Advertisement

Determining Macrophage Polarization upon Metabolic Perturbation

  • Pu-Ste Liu
  • Ping-Chih HoEmail author
Protocol
Part of the Methods in Molecular Biology book series (MIMB, volume 1862)

Abstract

Metabolic reprograming controlling macrophage activation and function is emerging as new regulatory circuit on shaping immune responses. Generally, lipopolysaccharides (LPS)-induced pro-inflammatory activated macrophages, known as M1 macrophages, display higher glycolysis. In contrast, interleukin-4 (IL-4)-skewed anti-inflammatory activated macrophages, known as M2 macrophages, mainly rely on oxidative phosphorylation for their bioenergetic demands. Emerging evidence reveals that these metabolic preferences further fine-tune macrophage polarization process, including signaling cascades and epigenetic reprogramming. Thus, specific nutrient microenvironments may affect inflammatory responses of macrophages by intervening these metabolic machineries. How to measure the metabolic switch of macrophages both in vitro and in vivo is an important issue for understanding immunometabolic regulations in macrophages. Here, we describe a basic protocol for examining how glutamine metabolism affects macrophage polarization by using the Extracellular Flux (XF(e)96) Analyzer (Seahorse Bioscience), which takes real-time measurements of oxidative phosphorylation and glycolysis. We also present a detailed procedure for detecting the expression of inflammatory genes in polarized macrophages under glutamine-replete or -deprived conditions.

Key words

Macrophage polarization Glutamine metabolism Extracellular flux analyzer Oxygen consumption Extracellular acidification 

1 Introduction

Increasing evidence highlights the roles of macrophage activation and function in maintaining tissue homeostasis as well as in human disease progression [1, 2, 3]. In response to cytokine milieus and environmental stimulations, macrophages could undergo polarization. There are two major functionally polarized states, M1 and M2 macrophages, based on the expressed markers and functional molecules in those macrophages. M1 macrophages are pro-inflammatory and release pro-inflammatory cytokines including IL1β, tumor necrosis factor α (TNF α), IL6 and IL12 for host defense to against microbial infection. M2 macrophages are anti-inflammatory and express anti-inflammatory molecules including arginase I, MrcI, Retnla, and YmI for tissue repairment and restricting helminth infections. Conventionally, macrophage polarization is measured in terms of changes in gene and protein expression of M1 and M2 markers by using qPCR and FACS analysis.

Recent evidence shows the crucial role of metabolic reprogramming in the regulation of M1 and M2 macrophage polarization [4]. The metabolism of LPS-induced M1 macrophages is characterized by higher glycolysis; in contrast, IL4-induced M2 macrophages exhibit oxidative phosphorylation (OXPHOS) for supporting their inflammatory responses. In addition to primary activation signals controlled by cytokines and damage-associated molecular patterns (DAMPs), the availability of nutrients in the microenvironment could also orchestrate the metabolic reprogram for regulation of macrophage activation and function [5]. Hence, the changes of metabolic pathways are not only characteristic of macrophage polarization but also actively participating on macrophage polarization through fine-tuning cellular signals and transcriptional regulations.

The Seahorse Extracellular Flux Analyzer provides a new and useful tool to measure different metabolic phenotypes in cells, specifically in macrophages [6, 7]. By using the Seahorse Extracellular Flux Analyzer, we could measure metabolic flux by simultaneously examining extracellular acidification rate (ECAR, a qualitative indicator of glycolysis), and the rate of oxygen consumption (OCR, a qualitative indicator of OXPHOS). Here, we describe the principle and detailed procedures for examining the effect of glutamine metabolism in polarized macrophages. We outline a protocol for analyzing the changes in mitochondrial respiration and glycolysis. As shown in Fig. 1, we present a detailed protocol for analysis of macrophage polarization, including the following: (1) Isolation of bone marrow and differentiation of bone marrow-derived macrophages (BMDM); (2) Polarizing BMDM and performing the Seahorse Extracellular Flux analysis; (3) Detection of gene expression in polarized macrophages by qPCR.
Fig. 1

Flowchart of the experimental procedures in Seahorse Extracellular Flux Analyzer and RT-qPCR analysis. The dotted boxes indicated the experimental procedures performed on the different or the same day as indicated in this figure

Immunometabolism, a new mechanism for controlling macrophage polarization, opens a new horizon for modulating immune responses, and targeting metabolic machineries represents a promising strategy to treat macrophage-related disease [1, 2, 3]. How metabolic components, including fuel sources and fuel utilization, integrate into regulations of macrophage activation and function remain unclear. Future research studying these metabolic features of macrophages during infection and disease progression will provide more information for elucidating how immunometabolic regulation influences macrophage activation and function. Thus, the Seahorse Extracellular Flux Analyzer provides an easy method for the measurement of metabolic perturbations in real time and helps elucidate the involvement of metabolic processes in macrophage polarization.

Here, we only present the basic protocol for determining metabolic phenotypes in macrophage polarization upon the perturbation of glutamine metabolism. In addition to this basic protocol, there are several modified protocols to determine the energy utilization of macrophages in real time using a Seahorse Extracellular Flux Analyzer. For example, when the assay is running, compounds can be injected through the four injection ports surrounding the sensor. This experimental design could allow evaluation of acute and real-time effects of compounds such as different Toll-like receptor (TLR) ligands, cytokines, metabolic substrates, and activators/inhibitors of signaling pathways on cellular metabolism of polarized macrophages [5, 8].

Mounting evidence reveals that the mitochondrion has a crucial role in macrophage activation and function [9, 10]. Therefore, the ability to identify and quantify the changes in the activity of mitochondrial complexes is important for understanding relationship between the bioenergetics and changes in macrophage polarization. Several publications provide protocols to detect the changes of OCR for measurement of mitochondrial energetics by using the Seahorse Extracellular Flux Analyzer. These technical details and interpretive value of this approach have been well described [11, 12, 13].

Taken together, the Seahorse Extracellular Flux Analyzer offers an in vitro platform for analyzing real-time metabolism processes for polarized macrophages. These rapid, sensitive, and high-throughput Seahorse Extracellular Flux Analyzer methods introduce highly valuable approaches for developing a greater understanding of genetic and epigenetic pathways that regulate cellular metabolism for understanding macrophage biology.

2 Materials

  1. 1.

    C57BL/6 mice, specific-pathogen-free, typically 6–10 weeks old.

     
  2. 2.

    ACK (Ammonium-Chloride-Potassium) lysis buffer (Gibco).

     
  3. 3.

    10- and 20-mL syringes with 25-G needles.

     
  4. 4.

    Surgical scissors (immerse in 70% ethanol).

     
  5. 5.

    50 mL Falcon conical tubes.

     
  6. 6.

    10 cm Petri dish.

     
  7. 7.

    70 μm nylon cell strainer.

     
  8. 8.

    Hemocytometer.

     
  9. 9.

    DMEM cell culture medium: DMEM (high glucose, GlutaMAX™ Supplement) supplemented with 10% FBS and 1% penicillin (100 U/mL) and Streptomycin (100 μg/mL).

     
  10. 10.

    L929 conditional medium: Plate 60% confluent (1–2 × 106) L929 cells in a 175 cm2 flask containing 25 mL of DMEM culture medium. Grow cells in a humidified incubator with 5% CO2 at 37 °C for 6 days. Collect the supernatant and filter through a 0.45 μm filter. Store 50 mL aliquots frozen at −80 °C.

     
  11. 11.

    Glutamine-complete medium preparation: DMEM medium (no phenol red, no Glucose, Glutamine) supplemented with 1 mM sodium pyruvate, 10% dialyzed FBS, 10 mM glucose, 2 mM glutamine and 1% penicillin (100 U/mL) and Streptomycine (100 μg/mL).

     
  12. 12.

    Glutamine-replete medium preparation: DMEM medium (no phenol red, no Glucose, Glutamine) supplemented with 1 mM sodium pyruvate, 10% dialyzed FBS, 10 mM glucose and penicillin (100 U/mL) and Streptomycine (100 μg/mL).

     
  13. 13.

    XFe96 FluxPak (Seahorse Bioscience).

     
  14. 14.

    XF Calibrant (Seahorse Bioscience).

     
  15. 15.

    XFe96 Extracellular Flux Analyzer.

     
  16. 16.

    PBS (phosphate buffered saline, pH 7.4).

     
  17. 17.

    A humidified CO2 incubator.

     
  18. 18.

    An incubator (37 °C) without CO2 supply.

     
  19. 19.

    XF assay medium (pH 7.4): Non-buffered DMEM medium power (Sigma) supplemented with: 10 mM glucose, 2 mM l-glutamine, 1 mM sodium pyruvate.

     
  20. 20.

    10× injection compound mixtures preparation (Table 1).

     
  21. 21.

    Protein lysis buffer:

    RIPA lysis buffer (50 mM Tris–HCl, pH 7.4, 1% NP-40, 0.5% Sodium deoxycholate, 0.1% SDS (Sodium dodecyl sulfate), 150 mM NaCl, 2 mM EDTA) and containing proteinase inhibitor cocktail (Sigma).

     
  22. 22.

    TRIZOL Reagent technical insert (Invitrogen).

     
  23. 23.

    First Strand cDNA synthesis kit (Life Technologies).

     
  24. 24.

    SYBR Green PCR mixture (KAPA Biosystems).

     
  25. 25.

    LightCycler 480 Instrument II machine (Roche Life Science).

     
  26. 26.

    Primers for qRT-PCR amplification (Table 2).

     
Table 1

10× injection compound mixtures preparation

Mixture/injection

Inhibitor compound

Stock concentration

10× Port concentration

Port A

Oligomycin

6 mM

40 μM

Port B

FCCP

50 mM

20 μM

Port C

Rotenone/Antimycin A

100 mM/50 mM

5 μM

Port D

2-deoxyglucose (2DG)

1 M

0.5 M

Table 2

Primers for qPCR amplification

Primers

Sequence

Arg1-F

CTCCAAGCCAAAGTCCTTAGAG

Arg1-R

AGGAGCTGTCATTAGGGACATC

Ym1-F

AGAAGGGAGTTTCAAACCTGGT

Ym1-R

GTCTTGCTCATGTGTGTAAGTGA

Retnla-F

CTGGGTTCTCCACCTCTTCA

Retnla-R

TGCTGGGATGACTGCTACTG

Mrc1-F

CTCTGTTCAGCTATTGGACGC

Mrc1-R

CGGAATTTCTGGGATTCAGCTTC

IL1b-F

TACGGACCCCAAAAGATGA

IL1b-R

TGCTGCTGCGAGATTTGAAG

IL6-F

TAGTCCTTCCTACCCCAATTTCC

IL6-R

TTGGTCCTTAGCCACTCCTTC

Tnfa-F

ACGGCATGGATCTCAAAGAC

Tnfa-R

AGATAGCAAATCGGCTGACG

IL12-F

AATGTCTGCGTGGAAGCTCA

IL12-R

ATGCCCACTTGCTGCATGA

β-actin-F

TCCATCATGAAGTGTGACGT

β-actin-R

TACTCCTGCTTGCTGATCCAC

3 Methods

3.1 Isolation of Bone Marrow and Bone Marrow-Derived Macrophages (BMDM) for Differentiation

  1. 1.

    On day 0, isolate bone marrows from the femur and tibia bone of C57B/6 mice for BMDM differentiation in vitro.

     
  2. 2.

    Sacrifice mice using a CO2 euthanasia chamber and cut off the hind leg above the pelvic-hip joint with scissors.

     
  3. 3.

    Remove the muscles and residual tissues surrounding the hind leg with scissors until the femur and tibia bones can be seen.

     
  4. 4.

    Cut the femur and tibia bones at both ends with scissors. Use a 25-G needle and a 20 mL syringe filled with DMEM medium to flush the bone marrow into a 50 mL Falcon conical tube.

     
  5. 5.

    Pipet the bone marrow cells up and down to bring the cells into a single-cell suspension and pass the cells through a 70 μm nylon cell strainer to remove cell clumps.

     
  6. 6.

    Centrifuge cells at 211 × g for 5 min at 4 °C and aspirate the medium. Then resuspend the cell pellet with 1 mL ACK lysis buffer (for each mouse) . Incubate for 3 min at room temperature and neutralize the lysis buffer by adding 5 mL DMEM medium.

     
  7. 7.

    Centrifuge cells at 211 × g for 5 min at 4 °C. Discard the supernatant and resuspend BM cell pellet with appropriate DMEM medium for the BMDM differentiation process.

     
  8. 8.

    BMDM differentiation: seed BM cells (1–2 × 106) in a 10 cm Petri dish and culture cells in BMDM differentiation media. Incubate cells in a humidified 5% CO2 incubator at 37 °C. BMDM differentiation media is made by mixing 2 mL L929 conditional medium with 8 mL DMEM cell culture medium.

     
  9. 9.

    On day 3 and day 5, remove cell culture medium and add fresh medium containing 2 mL L929 conditional medium and 8 mL DMEM cell culture medium to each dish. Continue incubating in a humidified 5% CO2 incubator at 37 °C. Check BMDM morphology using microscopy (see Note 1 ).

     

3.2 Preparation of Polarized BMDM and Perform the Seahorse Extracellular Flux Analysis

  1. 1.

    On day 7, seed BMDM cells into each well of the XF96 cell culture microplate.

     
  2. 2.

    Remove the older medium from BMDM cells and wash BMDM cells one time with DMEM cell culture medium (see Note 2 ).

     
  3. 3.

    Add 5 mL DMEM cell culture medium and use cell scraper to scrape BMDM cells from the culture dish.

     
  4. 4.

    Collect detached BMDM cells into in a 50 mL Falcon conical tube and centrifuge cells at 211 × g for 5 min at 4 °C. Aspirate the supernatant and resuspend cells in 10 mL DMEM cell culture medium.

     
  5. 5.

    Count the cells using a hemocytometer and adjust the concentration of counted cells to 1 × 106 per mL in DMEM cell culture medium.

     
  6. 6.

    Seed cells into the XF96 cell culture microplate by pipetting 100 μL cell suspension into each well. Each condition should have at least four repeat wells to ensure reproducibility. Incubate the XF96 cell culture microplate in a humidified incubator with 5% CO2 at 37 °C for 18 h to allow cells to attach to the bottom of the well. Leave unseeded four wells (A1, A12, H1, and H12) and add only XF medium in these wells (no cells) as background wells (see Note 3 ).

     
  7. 7.

    Hydrate a Seahorse XF96 Sensor Cartridge for at least 4 h before running assay. Seahorse XF96 Extracellular Flux Assay Kit comprises a sensor cartridge and a utility plate for sensor hydration. Hydrate the cartridge by adding 200 μL PBS (pH 7.4) or XF Calibrant Solution in each well of the utility plate. Place the cartridge back into the utility and submerge the sensors in PBS. Put assembled sensor cartridge with utility plate in a non-CO2 incubator at 37 °C for 18 h before the assay (see Note 4 ).

     

3.3 Polarizing Bone Marrow-Derived Macrophages and Running Extracellular Flux Analysis

  1. 1.

    On day 8, using LPS (100 ng/mL) and IL4 (20 ng/mL) to polarize BMDMs becoming M1 and M2 macrophages in medium with or without glutamine containing medium for 6 h (see Note 5 ).

     
  2. 2.

    Prepare, warm up, and adjust the pH 7.4 of the XF96 assay medium. Incubate the assay medium at 37 °C in the water bath until ready for use (see Note 6 ).

     
  3. 3.

    Gently remove the culture medium from polarized macrophages and add 200 μL XF96 assay medium for washing cells two times by centrifuging the plate at 256 × g for 3 min. After aspirating the media in the last washing step, adding 180 μL of the XF96 assay medium to each well and put the assay plate in a non-CO2 and non-humidified incubator at 37 °C for 18 h before loading this plate into the XF96 Extracellular Flux Analyzer (see Note 7 ).

     
  4. 4.
    Prepare 10× injection compound mixtures for loading port A–D (see Table 1). Without removing the microplate underneath, pipette 10× injection compound mixtures directly into port A–D on the top of the sensor cartridge and the detail for loading as shown in Table 3 (see Note 8 ).
    Table 3

    Compounds for loading the sensor cartridge

    Mixture/injection

    Compounds

    Volume injected during run (μL)

    Final concentration in the assay

    Port A

    Oligomycin

    20

    4 μM

    Port B

    FCCP

    22

    2 μM

    Port C

    Rotenone + Antimycin A

    25

    500 nM

    Port D

    2-DG

    28

    0.05 M

     
  5. 5.

    Incubate cartridge at 37 °C in a non-CO2 incubator while setting up the program in XF96 Extracellular Flux Analyzer.

     
  6. 6.
    Set up the standard program for seahorse run:
    • Calibrate

    • Equilibrate

    • Base line readings (Loop three times):

    • Mix—3 min

    • Wait—2 min

    • Measure—3 min

    • End loop

    • Inject port A (Loop three times):

    • Mix—3 min

    • Wait—2 min

    • Measure—3 min

    • End loop

    • Inject Port B (Loop three times):

    • Mix—3 min

    • Wait—2 min

    • Measure—3 min

    • End loop

    • Inject Port C (Loop three times):

    • Mix—3 min

    • Wait—2 min

    • Measure—3 min

    • End loop

    • End program

    • Inject Port D (Loop three times):

    • Mix—3 min

    • Wait—2 min

    • Measure—3 min

    • End loop

    • End program

     
  7. 7.

    Load the cartridge and assay plate, and run the program (see Note 9 ).

     
  8. 8.

    When the assay is complete, remove all assay medium by centrifuging at 256 × g 3 min (see Note 10 ). Add 100 μL protein lysis buffer to each well and pipette up and down and incubate the plate on ice for 20 min. Take 10 μL of cell lysate for measuring protein concentration by using Bio-Rad protein assay. ECAR and OCR data are normalized by using protein concentration.

     

3.4 Measuring Expression Levels of Markers Associated with M1 and M2 Phenotypes

  1. 1.
    On day 7, seed 4 × 105 BMDMs per well into a 24-well culture plate. Each condition should have three repeat wells to ensure reproducibility. Incubate the 24 well culture plate in a humidified incubator with 5% CO2 at 37 °C for 18 h to allow the cell attach to the bottle of the well.
    1. (a)

      On day 8, stimulating macrophages with LPS (100 ng/mL) and IL4 (20 ng/mL) to polarize becoming M1 and M2 macrophages in medium with or without glutamine for 6 h.

       
    2. (b)

      Aspirate the medium from the 24-well culture plate and lyse cells directly in a culture dish by adding 0.5 mL of TRIZOL reagent per well. Incubate the homogenized sample for 5 min at room temperature (RT) and then transfer the supernatant to a new tube.

       
    3. (c)

      Add 0.2 mL of chloroform into each well, mix, and incubate for 3 min at RT.

       
    4. (d)

      Centrifuge the samples at 18407 × g for 10 min at 4 °C. After centrifugation, the mixture separates into two phases: phenol-chloroform phase and a colorless upper aqueous phase. RNA remains exclusively in the upper aqueous phase. Transfer upper aqueous phase carefully without disturbing the interphase into a fresh tube.

       
    5. (e)

      Add 0.25 mL isopropanol, mix, and centrifuge the samples at 18407 × g for 15 min at 4 °C for RNA precipitation.

       
    6. (f)

      Add 1 mL of 75% ethanol and centrifuge the samples at 5283 × g for 5 min at 4 °C for RNA wash.

       
    7. (g)

      Air dry RNA pellet for 5–10 min, and dissolve RNA in diethylpyrocarbonate (DEPC)-treated water.

       
    8. (h)

      Take 1 μg of total RNA and convert into cDNA using First Strand cDNA synthesis kit (Life Technologies). Perform qPCR in triplicate on a LightCycler 480 Instrument II machine (Roche Life Science) or equivalent instrument using SYBR Green PCR mixture (KAPA Biosystems) or equivalent reagent for quantification of the target gene expression. Relative expression can be normalized to β-actin for each sample. The primers for qRT-PCR amplification are summarized in Table 2.

       
     

3.5 Anticipated Results

Typical patterns of OCR and ECAR of untreated, LPS and IL4 stimulated BMDMs are shown in Fig. 2. OCR should be suppressed after oligomycin treatment, increased after Carbonyl cyanide-4-(trifluoromethoxy)phenylhydrazone (FCCP) injection and returned to the baseline after adding rotenone plus antimycin A. The difference OCR between maximal OCR (upon FCCP stimulation) and basal OCR is known as spare respiratory capacity (SRC), reflecting the mitochondrial flexibility to deal with respiratory stress. IL4 could enhance OCR in M2 macrophages, causing M2 macrophages to display a substantial increase of SRC, whereas LPS-stimulated macrophages have minimal SRC (Fig. 2b). As shown in Fig. 2c, ECAR should increase after treatment with oligomycin, FCCP and rotenone plus antimycin A, but return to baseline after 2-Deoxyglucose (2-DG) treatment. Typically, M1 macrophages, which are characterized by enhanced glycolysis, will display elevated ECAR as compared to naive and IL4-stimulated macrophages. Figure 3 shows the expression levels of M1 and M2 markers in LPS- or IL4-stimulated BMDMs. We also detect whether glutamine metabolism could affect IL4-induced OCR in M2 macrophages (Fig. 4). As shown in Fig. 4a, b, IL-4-treated BMDMs show higher OCR and SRC than untreated BMDMs, whereas IL-4 treatment fails to increase SRC in glutamine-deprived BMDMs. Consistently, the expression of M2 markers is increased in IL-4-treated BMDMs but decreased in glutamine-deprived BMDMs (Fig. 4c).
Fig. 2

Examples of metabolic phenotypes in untreated, LPS, and IL4 polarized BMDMs. (a) The represented result of OCR measurement under indicated treatments in untreated, BMDMsM LPS- or IL4-stimulated BMDMs. (b) IL4-stimulated BMDMs have higher SRC (Spare Respiratory Capacity). SRC = average of basal OCR values − average of maximal OCR values (c) ECAR measured under basal conditions followed by the sequential injection of oligomycin (oligo), FCCP, rotenone plus antimycin (Rot/AA) and 2-DG as indicated in untreated, LPS and IL4 polarized BMDMs. Data are expressed as means ± standard deviation (SD), n = 6 independent experiments. *p < 0.05, unpaired, two-tailed Student’s t-test

Fig. 3

Examples of qPCR analysis of mRNA expression of M1 and M2 marker genes in untreated, LPS and IL4-stimulated BMDMs. Data are expressed as means ± SD representative of three independent experiments with 3 samples per group. *p < 0.05, unpaired, two-tailed Student’s t-test

Fig. 4

Glutamine promotes IL4-induced M2 macrophages activation. (a) OCR and (b) SRC of BMDMs under glutamine-complete or -deprived culture conditions, with or without 6 h IL-4 stimulation before treatment with oligomycin (oligo), FCCP, rotenone plus antimycin (Rot/AA), and 2-DG. (c) qPCR analysis of mRNA expression of M2 marker genes in BMDMs stimulated with IL-4 under glutamine-complete or -deprived culture conditions for 6 h. Data are expressed as means ± SD representative of three independent experiments with 3 samples per group. *p < 0.05, unpaired, two-tailed Student’s t-test

4 Notes

  1. 1.

    Macrophages appear as adherent cells with the following typical morphology: prominent nucleus with flatly outspread cytoplasm and multiple pseudopodia.

     
  2. 2.

    BMDMs must be washed with DMEM culture medium and cultured in DMEM culture medium in order to exclude L929-conditioned medium.

     
  3. 3.

    To make sure not seeding cells in more than 100 μL in each well of the XF96 cell culture microplate and checking cells were disturbed monolayer by using a microscope. If more volume of seeding cells is used will cause non-monolayer distribution and thereby reducing accuracy of the measurement.

     
  4. 4.

    Do not incubate the sensor-microplate in a typical cell culture incubator (containing 5% CO2) because CO2 will affect the pH in the calibration solution and cause erroneous ECAR measurements.

     
  5. 5.

    BMDMs must be cultured in medium with or without glutamine for 16 h before stimulating with LPS and IL4 for polarized M1 and M2 macrophages.

     
  6. 6.

    The pH is temperature dependent. pH should be adjusted while the medium is in a 37 °C water bath to maintain the pH of XF assay medium at 37 °C.

     
  7. 7.

    CO2 reacts with H2O to form HCO3 + H+, which acidifies the medium and results in erroneous ECAR measurements.

     
  8. 8.

    It is important to load all ports. For wells not receiving a compound, load the same volume in each port with complete XF Assay Medium.

     
  9. 9.

    After the calibration step, the user will be asked to replace the calibration plate for the cell plate. Make sure that the cell plate is loaded in the correct orientation.

     
  10. 10.

    Check BMDMs with a microscope to determine whether cells remain viable and attached at the bottom of plate. Dead and detached cells will largely affect the readout of this assay and generate weaker ECAR and OCR values.

     

References

  1. 1.
    Na YR, Je S, Seok SH (2018) Metabolic features of macrophages in inflammatory diseases and cancer. Cancer Lett 413:46–58CrossRefGoogle Scholar
  2. 2.
    Di Conza G, Ho P-C (2018) Metabolic adaptation of macrophages in chronic diseases. Cancer Lett 414:250–256CrossRefGoogle Scholar
  3. 3.
    Ho P-C, Liu P-S (2016) Metabolic communication in tumors: a new layer of immunoregulation for immune evasion. J Immunother Cancer 4(1):4CrossRefGoogle Scholar
  4. 4.
    Van den Bossche J, O’Neill LA, Menon D (2017) Macrophage immunometabolism: where are we (going)? Trends Immunol 38(6):395–406CrossRefGoogle Scholar
  5. 5.
    Liu P-S, Wang H, Li X, Chao T, Teav T, Christen S, Di Conza G, Cheng W-C, Chou C-H, Vavakova M (2017) α-ketoglutarate orchestrates macrophage activation through metabolic and epigenetic reprogramming. Nat Immunol 18(9):985PubMedGoogle Scholar
  6. 6.
    van der Windt GJ, Chang CH, Pearce EL (2016) Measuring bioenergetics in T cells using a Seahorse extracellular flux analyzer. Curr Protoc Immunol 113:3.16.B.1–3.16.B. 14CrossRefGoogle Scholar
  7. 7.
    Van den Bossche J, Baardman J (2015) Metabolic characterization of polarized M1 and M2 bone marrow-derived macrophages using real-time extracellular flux analysis. J Vis Exp (105)Google Scholar
  8. 8.
    Huang SC-C, Everts B, Ivanova Y, O’sullivan D, Nascimento M, Smith AM, Beatty W, Love-Gregory L, Lam WY, O’neill CM (2014) Cell-intrinsic lysosomal lipolysis is essential for alternative activation of macrophages. Nat Immunol 15(9):846CrossRefGoogle Scholar
  9. 9.
    Van den Bossche J, Baardman J, Otto NA, van der Velden S, Neele AE, van den Berg SM, Luque-Martin R, Chen H-J, Boshuizen MC, Ahmed M (2016) Mitochondrial dysfunction prevents repolarization of inflammatory macrophages. Cell Rep 17(3):684–696CrossRefGoogle Scholar
  10. 10.
    Liu P-S, Ho P-C (2018) Mitochondria: a master regulator in macrophage and T cell immunity. Mitochondrion 41:45CrossRefGoogle Scholar
  11. 11.
    Nicholas D, Proctor EA, Ip BC, Habib C, Ritou E, Grammatopoulos TN, Steenkamp D, Dooms H, Apovian CM, Lauffenburger DA (2017) Advances in the quantification of mitochondrial function in primary human immune cells through extracellular flux analysis. PLoS One 12(2):e0170975CrossRefGoogle Scholar
  12. 12.
    Salabei JK, Gibb AA, Hill BG (2014) Comprehensive measurement of respiratory activity in permeabilized cells using extracellular flux analysis. Nat Protoc 9(2):421CrossRefGoogle Scholar
  13. 13.
    Perry CG, Kane DA, Lanza IR, Neufer PD (2013) Methods for assessing mitochondrial function in diabetes. Diabetes 62(4):1041–1053CrossRefGoogle Scholar

Copyright information

© Springer Science+Business Media, LLC, part of Springer Nature 2019

Authors and Affiliations

  1. 1.Department of Fundamental Oncology, Faculty of Biology and MedicineUniversity of LausanneEpalingesSwitzerland
  2. 2.Ludwig Lausanne BranchEpalingesSwitzerland
  3. 3.Institute of Cellular and System MedicineNational Health Research InstitutesMiaoli CountyTaiwan

Personalised recommendations