Isolation of Fungal Infection Structures from Plant Tissue by Flow Cytometry for Cell-Specific Transcriptome Analysis

  • Hiroyuki Takahara
  • Elmar Endl
  • Richard O’Connell
Protocol
Part of the Methods in Molecular Biology book series (MIMB, volume 729)

Abstract

Many plant pathogenic fungi differentiate a series of highly specialized infection structures to invade and colonize host tissues. Especially at early stages of infection, the ratio of fungal to plant biomass is very low. To investigate cell-specific patterns of gene expression, it is necessary to purify the fungal structures of interest from infected plants. We describe here a method to isolate the biotrophic hyphae of Colletotrichum higginsianum from Arabidopsis leaves, based on a combination of pre-enrichment by isopycnic centrifugation followed by further purification by fluorescence-activated cell sorting. This protocol efficiently eliminates contamination by plant components and nontarget fungal cell-types. Moreover, the isolated cells remain alive, providing high-quality RNA for library construction. The method can be readily adapted for cell-specific transcriptome analysis in other plant–microbe interactions.

Key words

Fluorescence-activated cell sorting Flow cytometry Colletotrichum higginsianum Arabidopsis thaliana Biotrophy Transcriptome 

1 Introduction

To successfully penetrate and colonize host tissues, many plant pathogenic fungi sequentially produce a whole series of highly specialized cell-types or “infection structures.” In the case of some biotrophic parasites, feeding structures called haustoria or intracellular hyphae develop inside living plant cells, after penetration through the plant cell wall (1). The construction of cDNA libraries is a powerful approach for identifying genes that are differentially expressed at specific stages of fungal morphogenesis and plant infection (2, 3, 4, 5). However, sampling the transcriptome of infection structures formed in planta is hindered by the low ratio of fungal to plant biomass, especially at early stages of infection. In order to investigate cell-specific patterns of gene expression, it is necessary to isolate the fungal structures of interest from infected plants.

Previously, fungal structures have been isolated from plants using techniques such as density gradient centrifugation, lectin affinity chromatography, immunomagnetic separation, and laser capture microdissection (6, 7, 8, 9). Fluorescence-activated cell sorting (FACS) is a form of flow cytometry that allows a heterogeneous mixture of cells to be sorted, one cell at a time, based on their specific light-scattering and fluorescence characteristics (10). However, although FACS is widely used in animal and plant cell biology for cell-specific expression profiling (11, 12, 13, 14), it has rarely been applied to plant pathogens. In this chapter, we present a protocol for isolating the biotrophic hyphae of Colletotrichum higginsianum from infected Arabidopsis leaves, based on a combination of isopycnic centrifugation and FACS. The work-flow is summarized schematically in Fig. 1a. We expect that the method can be modified for isolating the infection structures of many other plant pathogens.
Fig. 1.

Isolation of Colletotrichum infection hyphae from Arabidopsis plants. (a) Work-flow of the isolation procedure. Fungal hyphae are first released from infected leaves by homogenization, then pre-enriched by isopycnic centrifugation, stained with a green fluorescent vital dye, and purified by FACS. A appressorium, S spore, H hypha, C chloroplast. (b, c  ) Dot plot cytograms showing the gating strategy used for sorting. Cells combining strong green fluorescence (R1) and high forward- and side-scatter (R2) were selected. (d  ) Light micrograph showing hyphae purified by FACS. Reproduced from ref. 15 with permission from Blackwell Publishing Ltd.

Fungal hyphae are first released from host epidermal cells by mechanical homogenization and then partially enriched by isopycnic centrifugation. This pre-enrichment step is crucial to minimize the sorting time required for the subsequent FACS purification (see 1). The density gradient medium used for centrifugation is Percoll, a colloidal suspension of silica particles coated with polyvinylpyrrolidone, which has low osmolarity and is nontoxic toward cells (8). Cell sorting is based on the specific labeling of intact, viable hyphae by a green fluorescent vital dye, and fluorescein diacetate, while contaminating plant chloroplasts are removed on the basis of their red autofluorescence (15) (Fig. 1b). Other fluorescent markers could be used in place of FDA, for example, fluorescent reporter proteins (in the case of fungi that can be genetically transformed) and fluorochrome-tagged lectins or antibodies that label cell-specific surface epitopes (7, 16, 17).

Nearly all the cells isolated by our method remain alive, so that high-quality RNA can be extracted for cDNA library construction or expression profiling experiments (Fig. 2). Moreover, cell sorting efficiently eliminates contamination by plant components and nontarget fungal cell-types, yielding hyphae with 94% purity, on average (15) (Fig. 1d). This provides an enormous enrichment of mRNA from a single fungal cell type, and deep-sequencing of a cDNA library prepared from FACS-purified hyphae with Roche 454 GS FLX technology revealed that out of 404,000 ESTs only 0.03% had homology to plant sequences (unpublished data). The isolation method is invasive and takes approximately 1.5 h to complete. In order to minimize transcriptional changes, we perform all steps of the procedure at or below 4°C and limit cell sorting runs to 30-min duration. Libraries prepared from the FACS-isolated hyphae appear to accurately represent the fungal transcriptome in planta, because out of 78 C. higginsianum genes selected from a cDNA library, all were expressed at the equivalent stage of plant infection (15) (unpublished data). Nevertheless, we cannot exclude the possibility that transcript levels are modified during isolation, and while the method is a powerful tool for gene discovery, it may be less suitable for expression profiling.
Fig. 2.

Assessment of quality and quantity of total RNA extracted from FACS-purified hyphae of Colletotrichum higginsianum. (a) Bioanalyzer electropherogram showing a low baseline and high, narrow peaks corresponding to the 28S and 18S ribosomal RNAs. The 28S:18S ratio  =  1.8, indicating good RNA integrity. The first peak represents a 50-bp marker (arrow  ) added to the sample. (b) Corresponding capillary gel electrophoresis images, showing the DNA sizing ladder (M) and total RNA extracted from FACS-purified hyphae (H). Reproduced from ref. 15 with permission from Blackwell Publishing Ltd.

2 Materials

2.1 Culture Medium for Colletotrichum

  1. 1.

    Mathur’s agar medium: dissolve 2.8 g glucose, 1.22 g MgSO4  ⋅  7H2O, 2.72 g KH2PO4, 2.18 g mycological peptone (Oxoid Ltd, Basingstoke, UK), and 30 g agar in 1 L deionized water. Dispense 100 mL aliquots into 250-mL Erlenmeyer flasks, seal with a cotton wool plug, cover with aluminum foil, and autoclave. Allow the flasks to cool on a flat surface.

     

2.2 Fungal and Plant Materials

  1. 1.

    Fungal strain: C. higginsianum IMI 349063 (CABI-Europe, Egham, UK).

     
  2. 2.

    Susceptible Arabidopsis thaliana accession: Columbia-0 glabrous mutant Col-gl1-1 (WT-1, Lehle Seeds Round Rock, TX) (see 2).

     

2.3 Stock Solutions

  1. 1.

    10× Isolation buffer: 2 M sucrose in 0.2 M 3-(N-morpholino)propane sulfonic acid (MOPS) buffer, pH 7.2. Store at −20°C.

     
  2. 2.

    1× Isolation buffer: one part 10× isolation buffer diluted with nine parts of sterile deionized water. Store at 4°C.

     
  3. 3.

    Percoll stock solution: one part 10× isolation buffer mixed with nine parts of Percoll (Sigma, St. Louis, MO). Store at 4°C.

     
  4. 4.

    Percoll working solution: 5 mL Percoll stock solution mixed with 5.93 mL of 1× isolation buffer to produce a specific gravity of 1.085 g/mL. Store at 4°C.

     
  5. 5.

    Fluorescein diacetate vital dye: 5 mg/mL stock solution of fluorescein diacetate (FDA; Sigma) in acetone. Store at −20°C. Prepare a working solution (0.01% w/v) in 1× isolation buffer immediately before use.

     
  6. 6.

    FACSFlow phosphate-buffered saline sheath solution (BD Bioscience).

     
  7. 7.

    70% (v/v) Ethanol in deionized water.

     

2.4 Molecular Biology Kits and Reagents

  1. 1.

    PicoPure RNA isolation kit (Arcturus Bioscience).

     
  2. 2.

    RNA 6000 Pico assay kit (Agilent Technologies).

     
  3. 3.

    SMART PCR cDNA synthesis kit (Takara Bio-Clontech).

     
  4. 4.

    RNase-free DNase I solution (Qiagen).

     
  5. 5.

    QIAquick PCR purification Kit (Qiagen).

     

2.5 Other Supplies

  1. 1.

    Nylon mesh, 40- and 50-μm pore size (Bückmann GmbH, Germany).

     
  2. 2.

    Polystyrene Petri dishes, 145-mm diameter (Greiner Bio-One).

     
  3. 3.

    Falcon polypropylene centrifuge tubes, 50-mL (BD Bioscience).

     
  4. 4.

    Glass round-bottomed FACS tubes, 6-mL (BD Bioscience).

     

3 Methods

3.1 Plant Growth and Inoculation

  1. 1.

    Culture C. higginsianum for 10–12 days at 25°C on Mathur’s medium and harvest conidia (spores) by adding 10 mL of sterile deionized water to the culture flask and shaking vigorously. Adjust the concentration of the spore suspension to 5  ×  106 spores/mL, using a hemocytometer slide to count the cells.

     
  2. 2.

    Grow Arabidopsis plants for 5–6 weeks in a peat-based compost using a controlled-environment chamber (10-h light period, 180 μE/m2/s, 23°C, 65% humidity).

     
  3. 3.

    Excise the fully expanded rosette leaves and arrange 15–20 leaves in the base of a large Petri dish (145-mm diameter). Inoculate the lower (abaxial) leaf surface with approximately 100–200 μL of conidial suspension, using small pieces (1  ×  2 cm) of 50-μm nylon mesh and an artist’s brush to evenly distribute the liquid across the hydrophobic leaf surface (see 3).

     
  4. 4.

    Line the lid of the Petri dish with wet tissue paper, seal the dish with Parafilm to maintain 100% humidity, and incubate in the dark at 25°C for 40 h (see 4).

     

3.2 Isopycnic Centrifugation

Buffer solutions should be ice-cold, and all homogenization and filtration steps should be performed in a cold room.
  1. 1.

    Remove ungerminated conidia from the leaf surface by rinsing in 1 L of deionized sterile water in a beaker.

     
  2. 2.

    Blot off surplus water using tissue paper and place approximately 500 leaves (60 g fresh weight) into the precooled jar of a Waring blender (or similar) together with 200 mL of 1× isolation buffer. Homogenize at high speed for 1 min (see 5).

     
  3. 3.

    Filter the homogenate through 50-μm nylon mesh to remove plant cell wall debris and collect the filtrate in a precooled beaker.

     
  4. 4.

    Re-homogenize material retained on the filter in 100 mL of 1× isolation buffer for 1 min, re-filter, and rinse the residue with a further 100-mL buffer. Pool the filtrates from steps 3 and 4, giving 400 mL in total.

     
  5. 5.

    Transfer the pooled filtrate into eight 50-mL Falcon tubes and centrifuge at 1,080  ×  g for 15 min at 4°C in a refrigerated centrifuge equipped with a swing-out rotor.

     
  6. 6.

    Discard the supernatants and resuspend each pellet in 5 mL of 1× isolation buffer.

     
  7. 7.

    Using a Pasteur pipette, slowly layer the cell suspensions onto 5-mL aliquots of 1.085 g/mL Percoll working solution in eight 50-mL Falcon tubes (see 6). The cell suspension should float on top of the Percoll “cushion.” Take care to avoid mixing at the interface between the two layers.

     
  8. 8.

    Centrifuge the tubes at 720  ×  g for 15 min at 4°C with no braking (see 7). Using a Pasteur pipette, carefully remove the upper aqueous layer and the dense green layer of chloroplasts floating above the Percoll cushion (see 8).

     
  9. 9.

    Dilute each Percoll cushion to 50 mL with 1× isolation buffer and centrifuge at 1,080  ×  g for 15 min at 4°C.

     
  10. 10.

    Using a Pasteur pipette connected to a vacuum pump, remove and discard the supernatants. Resuspend the pellets in 1 mL 1× isolation buffer and pool them together.

     
  11. 11.

    Estimate the concentration of all cell types/particles present in the suspension, including contaminants such as plant chloroplasts, using a hemocytometer slide. Optionally, check cell viability by fluorescence microscopy after staining with 0.01% (w/v) FDA (see 9).

     
  12. 12.

    Maintain the sample on ice until ready to start cell sorting.

     

3.3 Fluorescence-Activated Cell Sorting

The sorting parameters given below are optimized for the FACS DiVa cell sorter (BD Bioscience), which has a “stream-in-air” flow system. However, the strategy used for detection and sorting should be applicable to instruments from other manufacturers. Cell sorting is performed using excitation from a laser emitting 150 mW at 488 nm. Forward- and side-scatter signals are collected through 488/10 nm band-pass filters. Green fluorescence emission from fluorescein diacetate is collected with a 530/20-nm band-pass filter and the red autofluorescence of chloroplasts with a 630/22-nm band-pass filter. All pulses are displayed on a logarithmic scale to obtain the full dynamic range. Preliminary studies should be performed on stained samples to optimize threshold and gain settings for the forward- and side-scatter detectors.
  1. 1.

    Increase sensitivity of the forward- and side-scatter detectors until electronic noise and impurities in the sheath fluid are detected. Then decrease sensitivity to just above background.

     
  2. 2.

    Dilute the sample with 1× isolation buffer to obtain a suspension in which the total concentration of all cells/particles (including chloroplasts and other contaminants) is in the range 2.5–5.0  ×  106/mL. The target cells (biotrophic hyphae) should comprise 5–10% of the total particles present in the sample.

     
  3. 3.

    Filter the sample using a 40-μm pore size nylon mesh to remove any large particles or aggregates, such as plant cell wall fragments, which could block the injection nozzle and disrupt the flow stream.

     
  4. 4.

    Immediately prior to analysis, label the living fungal cells by adding FDA stock solution to the sample to give a final concentration of 0.01% (w/v).

     
  5. 5.

    Run the sample on the cell sorter and record a sufficient number of events to see fluorescein-labeled fungal cells and autofluorescent chloroplasts in a display of green versus red fluorescence (Fig. 1b). Adjust the spill-over of fluorescein fluorescence into the red channel using standard procedures to compensate for spectral overlap.

     
  6. 6.

    Set a region of interest (R1) on the cells exhibiting green fluorescence in a two-parameter display of the fluorescence signals, and then use the software to display these events in a dot plot of forward- versus side-scatter (Fig. 1c).

     
  7. 7.

    Apply a second region of interest (R2) in the forward- versus side-scatter plot that includes most the hyphae identified in step 6. An appropriate combination of regions R2 and R1 is used to precisely define the population of fluorescein-labeled hyphae for subsequent cell sorting (see 10). Verify the purity of sorted cells by collecting a sample of the positive flow stream onto a slide and view with light microscopy (Fig. 1d).

     
  8. 8.

    Sort the sample using a 90-μm injection nozzle at an event rate of 5,000/s, with the sort mode optimized for purity and a sheath fluid pressure of 25 psi. Make use of the mechanical agitator to prevent settling and aggregation of the cells, and the water-cooling system to maintain the cells at 4°C during sorting.

     
  9. 9.

    Collect the sorted cells into glass FACS tubes containing 2 mL 1× isolation buffer.

     
  10. 10.

    Transfer the cells into RNase-free 1.5-mL Eppendorf tubes and centrifuge at 5,000  ×  g for 10 min. Remove the supernatant, snap-freeze the pellet in liquid nitrogen, and store at −80°C.

     

3.4 RNA Extraction and Quality Assessment

The cell sorting protocol described above yields a relatively small number of cells (approximately 4  ×  105 in a typical experiment). We present here a method for extracting total RNA based on the PicoPure RNA isolation kit (Arcturus Bioscience), which is suitable for recovering total RNA from single cells or laser capture microdissection samples, as well as larger samples containing up to 100 μg RNA.
  1. 1.

    Pipette 100 μl of PicoPure Extraction Buffer into tubes containing a frozen pellet of sorted cells and resuspend by gentle pipetting.

     
  2. 2.

    Incubate the cell suspension at 42°C for 30 min (see 11).

     
  3. 3.

    Centrifuge at 3,000  ×  g for 2 min to remove cell debris and transfer the supernatant into a fresh RNase-free Eppendorf tube.

     
  4. 4.

    Add an equal volume (approx. 100 μL) of 70% ethanol and mix thoroughly by pipetting.

     
  5. 5.

    Proceed with the RNA isolation according to the manufacturer’s instructions. Remove any contaminating genomic DNA by treatment with RNase-free DNase I (Qiagen).

     
  6. 6.

    Elute the total RNA from the Picopure Purification Column using the minimum recommended volume of Elution Buffer (11 μL).

     
  7. 7.

    Use a 2-μL aliquot to estimate the quality and quantity of the extracted RNA using an Agilent 2100 Bioanalyzer with the RNA 6000 Pico assay kit (Fig. 2), according to the manufacturer’s instructions (see 12).

     
  8. 8.

    Store the RNA at −80°C until starting cDNA library preparation.

     

3.5 cDNA Library Construction

Using the RNA extraction procedure described above, it is possible to obtain approximately 0.55 μg of total RNA from 4  ×  105 FACS-purified biotrophic hyphae. To generate an amplified, oligo-dT-primed cDNA library, the SMART PCR cDNA synthesis kit (Takara Bio-Clontech) can be used according to the manufacturer’s instructions with some minor modifications.
  1. 1.

    As starting material for first-strand cDNA synthesis, use 150 ng of total RNA in a total reaction volume of 10 μL.

     
  2. 2.

    Use a 2-μL aliquot from the first-strand synthesis for subsequent PCR amplification in a total reaction volume of 100 μL. Determine the optimal number of PCR cycles by agarose gel electrophoresis (see 13).

     
  3. 3.

    Purify the amplified cDNAs using the QIAquick PCR purification Kit (Qiagen).

     
  4. 4.

    Digest the purified cDNAs with ScaI to cleave the 3′ end of the oligo-dT adaptor sequences (see 14).

     
  5. 5.

    After further purification using the QIAquick Kit and A-Tailing by DNA polymerase in the presence of dATP, clone the cDNAs into the pGEM-T Easy vector (Promega) and transform them into Escherichia coli DH5α competent cells.

     

4 Notes

  1. 1.

    The time required to sort a given number of target cells is directly related to their concentration in the sample mixture (10). For example, at a sort rate of 10,000 events per second, it would take 47 min to sort 106 target cells from a mixture in which they comprise 1% of the total, but only 17 min if they comprise 10% of the total.

     
  2. 2.

    Brush-inoculation of excised Arabidopsis leaves with fungal spore suspension is facilitated by use of the Col-0 glabrous mutant, which lacks trichomes.

     
  3. 3.

    These conditions result in heavy infection, where most Arabidopsis epidermal cells contain ten or more biotrophic hyphae of Colletotrichum. For other plant–fungal inter­actions, optimize the inoculation conditions to obtain the maximum possible number of target infection structures in the plant tissue available for extraction.

     
  4. 4.

    Apply the inoculum and seal the Petri dish as quickly as possible to avoid dessication of the excised leaves. Incubation of the inoculated leaf tissue in the dark facilitates later removal of plant chloroplasts by isopycnic centrifugation, probably by increasing their buoyant density. At 40 h after inoculation, most infections should consist of biotrophic hyphae inside host epidermal cells. Verify this by light microscopy as follows: clear the leaf tissue for 30 min in a 1:3 mixture of chloroform:ethanol, mount in lactophenol under a coverslip, and view with differential interference contrast microscopy.

     
  5. 5.

    Mechanical homogenization is used to release the fungal structures from plant tissue. Bulbous determinate structures, such as fungal haustoria and intracellular hyphae, and unicellular structures, such as spores and yeast cells, survive this process and can be isolated intact. However, long filamentous hyphae are likely to be fragmented, resulting in loss of cytoplasm unless retained between septa.

     
  6. 6.

    The choice of density for the Percoll cushion depends on the buoyant density of the cells of interest. To optimize the method for infection structures of other fungal pathogens, layer the tissue homogenate onto a stepped density gradient comprising five steps of 1.040, 1.065, 1.090, 1.115, and 1.140 g/mL Percoll. After centrifugation, determine by microscopy in which Percoll layer the target cells are concentrated.

     
  7. 7.

    Avoid rapid braking of the centrifuge rotor, which results in mixing between the Percoll layer and plant debris floating above it.

     
  8. 8.

    During aspiration, take care to avoid transferring parts of the compacted chloroplast layer into the Percoll. Try to remove as little of the Percoll layer as possible because this contains the cells of interest.

     
  9. 9.

    Cells stained by FDA retain cytoplasmic esterase activity and an intact plasma membrane (18).

     
  10. 10.

    The threshold and sensitivity for forward- and side-scatter detectors should be adjusted so that all events, including chloroplasts and other small particles, are identified. If the threshold is set too high, the instrument will ignore events that might be crucial for the correct sorting decision, resulting in greater contamination. For purifying infection structures of fungi other than Colletotrichum, it will be necessary to optimize the forward- and side-scatter settings according to their size and optical properties.

     
  11. 11.

    Incubation in the PicoPure Extraction Buffer efficiently recovers total RNA from C. higginsianum hyphae without any mechanical disruption of the cells. Other RNA extraction methods, such as TRIzol reagent (Invitrogen), could be used if a larger number of cells are available.

     
  12. 12.

    Assess total RNA integrity by inspecting the Agilent Bioanalyzer electropherogram. Intact RNA should present 18S and 28S ribosomal RNA peaks that are high and narrow, with a 28S:18S ratio between 1.8 and 2.0 (19). Low baseline fluorescence also indicates the absence of RNA degradation products. If available, use the Agilent software to determine the RNA integrity number.

     
  13. 13.

    Perform PCR amplification with a range of cycle numbers, for example, 15, 18, 21, and 24, and electrophorese 5-μL aliquots of the products.

     
  14. 14.

    The supplied 3′ BD SMART CDS primer II A contains a ScaI site (AGTACT) just after the oligo-dT(30) sequence (AAGCAGTGGTATCAACGCAGAGTACT(30)VN-3′). This site is present in the 3′ oligo-dT primer but is absent from the 5′ oligonucleotide primer. Even after bidirectional cloning into the cloning vector, it is therefore possible to perform directional sequencing from the 5′ end using the 5′ PCR Primer II (AAGCAGTGGTATCAACGCAGAGT).

     

Notes

Acknowledgments

The authors thank Andreas Dolf and Peter Wurst for expert technical assistance with flow cytometry. This work was supported by funding from the Max Plank Gesellschaft and Deutsche Forschungsge­mein­schaft (Grant OC104/1-1, SPP1212-PlantMicro).

References

  1. 1.
    O’Connell, R. J. and Panstruga, R. (2006) Tête à tête inside a plant cell: establishing compatibility between plants and biotrophic fungi and oomycetes. New Phytol. 171, 699–718.PubMedCrossRefGoogle Scholar
  2. 2.
    Hahn, M. and Mendgen, K. (1997) Characterization of in planta-induced rust genes isolated from a haustorium-specific cDNA library. Mol. Plant Microbe Interact. 10, 427–37.PubMedCrossRefGoogle Scholar
  3. 3.
    Catanzariti, A. M., Dodds, P. N., Lawrence, G. J., Ayliffe, M. A., and Ellis, J. G. (2006) Haustorially expressed secreted proteins from flax rust are highly enriched for avirulence elicitors. Plant Cell 18, 243–56.PubMedCrossRefGoogle Scholar
  4. 4.
    Kleemann, J., Takahara, H., Stuber, K., and O’Connell, R. J. (2008) Identification of soluble secreted proteins from appressoria of Colletotrichum higginsianum by analysis of expressed sequence tags. Microbiology 154, 1204–17.PubMedCrossRefGoogle Scholar
  5. 5.
    Soanes, D. M. and Talbot, N. J. (2006) Comparative genomic analysis of phytopathogenic fungi using expressed sequence tag (EST) collections. Mol. Plant Pathol. 7, 61–70.PubMedCrossRefGoogle Scholar
  6. 6.
    Mackie, A. J., Robert, A. M., Callow, J. A., and Green, J. R. (1991) Molecular differentiation in pea powdery mildew haustoria-identification of 62 kDa N-linked glycoprotein unique to the haustorial plasma membrane. Planta 183, 399–408.CrossRefGoogle Scholar
  7. 7.
    Hahn, M. and Mendgen, K. (1992) Isolation by ConA binding of haustoria from different rust fungi and comparison of their surface qualities. Protoplasma 170, 95–103.CrossRefGoogle Scholar
  8. 8.
    Pain, N. A., Green, J. R., Gammie, F., and O’Connell, R. J. (1994) Immunomagnetic isolation of viable intracellular hyphae of Colletotrichum lindemuthianum from infected bean leaves using a monoclonal antibody. New Phytol. 127, 223–32.CrossRefGoogle Scholar
  9. 9.
    Tang, W., Coughlan, S., Crane, E., Beatty, M., and Duvick, J. (2006) The application of laser microdissection to in planta gene expression profiling of the maize anthracnose stalk rot fungus Colletotrichum graminicola. Mol. Plant Microbe Interact. 19, 1240–50.PubMedCrossRefGoogle Scholar
  10. 10.
    Fisher, D., Francis, G. E., and Rickwood, D. (1998) Cell Separation: A Practical Approach. Oxford University Press, Oxford, UK.Google Scholar
  11. 11.
    Birnbaum, K., Jung, J. W., Wang, J. Y., Lambert, G. M., Hirst, J. A., Galbraith, D. W., and Benfey, P. N. (2005) Cell type-specific expression profiling in plants via cell sorting of protoplasts from fluorescent reporter lines. Nat. Methods 8, 615–19.CrossRefGoogle Scholar
  12. 12.
    Galbraith, D. W. and Birnbaum, K. (2006) Global studies of cell type-specific gene expression in plants. Annu. Rev. Plant Biol. 57, 451–75.PubMedCrossRefGoogle Scholar
  13. 13.
    Lobo, M. K., Karsten, S. L., Gray, M., Geschwind, D. H., and Yang, X. W. (2006) FACS-array profiling of striatal projection neuron subtypes in juvenile and adult mouse brains. Nat. Neurosci. 9, 443–52.PubMedCrossRefGoogle Scholar
  14. 14.
    Shigenobu, S., Arita, K., Kitadate, Y., Noda, C., and Kobayashi, S. (2006) Isolation of germ­line cells from Drosophila embryos by flow cytometry. Dev. Growth Differ. 48, 49–57.PubMedCrossRefGoogle Scholar
  15. 15.
    Takahara, H., Dolf, A., Endl, E., and O’Connell, R. (2009) Flow cytometric purification of Colletotrichum higginsianum biotrophic hyphae from Arabidopsis leaves for stage-specific transcriptome analysis. Plant J. 59, 672–83.PubMedCrossRefGoogle Scholar
  16. 16.
    Czymmek, K. J., Bourett, T. M., and Howard, R. J. (2005) Fluorescent protein probes in fungi. In: Savidge T, Pothoulakis C, eds. Methods in Microbiology, Vol. 34. Microbial Imaging Elsevier, Amsterdam, 27–62.Google Scholar
  17. 17.
    Pain, N. A., O’Connell, R. J., Mendgen, K., and Green, J. R. (1994) Identification of glycoproteins specific to biotrophic intracellular hyphae formed in the Colletotrichum–bean interaction. New Phytol. 127, 233–42.CrossRefGoogle Scholar
  18. 18.
    Rotman, B. and Papermaster, B. W. (1966) Membrane properties of living mammalian cells as studied by enzymatic hydrolysis of fluorogenic esters. Proc. Natl. Acad. Sci. USA 55, 134–41.PubMedCrossRefGoogle Scholar
  19. 19.
    Sambrook, J. and Russel, D. W. (2001) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.Google Scholar

Copyright information

© Springer Science+Business Media, LLC 2011

Authors and Affiliations

  • Hiroyuki Takahara
    • 1
  • Elmar Endl
    • 2
  • Richard O’Connell
    • 3
  1. 1.Department of Bioproduction ScienceIshikawa Prefectural UniversityIshikawaJapan
  2. 2.Institutes of Molecular Medicine and Experimental ImmunologyUniversity of BonnBonnGermany
  3. 3.Department of Plant–Microbe InteractionsMax-Planck-Institute for Plant Breeding ResearchKölnGermany

Personalised recommendations