 6.

    After overnight incubation, check for the presence of colonies (typically very few colonies should be present in the negative control and hundreds of colonies in the ligation).

  7. 7.

    Pick colonies from the ligation plate and perform a miniprep DNA purification according to the manufacturer’s protocol .

  8. 8.

    Sequence the clones with the M13 forward primers or T7 primer to verify the correct insertion of the duplex oligonucleotide.

  9. 9.

    Colonies with a correct insertion can be used for a Midi or Maxi prep according to the manufacturer’s protocol .

  10. 10.

    The resulting targeting plasmid will be used for further downstream applications and can be stored at 4 °C for short term (1 week) or at −20 °C for long term (up to 12 months). See Note 1.

3 Generation of the Donor Construct

To generate a large knock-in, the use of a donor construct is required. The efficiency of generating a large knock-in is significantly lower than generating an indel or deletion. Therefore, utilizing a selection cassette to select for the successfully targeted clones can reduce the number of negative colonies (Fig. 3).

Fig. 3
figure 3

Map for cloning of the cDNA insert into the donor plasmid. The EF1a-cDNA-pCAG-Neo plasmid contains two KpnI recognition sites flanking the 5′ homology arm and two HindIII recognition sites flanking the 3′ homology arms [16]. The cDNA is expressed by the EF1a promoter and is flanked by 5′ EcoRI and PacI and 3′ NsiI and NotI recognition sites. The Neomycin selection is driven by the pCAG promotor and enables the selection of successful targeted cells with G418. If desired, the LoxP sites can be used to remove the Neomycin selection cassette by transient expression of Cre recombinase in the targeted iPSCs [18]

Full size image

3.1 Materials

  • Milli-Q water.

  • Cutsmart buffer (NEB, B7204S or supplied with restriction enzyme).

  • EcoRI-HF (NEB, R3101).

  • PacI (NEB, R0547).

  • NsiI-HF (NEB, R3127).

  • NotI-HF (NEB, R3189).

  • EF1a-cDNA-pCAG-Neo vector (the plasmid containing acid alpha-glucosidase cDNA and AAVS1 target sites can be used to clone the cDNA and target sites of interest [16] and is available upon request).

  • Agarose (Sigma, A9539).

  • 10× TAE Buffer (40 mM Tris, 20 mM acetic acid, 1 mM EDTA).

  • Gel extraction kit (Qiagen, 28704).

  • T4 DNA Ligase (NEB, B0202S).

  • T4 DNA Ligase Buffer (10×) (NEB, M0202 or supplied with T4 DNA Ligase).

  • Heat shock competent cells (One Shot TOP10, Invitrogen, C4040).

  • LB agar plates with 100μg/mL ampicillin and/or 50μg/mL kanamycin selection.

  • Sequence primers for insert.

  • Miniprep kit (Qiagen, 27106).

  • Midi or Maxiprep kit (Qiagen, 740410 or 740414).

3.2 Procedure

3.2.1 Digestion of the EF1a-cDNA-pCAG-Neo Plasmid

  1. 1.

    Perform a restriction reaction with the restriction enzymes on the EF1a-cDNA-pCAG-Neo plasmid as described below:

    Enzyme restriction mix for one reaction

    X μL (~2μg)

    EF1a-cDNA-pCAG-Neo plasmid

    5 μL

    Cutsmart buffer

    X μL

    Milli-Q water

    2 μL

    EcoRI-HF or PacI

    2 μL

    NsiI-HF or NotI-HF

    50 μL

    Total volume

  2. 2.

    Incubate the reaction mix for 60 min at 37 °C.

  3. 3.

    Run the restriction reaction on a 1% agarose gel.

  4. 4.

    Cut the linearized plasmid (size ~9100 bp) from the gel using a scalpel. Note: use a low-intensity UV source to visualize the DNA to prevent UV-induced damage.

  5. 5.

    Perform a gel extraction to isolate the product following the manufacturer’s protocol .

  6. 6.

    Quantify the gel-purified DNA using a spectrophotometer.

3.2.2 Ligation of the cDNA Insert into the EF1a-cDNA-pCAG-Neo Plasmid

Standard cloning techniques can be used to prepare the required cDNA insert with 5′ EcoRI-HF or PacI and a 3′ NsiI-HF or NotI-HF overhangs (e.g., using PCR or ordered as gBlock (IDT)).

  1. 1.

    Prepare and mix the T4 ligation mix as described below:

T4 Ligase reaction mix for one reaction

2μL

T4 DNA Ligase Buffer (10×)

X μL (50 ng)

Digested EF1a-cDNA-pCAG-Neo plasmid

X μL

Digested cDNA insert

X μL

Milli-Q water

1μL

T4 DNA Ligase

20μL

Total volume

Use the following formula to calculate the required amount of insert in ng:

$$ \frac{\mathrm{ng}\ \mathrm{of}\ \mathrm{vector}\times \mathrm{size}\ \mathrm{of}\ \mathrm{in}\mathrm{sert}\ \mathrm{in}\ \mathrm{kb}}{\ \mathrm{size}\ \mathrm{of}\ \mathrm{vector}\ \mathrm{in}\ \mathrm{kb}}\times \mathrm{molar}\ \mathrm{ratio}\ \mathrm{of}\frac{\mathrm{insert}}{\mathrm{vector}}=\mathrm{ng}\ \mathrm{insert} $$
  1. 2.

    Incubate 60 min at room temperature or overnight at 16 °C or over the weekend at 4 °C (choose one of these conditions; remember to include a negative control ligation reaction that lacks the cDNA insert).

  2. 3.

    Transform 10μL of the ligation into competent cells using the heat shock method according to manufacturer’s protocol .

  3. 4.

    Plate the transformed cells onto LB agar plates with ampicillin (100μg/mL) and/or kanamycin (50μg/mL) selection and incubate overnight at 37 °C.

  4. 5.

    After overnight incubation, check for the presence of colonies on the agar plates (typically very few colonies should be present in the negative control and hundreds of colonies in the ligation).

  5. 6.

    Pick colonies from the ligation plate and perform a miniprep according to manufacturer’s protocol .

  6. 7.

    Sequence the clones with cDNA-specific primers to verify the successful insertion of the cDNA insert. Also sequence from the cDNA into the vector to verify correct ligation.

  7. 8.

    Colonies with a successful insertion can be used for a Midi or Maxi prep according to manufacturer’s protocol , the resulting targeting plasmid will be used for further downstream applications and can be stored at 4 °C for short term (1 week) or at −20 °C for long term (up to 12 months). See Notes 2 and 3.

4 Generation of Conditioned Media

Conditioned medium from MEFs is used during and after nucleofection of the hiPSCs. Conditioned medium contains factors that are secreted by MEFs such as growth factors and extracellular proteins and is harvested every 24 h (Fig. 4). The conditioned medium is added immediately after plating to improve the recovery of hiPSCs from nucleofection.

Fig. 4
figure 4

The generation of conditioned medium. Antibiotics-free hiPSC medium is added to MEFs and harvested after 24 h for later use

Full size image

4.1 Materials

  • Irradiated Mouse Embryonic Fibroblasts (MEFs).

  • 2% gelatin solution (Sigma, G-1393).

  • PBS (Gibco, 70011044).

  • Fibroblast growth medium:

    • DMEM high glucose (Gibco, 11965092).

    • 10% fetal bovine serum (Hyclone, 11531831).

    • 1% penicillin-streptomycin-glutamine (P/S/G) (Gibco, 10378016).

  • Antibiotics free hiPSC medium:

    • 390 mL DMEM/F12 (Invitrogen, 21331046).

    • 10% KO serum replacement (Invitrogen, 10828).

    • 1% non-essential amino acids (NEAA) (Gibco, 11140050).

    • 1% glutamine (Gibco, 25030024).

    • 1 mL β-mercaptoethanol (Invitrogen, 31350010).

    • 10 ng/mL basic fibroblast growth factors (bFGF) (Preprotech, 100-18B) (dissolved in 0.1% BSA/PBS, see manufacturer’s instructions).

  • 10 cm tissue culture plate (Greiner Bio-One, 664160).

  • 0.45μm sterile cell culture filter (Millipore, SLHVR04NL).

4.2 Procedure

  1. 1.

    Coat a 10-cm tissue culture plate with 5 mL 0.1% gelatin solution (diluted in PBS) and incubate for 15 min at 37 °C.

  2. 2.

    Thaw a cryovial containing the MEFs in a 37 °C water bath until almost completely thawed and gently transfer the MEFs to a 15-mL tube containing 9-mL fibroblast growth medium using a P1000 pipette.

  3. 3.

    Centrifuge one million MEFs at 1000 rpm (200 × g) for 5 min, remove the excess medium and resuspend the pellet in 10-mL fibroblast growth medium.

  4. 4.

    Seed the MEFs onto the gelatin coated tissue culture plate and culture at 37 °C/5% CO2.

  5. 5.

    Refresh the media after 8–24 h with antibiotics free hiPSC medium.

  6. 6.

    Harvest the media after 24 h and refresh the MEFs with antibiotics-free hiPSC medium. This step can be repeated for up to 5 days or until quality of the MEFs have been diminished as such they are no longer considered viable.

  7. 7.

    Filter the conditioned media with using a 0.45-μm sterile cell culture filter.

  8. 8.

    Store the sterile conditioned medium at −20 °C for short-time storage of −80 °C for long-time storage. See Note 4. 

5 Preparation of the DNA Prep (1 Day in Advance)

Depending on the method of plasmid preparation, an optional co-precipitation of the plasmids prior to transfection may be performed. This step is recommended to prevent microbial contamination.

5.1 Materials

  • 5 M NaCl.

  • Milli-Q water.

  • Ice-cold 100% ethanol.

  • Ice-cold 70% ethanol.

  • sgRNA targeting plasmid (generated in Subheading 2).

  • pCas9_GFP plasmid (Addgene, 44719).

  • Optional: Donor template plasmid (available upon request).

5.2 Procedure

  1. 1.

    Prepare and mix the DNA prep mix to a 1.5-mL Eppendorf tube as described below:

Components

Single sgRNA *

Double sgRNA **

Donor template insertion***

Cas9 plasmid

11.5μg (~2 pmol)

11.5μg (~2 pmol)

8.9μg (~1.5 pmol)

1st sgRNA plasmid

8.5μg (~3 pmol)

4.25μg (~1.5 pmol)

6.7μg (~2.25 pmol)

2nd sgRNA plasmid

–

4.25μg (~1.5 pmol)

–

Donor plasmid

–

–

4.4μg (~1 0.25 pmol)

NaCl (5 M)

2μL

2μL

2μL

Milli-Q water

X μL

X μL

X μL

Total volume

100μL

100μL

100μL

  1. *For generating one double-stranded DNA break, e.g., to create a knockout
  2. **For generating two double-stranded DNA breaks, e.g., to create a large deletion
  3. ***To insert a cDNA in a safe harbor
  1. 2.

    Add 250μL ice-cold 100% ethanol and precipitate the DNA for 15 min at −20 °C.

  2. 3.

    Centrifuge for 10 min at 14,000 rcf at 4 °C and remove the ethanol, the plasmids will appear as a small translucent pellet.

  3. 4.

    Wash with 200μL ice-cold 70% ethanol and centrifuge for 10 min at 14,000 rcf at 4 °C, repeat this once.

  4. 5.

    Remove the excess ethanol from the Eppendorf tube and allow the pellet to air dry for 15 min.

  5. 6.

    Add 20μL of sterile PBS onto the dry pellet, close the tube, and let the DNA resuspend overnight at room temperature.

  6. 7.

    Transfer 2μL of the DNA prep to a new 1.5-mL Eppendorf tube to quantify the DNA using a spectrophotometer. This is required to verify that the correct amount of DNA has been recovered from steps 2–6.

6 Plating MEFs

After nucleofection, the hiPSCs are seeded on fresh MEFs (Fig. 5). To allow time for the MEFs to adhere to the plate, they have to be plated at least 8 h (preferably 24 h) prior to seeding the nucleofected hiPSCs. This protocol is for one 6-well plate but can be scaled accordingly (see Note 5).

Fig. 5
figure 5

Plating of mouse embryonic fibroblasts (MEFs). One million cells are divided over all wells of a 0.1% gelatin-coated six-well plate

Full size image

6.1 Materials

  • Irradiated mouse embryonic fibroblasts (MEFs).

  • 2% gelatin solution (Sigma, G-1393).

  • PBS (Gibco, 70011044).

  • Fibroblast growth medium.

    • DMEM high glucose (Gibco, 11965092).

    • 10% fetal bovine serum (Hyclone, 11531831).

    • 1% penicillin-streptomycin-glutamine (P/S/G) (Gibco, 10378016).

  • Six-well tissue culture plate (Thermo Scientific, 140675).

6.2 Procedure

  1. 1.

    Coat the six-well tissue culture plate with 1 mL 0.1% gelatin solution (diluted in PBS) per well and incubate for 15 min at 37 °C.

  2. 2.

    Thaw the cryovial containing the MEFs in a 37 °C water bath until almost completely thawed and gently transfer the MEFs to a 15-mL tube containing 9 mL fibroblast growth medium using a P1000 pipette.

  3. 3.

    Centrifuge one million MEFs at 1000 rpm (200 × g) for 5 min, remove the excess medium and resuspend the pellet in 12 mL fibroblast growth medium.

  4. 4.

    Seed 2 mL of the MEFs suspension per well onto the gelatin-coated tissue culture plate and culture at 37 °C/5% CO2.

7 Nucleofection of hiPSCs

The plasmid DNAs for the sgRNA , Cas9 protein, and the donor vector (optional) are introduced into the hiPSCs using nucleofection (Fig. 6) (see Note 5).

Fig. 6
figure 6

Procedure for nucleofection of single-cell hiPSCs for CRISPR-Cas9-mediated gene editing. hiPSCs are dissociated into single cells and mixed with DNA. After nucleofection, cells are plated as single cells at different densities on MEFs

Full size image

7.1 Materials

  • hiPSC medium.

    • 390 mL DMEM/F12 (Invitrogen, 21331046).

    • 10% KO serum replacement (Invitrogen, 10828).

    • 1% Non-essential amino acids (NEAA) (Gibco, 11140050).

    • 1% penicillin-streptomycin-glutamine 100× (Gibco, 10378016).

    • 1 mL β-mercaptoethanol (Invitrogen 31350010).

    • 10 ng/mL basic fibroblast growth factor (bFGF) (Preprotech, 100-18B) (Dissolved in 0.1% BSA/PBS, see manufacturer’s instructions).

  • Nucleofector™ 2b Device (Lonza, AAB-1001).

  • Human Stem Cell Nucleofector™ Kit 2 (Lonza, VAPH-5022).

  • DNA prep (prepared in Subheading 5).

  • Conditioned medium from MEFs (prepared in Subheading 4).

  • Accutase (Gibco, A11105-01) or TrypLE (Gibco, 12605010).

  • PBS (Gibco, 70011044).

  • ROCK inhibitor Y-27632 (Hello Bio, HB2297) or Revitacell Supplement 100× (Gibco, A2644501).

  • Basic fibroblast growth factor (bFGF) (Preprotech, 100-18B) (Dissolved in 0.1% BSA/PBS, see manufacturer’s instructions).

  • G418 (InvivoGen, ant-gn-5).

7.2 Procedure

  1. 1.

    4 h before starting the nucleofection procedure: replace the medium on the hiPSCs with hiPSC medium supplemented with 10μM ROCK inhibitor or 1× Revitacell Supplement.

  2. 2.

    30 min before starting the procedure: replace the medium on the MEFs with conditioned medium supplemented with 10 ng/mL bFGF and 10μM ROCK inhibitor or 1× Revitacell Supplement.

  3. 3.

    Transfer 9μg of the DNA prep to a new sterile 1.5-mL Eppendorf tube, prepare one tube for each nucleofection reaction.

  4. 4.

    Remove the hiPSC medium and wash the hiPSCs with 2 mL sterile PBS.

  5. 5.

    Incubate the cells with 500μL of warm Accutase or TrypLE at 37 °C until the cells start to detach; this should take 5–10 min.

  6. 6.

    Using a 10-mL pipette, add 2 mL of hiPSC medium onto each well and detach the cells from the bottom of the well by pipetting the medium gently up and down the well. Transfer the cell suspension to a 50-mL tube.

  7. 7.

    Count the cells and transfer two million cells into a new 50-mL tube for each nucleofection reaction.

  8. 8.

    Centrifuge the cell suspension for 5 min at 1000 rpm (200 × g) and carefully remove all medium.

  9. 9.

    Mix solutions A and B from the Human Stem Cell Nucleofector Kit 2; 100μL nucleofection mix is required per reaction, the rest of the mix can be stored up to 1 month at 4 °C See Note 6.

  1. 10.

    Resuspend the pellet of two million cells in 100μL of the Human Stem Cell Nucleofector mix by pipetting up and down twice using a P1000 pipette.

  2. 11.

    Transfer the resuspended cells into the 1.5-mL Eppendorf containing the 9μg DNA prep.

  3. 12.

    Mix the resuspended cells and the DNA prep by pipetting up and down four times using a P1000 pipette.

  4. 13.

    Carefully transfer the mix to a Human Stem Cell Nucleofector Kit 2, make sure that no air bubbles are introduced. If any bubbles do appear in the cell suspension, gently tap the bottom of the cuvette on the surface of the cell culture hood to remove them.

  5. 14.

    Put the lid on the cuvette and place it into the Nucleofector™ 2b. Select program [B-016] and press enter. After 2 s, an [OK] message appears on the display of the device indicating that the program was successfully executed. A white layer containing dead cells will be formed on one side of the cuvette.

  6. 15.

    Bring the cuvette back into the cell culture hood and transfer the cell suspension using the plastic transfer pipette included in the kit to a 50-mL tube containing 2 mL of conditioned medium supplemented with 10 ng/mL bFGF and 10μM ROCK inhibitor or 1× Revitacell Supplement. Try to only transfer the suspension and avoid the white layer of dead cells.

  7. 16.

    Seed the hiPSCs on the prepared MEFs in conditioned medium and culture at 37 °C/5% CO2. It is recommended to seed the hiPSCs at several dilutions (1/3, 1/6, 1/9) in order to generate single-cell colonies.

  8. 17.

    After 24 h, replace the conditioned medium with hiPSC medium and refresh the media daily.

  9. 18.

    The selection with G418 can be started 48 h after nucleofection if the donor template is used.

  10. 19.

    7–21 days after nucleofection, single colonies can be picked (see Subheading 8). The time required to obtain a colony depends on the cell density, recovery speed of the cells, and the use of selection.

8 Picking Colonies

Once the colonies are large enough to be passaged, the colonies are cut with a 23 gauge needle and split manually into two wells, of which one is used for genotyping and one to continue passaging after genotyping (Fig. 7) (see Note 5).

Fig. 7
figure 7

Picking hiPSC colonies after nucleofection. hiPSC colonies are dissociated, cut from the plate using a 23 gauge needle, and passaged into a plate for DNA isolation and another plate for subculturing

Full size image

8.1 Materials

  • hiPSC medium:

    • 390 mL DMEM/F12 (Invitrogen, 21331046).

    • 10% KO serum replacement (Invitrogen, 10828).

    • 1% non-essential amino acids (NEAA) (Gibco, 11140050).

    • 1% < penicillin-streptomycin-glutamine 100× (Gibco, 10378016).

    • 1 mL β-mercaptoethanol (Invitrogen 31350010).

    • 10 ng/mL basic fibroblast growth factors (bFGF) (Preprotech, 100-18B) (dissolved in 0.1% BSA/PBS, see manufacturer’s instructions).

  • Irradiated mouse embryonic fibroblasts (MEFs).

  • 2% gelatin solution (Sigma, G-1393).

  • PBS (Gibco, 70011044).

  • Fibroblast growth medium:

    • DMEM high glucose (Gibco, 11965092).

    • 10% fetal bovine serum (Hyclone, 11531831).

    • 1% penicillin-streptomycin-glutamine (P/S/G) (Gibco, 10378016).

  • 48-well tissue culture plate (Greiner bio-one, 677180).

  • 1 mg/mL Collagenase IV (Invitrogen 17104-019) in KO DMEM/F12 (Invitrogen 21331046) (dissolve at 37 °C for 10–15 min, filter through 0.2μM sterile filter (Millipore, SLFGR04NL).

  • 23 gauge needle.

8.2 Procedure

  1. 1.

    24 h prior to picking: prepare two 48-well plates per nucleofection with MEFs (scale down from Subheading 6). One will be used for DNA isolation and one for passaging of the colonies.

  2. 2.

    Before picking colonies: Rinse MEFs with 1 mL PBS and add hiPSC medium.

  3. 3.

    Remove the hiPSC medium and wash with 1 mL PBS.

  4. 4.

    Add 1 mL collagenase IV (1 mg/mL) solution into each well.

  5. 5.

    Incubate the plate at 37 °C for 5–15 min.

    1. (a)

      Monitor the cell detachment under microscope as more time might be needed.

    2. (b)

      The edge of the detached colonies should look slightly “curled” comparing to the attached ones.

  6. 6.

    Add 1 mL hiPSC medium into each well.

  7. 7.

    Cut the selected single colony into small pieces with a 23 gauge needle:

    1. (a)

      Hold needle in an upward direction of needle opening.

    2. (b)

      Scrape gently, avoid cutting the plastic surface.

  8. 8.

    Dissociate the selected colony from the plate with a P1000 and divide over two wells, one on each plate.

  9. 9.

    Repeat until all the selected single colonies are picked.

  10. 10.

    Refresh the media and monitor the colonies daily until passaging or harvesting DNA for genotyping.

9 Genotyping

Normally, the genotyping can be finished before the sister colony has to be passaged, but if required it can also be performed on cells of a later passage. The method of genotyping will differ depending on the gene editing strategy (Fig. 8). For small indels and large deletions, a generic PCR can be performed using primers flanking the target sequence(s), and the genomic alteration of the target site can be determined by Sanger sequencing of the PCR product(s). For large deletions, a dual-PCR strategy can be used to determine the mono-allelic or bi-allelic presence of the deletion. For cDNA insertions mediated by a donor construct, a dual-PCR strategy can be used to determine whether the donor template has integrated at the target location. To determine copy number variations and to further examine genomic changes, Southern blotting and/or qPCR analysis of genomic DNA can be performed. Finally, it is important to monitor any off-target events resulting from the CRISPR reaction. This is usually done by analyzing predicted off-target sites using PCR and Sanger sequencing, although this might not always be sufficient. For a more extensive discussion on off-target effects, see [10, 19,20,21].

Fig. 8
figure 8

Genotyping methods to detect indels, large deletions, and template integrations. DNA is isolated from the hiPSC colonies and used for a PCR-based genotyping strategy. Method 1 uses Sanger sequencing to determine the indels, methods and 2 and 3 use agarose gel electrophoresis to identify successfully targeted colonies. Typical results for agarose gel electrophoresis are shown

Full size image

Below we describe examples for the genotyping of indels, deletions, and template knock-ins.

9.1 DNA Isolation

9.1.1 Materials

  • Lysis buffer (Tris pH 8.5, 0.1 M, EDTA 5 mM, SDS 0.2%, NaCl 0.2 M; add 100μg/mL fresh protease K).

  • NaCl (5 M).

  • Isopropanol (Sigma, 59300).

  • 70% ethanol (Sigma, 72032221).

  • Milli-Q water.

9.1.2 Procedure

  1. 1.

    Remove the hiPSC medium and wash the hiPSCs once with PBS.

  2. 2.

    Add 500μL lysis buffer to each well and incubate at 37 °C for 1–18 h (in cell culture incubator).

  3. 3.

    Transfer the cell lysate to a 1.5-mL tube (optional: store lysate at −20 °C). Subsequent steps are performed at room temperature, unless stated otherwise.

  4. 4.

    Add 260μL NaCl (5 M) and shake (do not vortex to avoid breaking the genomic DNA), a white protein precipitate forms.

  5. 5.

    Centrifuge for 5 min at maximum speed and transfer the supernatant to a new 1.5-mL tube, without touching the white pellet.

  6. 6.

    Add 532μL (0.7× volume) isopropanol, shake (do not vortex), a small piece of DNA should appear, if not shake again.

  7. 7.

    Centrifuge for 5 min at maximum speed.

  8. 8.

    Remove the supernatant and wash the pellet with 500μL 70% ethanol and centrifuge 5 min at maximum speed.

  9. 9.

    Remove the excess ethanol from the Eppendorf tube and allow the pellet to air dry for 15 min.

  10. 10.

    Dissolve the pellet in 40μL Milli-Q water and incubate for 1 h at 65 °C.

  11. 11.

    Quantify the extracted DNA using a spectrophotometer.

9.2 Genotyping Method 1: Introduction of Indels (Nested DNA Sequencing)

For the genotyping of indels, a PCR with primers flanking the targeted area is used to amplify the DNA; this is subsequently sequenced to verify the introduction of indels (Fig. 9).

Fig. 9
figure 9

Genotyping of indels. Primers flanking the indel amplify the region, after which the indel can be determined by Sanger sequencing

Full size image

9.2.1 Materials

  • Forward primer, located ~300 bp upstream the sgRNA sequence (stock: 10μM in 10 mM Tris).

  • Reverse primer, located ~200 bp downstream the sgRNA sequence (stock: 10μM in 10 mM Tris).

  • Sequence primer, located ~100 bp upstream the sgRNA sequence (stock: 10μM in 10 mM Tris).

  • Isolated DNA (isolated previously from individual hiPSC colonies).

  • Milli-Q water.

  • FastStart™ Taq DNA Polymerase (Roche, 12032902001).

  • 10× PCR buffer + MgCl2 (supplied with FastStart Taq polymerase)

  • dNTPs (Invitrogen, 10297-018) (stock: 10 mM in 10 mM Tris pH 8.5 for each nucleotide).

  • BigDye™ Terminator v3.1 Cycle Sequencing Kit (Thermo Scientific, 4337458):

    • Exosap.

    • 5× sequencing buffer.

    • BigDye® Terminator v3.1 (BDT).

9.2.2 Procedure

  1. 1.

    Dilute the DNA samples to the required DNA concentration using Milli-Q water.

  2. 2.

    Perform a PCR as described below. Use a DNA sample from the unedited cell as a negative control.

    PCR mix for one reaction

    PCR program

    1.5 μL

    10× PCR buffer + MgCl2

    (1)

    96 °C, 4:00

    0.5 μL

    dNTPs (10 mM)

    (2)

    96 °C, 0:20

    0.5 μL

    Forward primer (10μM)

    (3)

    55–65 °C, 0:30

    0.5 μL

    Reverse primer (10μM)

    (4)

    72 °C, 1:00

    1 μL

    DNA (<25 ng)

    (5)

    Go to step 2

    34×

    0.5 μL

    FastStart Taq

    (6)

    72 °C, 5:00

    10.5 μL

    Milli-Q water

    (7)

    10 °C, ∞

    15 μL

    Total volume

    (8)

    End

  3. 3.

    Add 1μL Exosap to the PCR product and perform the Exosap reaction as described below

    Exosap program

    (1)

    37 °C, 45:00

    (2)

    80 °C, 15:00

    (3)

    10 °C, ∞

    (4)

    End

  4. 4.

    Use 4μL of the product to perform a BDT reaction as described below

    BDT reaction mix for one reaction

    BDT reaction Program

    3.5 μL

    5× sequence buffer

    (1)

    96 °C, 0:45

    1 μL

    Sequence primer (10μM)

    (2)

    96 °C, 0:10

    4 μL

    PCR product

    (3)

    58 °C, 0:05

    0.5 μL

    BDT

    (4)

    60 °C, 3:00

    1 μL

    Milli-Q water

    (5)

    Go to step 2

    25×

    10 μL

    Total volume

    (6)

    10 °C, ∞

      

    (7)

    End

  5. 5.

    Perform Sanger sequencing

9.2.3 Results

A successful CRISPR-Cas9 reaction will result in the appearance of heterozygous sequence calls starting around the target sequence. Note that also in the case of targeting both alleles, heterozygous callings will still appear as the indels introduced will likely differ between the two alleles.

9.3 Genotyping Method 2: Introduction of Large Deletions

Two PCRs with different sets of primers are used to genotype the introduction of large deletions. The product size for set 1 will decrease if the large deletion is successful. A long-range PCR protocol could be necessary for the reaction depending on the size of the deletion. A reaction with primer set 2 will not result in a product if the deletion is successful as the forward primer is in the deleted region. The combined results will provide information on the targeting of both alleles and will exclude false-positive results (Fig. 10).

Fig. 10
figure 10

Genotyping of large deletions. In primer set 1, PCR primers flank the desired deletion to amplify that region. In primer set 2, the forward primer is located inside the desired deletion to detect unedited alleles. A typical result is shown: sample #1 = no deletion, sample #3 = mono-allelic deletion, sample # 2, 4, and 5 = bi-allelic deletion

Full size image

9.3.1 Materials

  • Primer 1: forward primer located ~200 bp upstream the 5′ sgRNA (stock: 10μM in 10 mM Tris).

  • Primer 2: reverse primer located ~200 bp downstream the 3′ sgRNA (stock: 10μM in 10 mM Tris).

  • Primer 3: forward primer located ~200 bp upstream the 3′ sgRNA (stock: 10μM in 10 mM Tris).

  • Isolated DNA (isolated previously from individual hiPSC colonies).

  • Milli-Q water.

  • FastStart™ Taq DNA Polymerase (Roche, 12032902001).

  • 10× PCR buffer + MgCl2 (supplied with FastStart Taq polymerase).

  • dNTPs (Invitrogen, 10297-018) (stock: 10 mM in 10 mM Tris-HCl pH 8.5 for each nucleotide).

  • 1.5% agarose TAE gel.

    • 1× TAE buffer (40 mM Tris, 20 mM acetic acid, 1 mM EDTA).

    • Agarose (Sigma, A9539).

9.3.2 Procedure

  1. 1.

    Dilute the DNA samples to the required DNA concentration using Milli-Q water.

  2. 2.

    Perform two PCRs as listed below: one using set 1 (primers 1 and 2) and one using set 2 (primers 2 and 3).

    PCR mix for one reaction

    PCR program

    1.5μL

    10× PCR buffer + MgCl2

    (1)

    96 °C, 4:00

    0.5μL

    dNTPs (10 mM)

    (2)

    96 °C, 0:20

    0.5μL

    Forward primer (10μM)

    (3)

    55–65 °C, 0:30

    0.5μL

    Reverse primer (10μM)

    (4)

    72 °C (1:00 per 1 kb)

    1μL

    DNA (<25 ng)

    (5)

    Go to step 2

    34×

    0.5μL

    FastStart Taq

    (6)

    72 °C, 5:00

    10.5μL

    Milli-Q water

    (7)

    10 °C, ∞

    15μL

    Total volume

    (8)

    End

  3. 3.

    Run and visualize both PCRs on a 1.5% agarose TAE gel

9.3.3 Results

A large product size for set 1 indicates the presence of the full-sized product, a small product size indicates the introduction of a large deletion. The absence of the large product indicates successful targeting on both alleles. The presence of both products indicates successful targeting of one allele. Set 2 will verify the results, as a product will only be present if the original DNA sequence is present on one or both alleles.

 

No deletion

Mono-allelic deletion

Bi-allelic deletion

Primer set 1

Only large product

Large and small product

Only small product

Primer set 2

Product present

Product present

Product absent

9.4 Genotyping Method 3: Knock-In with Donor Template Integration

The genotyping of a template integration can be performed using two primer sets. Set 1 uses primers flanking the integration. Set 2 uses a forward primer upstream from the 5′ homology arm, the reverse primer is only present in the insert. Set 1 provides information on the presence of the integration, whereas set 2 indicates if the integration is at the desired location. The combined results will provide information on the targeting of both alleles (Fig. 11).

Fig. 11
figure 11

Genotyping of donor template integration. In primer set 1, PCR primers are located within the 5′ and 3′ homology arms, and under the PCR conditions employed will only amplify the DNA if the donor is not integrated. In primer set 2, PCR primers are located at a 5′ upstream location and within the donor construct, and will only result in a correct PCR product if the template has been integrated at the desired location. A typical result is shown: sample #1 and #2, mono-allelic integration; sample #3 and #4, bi-allelic integration; sample #5 no integration

Full size image

9.4.1 Materials

  • Primer set 1: (located in the homology arms).

    • Forward primer, located ~ 200 bp upstream the target site (stock: 10μM in 10 mM Tris).

    • Reverse primer, located ~ 200 bp downstream the target site (stock: 10μM in 10 mM Tris).

  • Primer set 2:

    • Forward primer, located ~ 200 bp upstream 5′ homology arm (stock: 10μM in 10 mM Tris).

    • Reverse primer, located in the insert, downstream the homology arm (stock: 10μM in 10 mM Tris).

  • Isolated DNA (isolated previously from individual iPSC colonies).

  • Milli-Q water.

  • FastStart™ Taq DNA Polymerase (Roche, 12032902001).

  • 10× PCR buffer + MgCl2 (supplied with FastStart™ Taq DNA polymerase).

  • dNTPs (Invitrogen, 10297-018) (stock: 10 mM in 10 mM Tris pH 8.5 for each nucleotide).

  • 1.5% agarose TAE gel.

    • 1× TAE buffer (40 mM Tris, 20 mM acetic acid, 1 mM EDTA).

    • Agarose (Sigma, A9539).

9.4.2 Procedure

  1. 1.

    Dilute the DNA samples to the required DNA concentration using Milli-Q water.

  2. 2.

    Perform two PCRs as listed below: one using set 1 and one using set 2.

    PCR mix for one reaction

    PCR program

    1.5μL

    10× PCR buffer + MgCl2

    (1)

    96 °C, 4:00

    0.5μL

    dNTPs (10 mM)

    (2)

    96 °C, 0:20

    0.5μL

    Forward primer (10μM)

    (3)

    55–65 °C, 0:30

    0.5μL

    Reverse primer (10μM)

    (4)

    72 °C, 1:00

    1μL

    DNA (<25 ng)

    (5)

    Go to step 2

    34×

    0.5μL

    FastStart Taq

    (6)

    72 °C, 5:00

    10.5μL

    Milli-Q water

    (7)

    10 °C, ∞

    15μL

    Total volume

    (8)

    End

  3. 3.

    Run and visualize both PCRs on a 1.5% agarose TAE gel

9.4.3 Results

Set 1 only results in a product in the absence of the integration on one or both alleles. Upon successful integration, the product becomes too large to amplify under given PCR conditions. Absence of a product for set 1 indicates successful bi-allelic integration. A product for set 2 indicates the integration of the donor template at the desired location, since the primer design ensures that a PCR product can only be formed if the correct integration has occurred.

 

No integration

Mono-allelic integration

Bi-allelic integration

Primer set 1

Product present

Product present

Product absent

Primer set 2

Product absent

Product present

Product present

10 Protocol Adjustments for Feeder-Free hiPSCs

Recently, hiPSC culture protocols have been developed that do not require the presence of MEFs but use adjusted cell culture media. The use of these protocols provide hiPSCs with a more stable environment and results in a higher rate of proliferation compared to feeder-dependent cultures. It is possible to use this CRISPR-Cas9 strategy for hiPSCs in feeder-free conditions with a few minor adaptations to the protocol (see Note 5).

10.1 Generation of Conditioned Media

This section of the protocol does not need to be performed.

10.2 Plating Frozen MEFs

This section of the protocol does not need to be performed.

10.3 Nucleofection of hiPSCs

This section of the protocol has some minor adjustments with regard to the cell culture conditions of the hiPSCs without MEFs.

10.3.1 Materials

  • MTSER PLUS medium (Stem Cell Technologies, 05825).

  • Penicillin/streptomycin (P/S)(Gibco, 15140122).

  • Nucleofector™ 2b Device (Lonza, AAB-1001).

  • Human Stem Cell Nucleofector™ Kit 2 (Lonza, VAPH-5022).

  • DNA prep (prepared previously).

  • Vitronectin XF (Stem cell Technologies, 07180).

  • CellAdhere™ Dilution Buffer (Stem cell Technologies, 07183).

  • 6-well suspension plates (Greiner bio-one, 657185).

  • Revitacell Supplement 100× (Gibco, A2644501).

  • Accutase (Gibco, A11105-01) or TrypLE (Gibco, 12605010).

  • PBS (Gibco, 70011044).

10.3.2 Procedure

  1. 1.

    4 h before starting the nucleofection procedure: replace the medium on the hiPSCs with mTSER PLUS medium supplemented with 1% P/S and 1× Revitacell Supplement.

  2. 2.

    1 h before starting the nucleofection procedure: for each nucleofection reaction, coat two wells of a six-well suspension plates with Vitronectin XF (1:25 diluted in CellAdhere™ Dilution Buffer) and incubate for 1 h at room temperature. After incubation, remove the coating and add 2 mL mTSER PLUS medium to each well.

Perform steps 3 – 15 as stated in Subheading 7 , continue the protocol as follows:

  1. 16.

    Seed the hiPSCs on the Vitronectin XF-coated six-well (2/3 and 1/3 of the cell suspension, respectively).

  2. 17.

    23 h after nucleofection: coat one full six-well suspension culture plate with Vitronecting XF (one plate for each nucleofection reaction).

  3. 18.

    24 h after nucleofection: from one well, detach the hiPSCs from the plate using 500μL TrypLE (preferably the well with the highest confluency, unless the confluency exceeds 80%).

  4. 19.

    Centrifuge the cell suspension at 1000 rpm (200 × g) for 5 min.

  5. 20.

    Resuspend the hiPSCs in 1 mL mTSER PLUS medium supplemented with 1% P/S and 1× Revitacell Supplement.

  6. 21.

    Using a P1000 pipette, reseed the hiPSCs to a confluency of 5% in the first well, and continue diluting the hiPSCs by a factor 2 for each following well in order to be able to obtain single-cell colonies.

  7. 22.

    48 h after transfection: replace the medium on the hiPSCs with mTSER PLUS medium supplemented with 1% P/S and refresh daily. Selection with G418 can be started now if a donor template is used.

  8. 23.

    6–14 days after nucleofection: single colonies can be picked, depending on the cell density, recovery speed of the cells, and use of selection. See Note 7. 

10.4 Picking Colonies

This section of the protocol follows a different procedure.

10.4.1 Materials

  • mTSER PLUS medium (Stem Cell Technologies, 05825).

  • Penicillin/streptomycin (P/S) (Gibco, 15140122).

  • Vitronectin XF (Stem cell Technologies, 07180).

  • CellAdhere™ Dilution Buffer (Stem cell Technologies, 07183).

  • 48-well suspension plates (Greiner bio-one, 677102).

10.4.2 Procedure

  1. 1.

    1 h before picking: for each nucleofection reaction, coat two full 48-well suspension plates with Vitronectin XF (1:25 diluted in CellAdhere™ Dilution Buffer) and incubate for 1 h at room temperature. One plate will be used for DNA isolation and one plate for passaging.

  2. 2.

    Before picking colonies: prepare 1 × 48 well plate by remove the coating from the wells and add 500μL mTSER PLUS medium supplemented with 1% P/S and 1× Revitacell Supplement to all wells of the plate.

  3. 3.

    Rinse the hiPSCs with 1 mL PBS and add 2 mL mTSER PLUS medium supplemented with 1% P/S.

  4. 4.

    Using P1000 pipette, gently scrape the selected colony with the pipet tip, once partly detached use the P1000 pipette to transfer the hiPSCs to a well containing 500μL medium.

  5. 5.

    Repeat until all the selected single colonies are picked.

  6. 6.

    Remove the coating from the wells from the second plate.

  7. 7.

    Dissociate the picked colonies by pipetting up and down using a P1000 pipette. Transfer 250μL of the suspended cells to a well on the second plate and leave the remaining 250μL in the original plate. Culture both plates at 37 °C/5% CO2.

  8. 8.

    Refresh the media and monitor the colonies daily until passaging or harvesting DNA for genotyping.

11 Troubleshooting

Problem

Possible cause and suggestions

Low number of colonies after nucleofection

Number of cells used in the nucleofection reaction was too low

• Increase the number of cells used for nucleofection

Cells died during the nucleofection

• Pretreat the hiPSCs with Revitacell Supplement

• Use conditioned media without antibiotics

• Be gentle during the handling of single-cell iPSCs

• Reduce the amount of time that the cells spend in the Human Stem Cell Nucleofector mix to a minimum

Only untargeted colonies

Poor plasmid quality

• Check plasmid integrity

Human Stem Cell Nucleofector mix is expired

• Use freshly made Human Stem Cell Nucleofector mix

sgRNA target not present

• Sequence the target site for variants, design multiple sgRNA per targeting.

Targeting of the gene is lethal to the cells

Bad sgRNA design, too many off-target events after nucleofection

• Use in silico prediction algorithms to predict off-target effects

Poor morphology of colonies after nucleofection

Poor morphology of cells before nucleofection

• Use hiPSC with a low passage number

• Remove all differentiation before nucleofection

Differentiation after nucleofection

• Add fresh bFGF to the conditioned media

• Refresh the hiPSC media daily

No single-cell colonies

Plating density after nucleofection too high

• Decrease plating density after nucleofection

• Use multiple plating densities

No single-cell passaging during nucleofection

• Ensure hiPSCs are single cells before nucleofection

Only mono-allelic targeted cells

Bi-allelic targeting is lethal to the cells

No colonies after G418 selection

G418 concentration too high

• Perform a kill curve to determine the optimal G418 concertation

High number of negative colonies after G418 selection

G418 concentration too low

• Perform a kill curve to determine the optimal G418 concertation

MEF viability decreases during selection with G418

MEFs not resistant to G418

• Use G418 resistant MEFs

Optimal G418 concentration for hiPSCs is too high for MEFs

• Add fresh MEFs to the well when the density of MEFs drops below 50%

12 Notes

  1. 1.

    Once a target sequence has been introduced into the pCRII-BbsI-sgRNA scaffold plasmid, both BbsI restriction sites are no longer present. Therefore, the plasmid containing the sgRNA cannot be reused to clone an alternative sgRNA .

  2. 2.

    The plasmid is now ready to serve as donor vector for the insertion of the cDNA of choice in the AAVS1 site. If desired, the cDNA can be inserted at a different genomic site of choice. In this case, the homology arms should be adjusted accordingly using the KpnI and HindIII sites for the 5′ and 3′ homology arms, respectively. The size of the homology arms is typically 500 bp to 1 kb in length. It is advised to double check that the targeting sequence is present without SNPs in the iPSCs used for the experiment, otherwise targeting efficiency will be reduced.

  3. 3.

    This donor plasmid uses neomycin as a selection marker in iPSCs. Prior to applying selection with G418, a kill curve should be made for each cell line to determine the optimal concentration.

  4. 4.

    Each nucleofection reaction requires approximately 20 mL of conditioned medium.

  5. 5.

    All steps should be performed in a cell culture hood to avoid contamination and maintain sterility.

  6. 6.

    It is recommended to perform the following steps for one reaction at a time.

  7. 7.

    A new kill curve may be required to determine the optimal G418 concentration in feeder free hiPSCs.