Advertisement

Methods to Study Angiogenesis in a Mouse Model of Prostate Cancer

Protocol
First Online:
  • 882 Downloads
Part of the Methods in Molecular Biology book series (MIMB, volume 1786)

Abstract

Angiogenesis is one important hallmark of cancer progression which explains the relevance of developing methods to efficiently analyze the neo-angiogenic process. In this report we make use of the transgenic adenocarcinoma of the murine prostate (TRAMP) model, considered a good model for studying clinical prostate cancer progression, to describe in detail the methods used to study angiogenesis in this type of solid tumor development. In this report we provide step-by-step procedures on the basis of previous work in our laboratory for: the mouse urogenital sinus (UGS) collection; microdissection of the prostate; preparation of the prostatic samples for immunofluorescence (to analyze vascular density, morphology, maturation, functionality, hypoxia, and others); preparation of prostatic samples to histopathological analysis and/or immunohistochemistry; and endothelial and vascular mural cell sorting and isolation by fluorescent associated cell sorting (FACS) to further analysis (mRNA, protein, or other) or to maintain in culture.

Key words

Prostate cancer TRAMP Tumor angiogenesis Endothelial and vascular mural cells 
Download protocol PDF

1 Introduction

Prostate cancer is the sixth leading cause of cancer death in males worldwide [1] and the second most frequently diagnosed cancer (at 15% of all male cancers) [2]. It is treated by surgery (radical prostatectomy—RP) or radiation if localized at the time of diagnosis. Because it is an androgen-dependent malignancy, if disease relapse occurs androgen deprivation therapy (ADT) is also used [3]. However, prostatic cancer cells can adapt to androgen-depleted conditions and patients inevitably progress from hormone sensitive to castration-resistant prostate cancer (CRPC).

Over 90% of prostate tumors arise within the glandular epithelial cell compartment [4]. Prostate cancer in men usually arises in the peripheral zone of the prostate and metastatic spread can be both lymphatic and hematogenous, spreading primarily to the bones, but also to the lungs and liver. On a histological level, early lesions consist of epithelial crowding and stratification with hyperchromatism and disruption of the basal cell layer and are classified as prostatic intraepithelial neoplasia (PIN). Lesions of PIN rapidly can progress by invading the surrounding stroma leading to the development of adenocarcinoma progressively less-differentiated and eventually to metastatic spread.

Angiogenesis plays a critical role in prostate cancer progression [5] and several studies have described a significant correlation between microvessel density (MVD) with increasing Gleason Score , pathological stage, and patient survival [6, 7]. However, angiogenesis is a much more complex and tightly regulated process that comprises orchestrated steps including basement membrane and extracellular matrix degradation, endothelial cell proliferation, sprouting and migration, recruitment of vascular support cells, and restoration of proper blood flow [8]. Therefore it becomes necessary to access all the different aspects of tumoral angiogenesis .

In this report we make use of the transgenic adenocarcinoma of the mouse prostate (TRAMP) model that was generated by microinjection of a vector containing a regulatory sequence (rat probasin) to target simian virus 40 (SV40) (antigens T and t; Tag) early gene expression specifically to the prostatic epithelium [9]. The mouse prostate consists of multiple lobes that have distinct patterns of ductal branching, histological appearance, gene expression, and secretory protein expression [10]. These correspond to the ventral, lateral, dorsal, and anterior lobes. However, even though the organization of the prostate differs from humans to mice, the dorsolateral lobe is the most analogous to the human peripheral zone, where prostate cancer develops in humans [11]. Therefore, despite the differences, the TRAMP model is considered a good model for studying prostate cancer progression, closely mimicking clinical prostate cancer with respect to progression, androgen independence, and biochemistry [12].

In this report we propose to describe in detail the methods used to study angiogenesis in prostate cancer using the TRAMP mice as model (Fig. 1). From mouse UGS collection, microdissection of the prostate, preparation of the prostatic samples for immunofluorescence (to access vascular density, recruitment of smooth muscle cells and/or pericytes, vascular functionality and permeability, tumor hypoxia, and others), immunohistochemistry (for prostatic lesions characterization and or other relevant stainings), endothelial and vascular mural cells sorting and isolation by fluorescent associated cell sorting (FACS) or whole prostate snap-freeze (for transcription or other analysis).
Fig. 1

A schematic overview of the major steps and methods described in this report. From murine prostate collection and microdissection, through different sample processing to several end analysis (IF, IHC, whole prostate or ECs and vSMCs transcription and protein analysis or other). *The sorted cells can also be used to put in culture or for other analysis (e.g., genomic, sequencing analysis)

2 Materials (All Buffers, Solutions, Media, and Specialized Equipment)

2.1 Reagents

  1. 1.

    10% buffered formalin solution—VWR Chemicals.

     
  2. 2.

    2,2,2 Tribromoethanol—Sigma Aldrich.

     
  3. 3.

    4′,6-Diamidino-2-phenylindole dihydrochloride hydrate (DAPI)—Molecular Probes.

     
  4. 4.

    Biotin-conjugated lectin from Lycopersicon esculentum—Sigma Aldrich.

     
  5. 5.

    Bovine Serum Albumin (BSA)—Sigma Aldrich.

     
  6. 6.

    Cell strainers—CellTrics® 50 μm, sterile—Sysmex.

     
  7. 7.

    Citrate or Citric acid monohydrate—VWR Chemicals.

     
  8. 8.

    Coverslips—Microscope cover glasses (24 × 50 mm)—Hirschmann.

     
  9. 9.

    DAB chromogen (ImmPACT™ DAB)—Vector Laboratories.

     
  10. 10.

    Deoxyribonuclease I from bovine pancreas (DNAse I)—Sigma Aldrich.

     
  11. 11.

    Dimethyl Sulfoxide (DMSO) Hybri-Max—Sigma.

     
  12. 12.

    Disodium hydrogen phosphate anhydrous (Na2HPO4)—VWR Chemicals.

     
  13. 13.

    Donkey serum—Sigma Aldrich.

     
  14. 14.

    Dulbecco’s Phosphate Buffered Saline (DPBS)—Life Technologies.

     
  15. 15.

    eFluor NC Flow Cytometry Staining Buffer (5×) (FCSB)—eBiosciences.

     
  16. 16.

    Entellan—Merck Millipore.

     
  17. 17.

    Eosin Y—Sigma Aldrich.

     
  18. 18.

    Ethanol EtOH (100%)—Merck Millipore.

     
  19. 19.

    Ethylenediaminotetraacetic acid disodium salt dehydrate (EDTA)—VWR Chemicals.

     
  20. 20.

    Evans’ Blue dye—Sigma Aldrich.

     
  21. 21.

    FACS tubes—5 ml Polystyrene round-bottom tube with cell strainer cap (12 × 75 mm)—BD Falcon.

     
  22. 22.

    Fetal Bovine Serum (FBS)—Sigma Aldrich.

     
  23. 23.

    Gelatin, from porcine skin—Sigma Aldrich.

     
  24. 24.

    Glycerol—Merck Millipore.

     
  25. 25.

    Goat serum—Sigma Aldrich.

     
  26. 26.

    Hydrogen peroxidase solution (H2O2 30% w/w reagent grade)—Scharlau.

     
  27. 27.

    Hypoxyprobe™-1 Plus Kit—Hypoxyprobe Inc. (hpi).

     
  28. 28.

    Isopentane (2-Methylbutane)—VWR Chemicals.

     
  29. 29.

    Mayer’s Hematoxylin—Merck Millipore.

     
  30. 30.

    Methanol—VWR Chemicals.

     
  31. 31.

    Microscope slides—Superfrost Plus (25 × 75 × 1.0 mm)—Thermo Scientific.

     
  32. 32.

    Mowiol 4-88—Calbiochem.

     
  33. 33.

    Na Citrate or Sodium Citric acid dehydrate—Sigma Aldrich.

     
  34. 34.

    Needles (100 Sterican 0.45 × 12 mm 26 G × 1/2″)—Bayer.

     
  35. 35.

    OCT compound—VWR Chemicals.

     
  36. 36.

    Paraformaldehyde (PFA)—Sigma Aldrich.

     
  37. 37.

    Petri dishes (10 cm)—VWR.

     
  38. 38.

    Plastic Pasteur pipettes (graduated 1.5 ml)—VWR.

     
  39. 39.

    Potassium chloride (KCl)—VWR Chemicals.

     
  40. 40.

    Potassium dihydrogen phosphate (KH2PO4)—VWR Chemicals.

     
  41. 41.

    RNeasy Micro Kit—Qiagen.

     
  42. 42.

    RNeasy Mini Kit—Qiagen.

     
  43. 43.

    Sodium chloride (NaCl)—VWR Chemicals.

     
  44. 44.

    Sucrose (D(+) Saccharose)—VWR Chemicals.

     
  45. 45.

    SuperScript III First Strand Synthesis Supermix Q RT-PCR Kit—Life Technologies.

     
  46. 46.

    Sybergreen Fastmix ROX dye—Qiagen.

     
  47. 47.

    Syringes (1 ml U100 Insulin without needle)—TERUMO.

     
  48. 48.

    Tert-amyl alcohol or 2-methyl-2-butanol—Fischer Scientific or Sigma Aldrich.

     
  49. 49.

    Tris (hydroxymethylaminomethane)—VWR Chemicals.

     
  50. 50.

    Triton X—AppliChem.

     
  51. 51.

    Tween 20, molecular biology grade—VWR Chemicals.

     
  52. 52.

    Xylene—Biochem Chemopharma.

     

2.2 Reagent Setup

  1. 1.

    0.1% Collagenase—Prepare the solution with the appropriate amount of collagenase diluted in sterile DPBS.

     
  2. 2.

    0.2 M Tris solution (pH 8.5)—2.42 g Tris in 100 ml distilled water and adjust the pH to 8.5.

     
  3. 3.

    1% Evans’ Blue dye solution—Dissolve the appropriate amount of Evans’ Blue in PBS (1×).

     
  4. 4.

    100% avertin solution—Dissolve 10 g 2,2,2 Tribromoethanol in 10 ml Tert-amyl alcohol with agitation at 40 °C. After complete dissolution, filtrate the solution in a Millipore 0.5 μm filter. Store the solution at 4 °C protected from the light.

     
  5. 5.

    2.4 U/ml Dispase—Firstly prepare a 10 mg/ml dispase solution by diluting the appropriate amount of dispase in sterile DPBS. From the first prepared solution, take 130 μl and preface to 1 ml with DPBS to obtain the final 2.4 U/ml dispase solution.

     
  6. 6.

    2.5% avertin solution—Dilute the 100% solution in PBS (1×) and mix energetically to homogenize the solution.

     
  7. 7.

    Antigen retrieval citrate buffer solution (pH 6) 10 mM—For 500 ml prepare 41 ml Na Citrate 0.1 M (pH 8.8) + 9 ml Citrate 0.1 M (pH 1.8) + 450 ml distilled water and adjust the pH in the end if necessary.

     
  8. 8.

    Antigen retrieval Tris EDTA buffer solution (pH 9)—For 500 ml prepare 0.605 g Tris + 0.185 g EDTA + 250 μl Tween 20 + add distilled water to mount up to 500 ml and adjust the pH if necessary.

     
  9. 9.

    Biotin-conjugated lectin from Lycopersicon esculentum (100 μg in 100 μl of PBS (1×))—Prepare the administration syringe and allow the solution to get to RT (lectin solution will be stored at 4 °C) before injecting the mice.

     
  10. 10.

    Blocking solution—2% BSA + 5% Goat or Donkey Serum (use the serum of the species in which the secondary antibody was produced; the serum should be inactivated at 55–10 min and stored in aliquots at −20 °C) in PBSW (PBS (1×) + 0.1% Tween 20).

     
  11. 11.

    DAPI solution (stock)—0.15% DAPI in PBS (1×) and store in aliquots.

     
  12. 12.

    Dehydration solution—15% Sucrose in PBS (1×). Prepare this similarly to the fixation solution. Dissolve the sucrose by shaking and/or rolling for ±15 min, until the solution becomes translucent.

     
  13. 13.

    Diluted solutions of EtOH (Dilute the 100% solutions of EtOH in distilled water to obtain solutions at 95%, 85%, and 70% EtOH).

     
  14. 14.

    Dissecting Media—To proceed with fixation and inclusion either in gelatin or paraffin or snap freeze prostates can be dissected using sterile PBS (1×); to proceed with sorting cells, prostates should be dissected using sterile DPBS.

     
  15. 15.

    DNAse I working solution—Prepare from the stock solution to obtain 10 U/ml.

     
  16. 16.
    FACS Collection medium—According to the following desired use for the cells, they should be collected using:

    • To proceed with RNA extraction, cells are sorted directly into the lysis buffer (500 μl) of the RNeasy Micro Kit.

    • To proceed with protein extraction, cells can be sorted to an appropriate medium (see next point) and then proceed with the normal protein extraction protocol.

    • To put in culture—cells should be collected directly in the media where they will be maintained, e.g., for ECs—EGM-2 (endothelial cell growth medium-2)-Lonza or endothelial cell media—PromoCell; for pericytes—Pericyte medium (ScienCell).

    • Cells can also be frozen for later use in a 1 ml solution of appropriate media with 10% DMSO and 50% (vol/vol) FBS.

     
  17. 17.

    FCSB working solution: Prepare 1× solution from the stock (5×) with 3% FBS.

     
  18. 18.

    Fixation solution—4% PFA + 4% Sucrose in PBS (1×). Prepare this in 50 or 15 ml Falcons, according to the size and number of samples collected (1/10 proportion of tissue/fixation solution). Heat the solution in the microwave until it becomes translucent (careful not to spill due to overheat and not inhale the PFA vapors). Proceed with cooling at RT and then allow to cool on ice.

     
  19. 19.

    Gelatin solution—7.5% gelatin + 15% Sucrose in PBS (1×). Firstly place PBS (1×) in the Falcon, and add gelatin (gram by gram) to facilitate dissolution and add sucrose (all at once). Heat in the microwave (careful not to overheat) and then add the rest of the PBS and agitate slowly. Place in the water bath at 37 °C—1 h to stabilize the solution.

     
  20. 20.

    Hypoxyprobe solution: Taking in consideration a desired dosage of 60 mg/kg, and a mean mouse weight of 30 g, each mouse should receive 1.8 mg of solid pimonidazole HCl. Therefore one vial of 100 mg should be suspended in 5000 ml—to give each mouse 90–100 μl of solution. The suspended solution should be protected from the light and kept at 4º C.

     
  21. 21.

    Mowiol solution—2.4 g Mowiol 4—88 + 6 g Glycerol + 6 ml distilled water + 12 ml of 0.2 M Tris solution (see Subheading 2.2). Mix with agitation at 50 °C for 6 h until complete dissolution. Allow the solution to stabilize (rest) for 2 h. Centrifuge at 3000 × g for 15 min and aliquot the supernatant and store at −20 °C.

     
  22. 22.

    PBS-Triton 0.1% or 0.3% solution—Add the adequate quantity of Tris (according to the desired percentage) and add distilled water to mount up to the final desired volume.

     
  23. 23.

    Phosphate Buffered Saline solution 1× (PBS 1×)—dilute the PBS 10× solution in distilled water.

     
  24. 24.

    Phosphate Buffered Saline stock solution (PBS 10×)—for 1 l solution: NaCl (1.37 M/80 g) + KCl (0.027 M/2 g) + Na2HPO4 (0.043 M/14.4 g) + KH2PO4 (0.014 M/2–4 g). Add distilled water until 800 ml, adjust the pH to 7.4 and complete with distilled water until the final volume and autoclave.

     

2.3 Equipment

  1. 1.
    Fluorescent immunostained sections from prostatic tumors can be obtained using:

    • For complex analysis (e.g., assessment of vascular maturation), we recommend using a confocal microscope—e.g., Carl Zeiss LSM 710 confocal microscope with either Zeiss 20× (Plan-Apochromat) NA 0.80 dry objective or 40× (EC Plan-Neofluor) NA 1.30 oil immersion objective, and captured using ZEN 2010 software (Carl Zeiss).

    • For simpler analysis (e.g., vascular extravasation, hypoxia, or others), an epifluorescence microscope should be used—e.g., a Leica DMRA2 fluorescence microscope with Leica HC PL Fluotar 10, 20× and 40×/0.5 NA dry objectives (Leica), captured using Leica DFC340 FX, (Leica), and processed with Metamorph 4.6–5 (Molecular Devices).

    • Morphometric analyses were performed using the NIH ImageJ 1.37v program (NIH).

     
  2. 2.

    H&E or immunohistochemistry stained sections are examined under a “bright field microscope, e.g.” an Olympus BX51 microscope with Olympus 10×/0.30 NA and 40×/0.75 NA dry objectives and captured with coupled Olympus DP21 photographic equipment (Olympus Iberia, Inc.).

     
  3. 3.

    For processing and inclusion in paraffin—Automatic tissue processor—Leica TP 1020 (Leica).

     
  4. 4.

    For sorting and isolation of ECs and vSMCs-FACS Aria III cytometer (BD Biosciences).

     

2.4 Equipment Setup

  1. 1.

    FACS sorting: The Special Order BD FACSAria III cell sorter is equipped with three solid-state lasers (laser outputs at 488, 561, and 633 nm). FITC is excited by a 488-nm laser and measured through a 530/30 nm BP 502 nm LP filter. PE is excited by a 561-nm laser and measured through a 582/15 nm BP filter. PE-Cy7 is excited by a 561 nm laser and measured through a 780/60 nm BP 735 nm LP filter. Unstained prostatic cells are used as control to set the cutoff value for background fluorescence. Single color stained sample prostate cells are used for compensating between the different color channels. Samples are sorted at 4 °C using a 70 μm nozzle and 70 psi pressure, and collected into appropriate Collection Media (according to the intended use of collected cells—see Subheading 2.2) chilled at 4 °C. BD FlowJo software (Version 10.0, BD Biosciences) is used for collection, storage, and analysis of the digital data.

     

3 Methods

3.1 Mouse Prostate Dissection

  1. 1.

    To harvest and dissect the prostate, proceed as described below. Sacrifice a TRAMP male mouse (age depending on the time point of the tumor development intended to analyze), and with an adequate skin scissors, like a Metzenbaum fino-tungsten carbide (Fine Science Tools, GmbH) and forceps, like Dumont AA Forceps (Fine Science Tools, GmbH), make a small cut in the middle line just proximal to the prepuce and extend the incision to both sides laterally to form a V surgical window (Fig. 2a I–IV). This cut should include not only the abdominal skin but also the abdominal muscle, exposing the interior of the abdominal cavity (carefully not to damage the internal organs, especially the bladder). When the internal organs are exposed, one should be able to see the preputial glands and the internal fat pad attached to the testis and ductus deferens (Fig. 2a V). With forceps pick the fat pad and retract it, as demonstrated in the figure (Fig. 2a VI–VIII). By doing this, one should be able to expose the testis, ductus deferens, bladder, seminal vesicles (s.v.), and the prostate (Fig. 2a IX). With forceps proceed by pulling up on the bladder while cutting each ductus deferens to separate the rest of UGS from the testis (Fig. 2a X). Identify the urethra (a strong pink tubular structure) below the UGS and as caudally as possible cut the urethra at its base (Fig. 2a XI). By doing this, one should be able to further pull up on the bladder isolating the majority of the UGS and if necessary cutting the rest of the connective tissue below the UGS (Fig. 2a XII).

     
  2. 2.

    If the prostatic tumor is very large, proceed similarly as described previously (Fig. 2b) (see Note 1 ).

     
  3. 3.

    Place UGS in a 10 cm Petri dish containing Dissecting Media (see Subheading 2.2) (see Note 2 ). One should have the bladder, seminal vesicles, prostate, urethra, and part of the ductus deferens and or ureters in the dish at this point (Fig. 3a I).

     
  4. 4.

    The following steps are shown in Fig. 3. Using a smaller scissors, like iris scissors-delicate (Fine Science Tools, GmbH) and a thinner dissection forceps, like Dumont #5 forceps (Fine Science Tools, GmbH), hold the bladder and cut the base of the bladder to separate it from the rest of the prostate (Fig. 3a II).

     
  5. 5.

    Using two dissecting forceps hold on to the bladder and remove the two ureters.

     
  6. 6.

    Using the two forceps, separate the anterior lobes of the prostate from the seminal vesicles by severing the connecting blood vessel (Fig. 3a III), then proceed removing the seminal vesicles one at a time by gently pulling the seminal vesicle and with the help of the scissors bluntly separate it from the anterior lobes (Fig. 3a IV–VI).

     
  7. 7.

    Additionally, remove any part of the ductus deferens still remaining (Fig. 3a VII–VIII) and pull away any pieces of fat still attached to the prostate (Fig. 3a IX–X).

     
  8. 8.

    At this point, one should be able to identify the different prostatic lobes: anterior (AP), dorsolateral (DLP), and ventral (VP) alongside with the urethra. Transfer the prostate into a new 10 cm Petri dish containing fresh Dissecting Media and if desired one can separate the prostate in two symmetrical pieces (e.g., for different analysis) by inserting the scissors in to the entrance of the urethra and cutting along its axis (Fig. 3b VII–VIII).

     
  9. 9.

    If the prostatic tumor is very large, proceed similarly as described previously (Fig. 3b) (see Note 3 ).

     
Fig. 2

Harvest of the mouse urogenital system. Images depict the step-by-step procedure for collecting the murine prostate. (a) Close to normal sized prostate and a (b) huge tumor bearing prostate

Fig. 3

Prostate microdissection. Images show the step-by-step microdissection procedure used to dissect the prostate from the rest of the urogenital system, which include (aII and bV) removal of the bladder, (aIII–VI and bII–IV) removal of the seminal vesicles, (aVII–VIII) removal of the rest of ductus deferens and/or ureters, (aIX and X) removal of fat, and (aXI–XII) the final product, the prostate. (bVII–VIII) Division of the prostate in two symmetrical pieces by the urethra. (a) Close to normal sized prostate and (b) huge tumor bearing prostate

3.2 Tissue Preparation for Immunofluorescence Analysis

3.2.1 PFA Fixation and Sucrose Dehydration

  1. 1.

    Prepare the fixation solution (see Subheading 2.2).

     
  2. 2.

    Collect the prostatic tissue to the fixation solution cooled at 4 °C (on ice).

     
  3. 3.

    Incubate with agitation at 4 °C—1 h using a roller.

     
  4. 4.

    Prepare the dehydration solution (see Subheading 2.2).

     
  5. 5.

    Transfer the prostatic tissues to the dehydration solution and incubate with agitation at 4 °C, 2–3 h to overnight (depending on the tissue dimension).

     

3.2.2 Gelatin Inclusion

  1. 1.

    Prepare the gelatin solution (see Subheading 2.2).

     
  2. 2.

    Put the dehydration solution tubes with the samples in the water bath at 37 °C—10 min.

     
  3. 3.

    Embedding—transfer the dehydrated samples to a 15 ml Falcon tube with ±7 ml of gelatin and put in the water bath at 37 °C—30 m to 1 h.

     
  4. 4.

    Place one layer of gelatin (±0.5 cm height) in a Petri dish (or other recipient for gelatin inclusion) and let solidify at RT (or in the fridge to accelerate the process) for approximately 20 min.

     
  5. 5.

    Transfer the gelatin embedded prostates to the Petri dish by placing the samples on the gelatin layer and covering the samples with gelatin (using a Pasteur pipette). Allow solidification and then proceed by covering the rest of the Petri dish with gelatin.

     
  6. 6.

    Allow solidification at RT ±10 m and then place the Petri dish in the fridge—±30 min.

     
  7. 7.

    When completely solid, cut small gelatin cubes containing the samples and orientate the cubes leaving the caudal aspect of the prostate facing upwards (so that the cryosections may be transversal using the central urethra as reference).

     
  8. 8.

    Identify the gelatin cubes using a cardbox piece and use OCT compound to glue each identification card to the respective cube (attention to the orientation of the cube).

     
  9. 9.

    Proceed with freezing in isopentane cooled at −80 °C in liquid nitrogen (and posterior cryosectioning).

     

3.3 Immunofluores-cence Analysis of Vascular Density and Maturation

3.3.1 Immunofluorescence Protocol

  1. 1.

    Unfreeze slides—±30 m RT.

     
  2. 2.

    Degelatinize the slides—Place a Coplin jar with PBS (1×) in a water bath at 37 °C and allow the PBS to reach the same temperature. Transfer the slides to the Coplin jar—15 min (or until complete degelatinization).

     
  3. 3.

    Rinse in PBS (1×)—2× 5 min.

     
  4. 4.

    Permeabilize the slides in 3% H2O2 methanol solution—in the dark 30 min.

     
  5. 5.

    Rinse in PBS (1×)—2× 5 min.

     
  6. 6.

    Wash in 0.1% Triton PBS (1×) solution.

     
  7. 7.

    Unfreeze blocking solution (see Subheading 2.2).

     
  8. 8.

    Blocking—Allow the excess washing solution to be drained from each slide and distribute 200 μl of blocking solution. Incubate during 1 h at RT in a humid chamber (keep the blocking solution on ice).

     
  9. 9.

    Incubate with the primary antibodies—Prepare the primary antibody at appropriate dilutions in blocking solution (see Table 1). Allow the excess blocking solution from the previous step to be drained and distribute 100 μl of the antibody solution in each slide. Cover with a coverslip and incubate at 4 °C-ON in a humid chamber.

     
  10. 10.

    Wash in PBS-W. Transfer the slides to a Coplin jar and wash in PBS-W—5× 10 min.

     
  11. 11.

    Thaw blocking solution.

     
  12. 12.

    Incubate with the appropriate secondary antibodies—Prepare the secondary antibodies solution (see Table 2). Allow the excess blocking solution from the previous step to be drained and distribute 100 μl of the secondary antibodies solution in each slide. Cover with a coverslip and incubate at RT 1 h in a humid chamber.

     
  13. 13.

    Transfer the slides to a Coplin jar and wash in PBS-W—2× 10 min.

     
  14. 14.

    Rinse in PBS (1×)—1× 10 min.

     
  15. 15.

    Incubate with DAPI (see Subheading 2.2) for cellular nuclear staining—Pipet 75 μl of the stock solution for 50 ml PBS (1×)—3 min in the dark.

     
  16. 16.

    Rinse in PBS (1×)—2× 5 min in the dark.

     
  17. 17.

    Thaw Mowiol mounting solution (see Subheading 2.2).

     
  18. 18.

    Mount slides—Allow for the excess rinse solution to be drained in each slide and distribute 75 μl/per slide and cover with a coverslip (careful to avoid the formation of bubbles).

     
  19. 19.

    Store at 4 °C protected from the light.

     
Table 1

Primary antibodies used

Antibody

Species

Company

Use

Dilution

Cell type stained

Notes

PECAM-1 (Cd31)

Rat

BD Pharmingen

IF

1:100

ECs

 

αSMA

Mouse conjugated Cy3

Sigma

IF

1:300

SMCs and prostatic glands stromal layer

Does not need a secondary antibody

Ng-2

Rabbit conjugated Alexa 488

Merck Millipore

IF

1:100

Pericytes

Pdgfr-β

Rabbit

Cell Signaling

IF

1:100

Pericytes

 

Hif1α

Rabbit

Abcam

IF

1:100

Hypoxic cells

 

2-FITC-Mab (pimonidazole)

Mouse conjugated FITC

Hypoxyprobe (hpi)

IHC

1:100

Hypoxic cells

This antibody is part of the Hypoxyprobe kit (see Subheading 2.1)

Cleaved Caspase 3

Rabbit

Cell Signaling

IF

1:1600

Apoptotic cells

The antibody tends to accumulate in the intra-glandular spaces

Ki67

Rat conjugated Alexa 570

eBiosciences

IF

1:100

Proliferating cells

 

ERG-1

Rabbit

Santa Cruz

IF

1:50

Nuclei of ECs

 

Endomucin

Rat

Santa Cruz

IF

1:100

Venous and capillaries endothelium

 

Vegfr-2 (Flk-1)

Rat

BD Pharmingen

IF

1:100

ECs

 

IgG Rabbit

Rabbit

Abcam

IHC

IF

1:100

 

Use for negative ctrls

IgG Goat

Goat

Santa Cruz

IHC

IF

1:50

 

Cd146 PE (Anti-mouse)

Rat

BD Pharmingen

FACS

(2 μl per sample)

ECs and vSMCs

 

Cd31 FITC (Anti-mouse)

Rat

BD Pharmingen

FACS

(3 μl per sample)

ECs

 

Cd45 PE-Cy7 (Anti-mouse)

Rat

eBiosciences

FACS

(0.25 μl per samples)

Hematopoietic cells

 

Ter-119 PE-Cy7

Rat

eBiosciences

FACS

(1.25 μl per sample)

Erythroid cells

 
Table 2

Secondary antibodies used

Antibody

Species

Company

Use

Dilution

Notes

Anti-rabbit Alexa 488

Donkey

Life Technologies

IF

1:300

 

Anti-rabbit Alexa 488

Goat

Life Technologies

IF

1:300

 

Anti-rat Alexa 488

Donkey

Life Technologies

IF

1:300

 

Anti-goat Alexa 488

Donkey

Life Technologies

IF

1:300

 

Anti-rabbit Alexa 555

Donkey

Life Technologies

IF

1:300

When used together with a 647, use a 555 instead of a 594

Anti-rabbit Alexa 594

Donkey

Life Technologies

IF

1:300

Anti-goat Alexa 555

Donkey

Life Technologies

IF

1:300

Anti-goat Alexa 594

Donkey

Life Technologies

IF

1:300

Anti-rat Alexa 594

Donkey

Life Technologies

IF

1:300

Anti-rabbit Alexa 647

Donkey

Life Technologies

IF

1:200

 

Anti-goat Alexa 647

Donkey

Life Technologies

IF

1:200

 

Anti-rat Alexa 647

Donkey

Life Technologies

IF

1:200

 

Anti-FITC

Rabbit

Hypoxyprobe (hpi)

IHC

1:300

This antibody is part of the Hypoxyprobe kit (see Subheading 2.1)

Streptavidin-Alexa 488

 

Life Technologies

IF

1:200

Use to react with administered lectin

Anti-rabbit HRP

Goat

Palex Medical SA

IHC

1:300

 

Anti-goat HRP

Donkey

Santa Cruz

IHC

1:300

 

3.3.2 Vascular Density and Maturation (Recruitment of SMCs and Pericytes) Analysis

To examine tumor vascular density, morphology (and branching points), and vessel maturity (Fig. 4), judged by the degree of recruitment of smooth muscle cells and pericytes, perform a double fluorescent immunostaining of platelet endothelial cell adhesion molecule (PECAM-1), alpha smooth muscle actin (α-SMA) (Fig. 4a) and Ng-2 (Fig. 4b) and/or Pdgfr-β (Fig. 4c), respectively, on tissue sections (10 or 20 μm), as described in the protocol above (Subheading 3.3.1).
  1. 1.

    The primary antibodies used are rat monoclonal anti-mouse PECAM-1, mouse monoclonal anti-SMA Cy3 conjugate, rabbit monoclonal anti-Pdgfr-β, and Alexa-488 conjugated rabbit anti-Ng-2 (see Table 1).

     
  2. 2.

    The secondary antibodies are anti-rat conjugated with Alexa Fluor 488 and anti-rabbit conjugated with Alexa Fluor 594 (see Table 2).

     
  3. 3.

    Nuclei are counterstained with 4′,6-diamidino-2-phenylindole dihydrochloride hydrate (DAPI).

     
  4. 4.

    Slide images are captured using a fluorescent confocal microscope (see Subheading 2.3).

     
  5. 5.

    For immunostaining quantification, a defined window (arbitrary size) is used and applied to select an area in each captured image (in order to have a constant analyzed prostatic tissue area). Color channels are split creating greyscale images for each individual immunostaining and a grey level threshold is established selecting only immunostaining positive pixels in each individual color channel. Pixel intensity measurements (determined by the percentage of white pixels per field after transforming the RGB images into binary files) are then applied to each selected window using ImageJ. In the case of co-localization quantification (SMA, Pdgfr-β, and Ng-2 stainings), pixel intensity measurements are applied but to intact RGB images in order to quantify overlaying signals from two different channels.

     
  6. 6.

    Other analysis can also be performed, like proliferation and/or apoptosis of ECs, using adequate antibodies (see Table 1). And other optional markers of ECs can also be used, like Endomucin, Vegfr-2, and ERG-1 (nuclei of ECs) (see Table 1).

     
Fig. 4

Analysis of prostate tumor vascular density and maturation. Confocal immunostaining images (20 and 40× amplification) marked for: (a) PECAM-1 (green) and SMA (red), to evaluate vascular density, morphology, and vSMC coverage of prostate samples; (b) PECAM-1 (green) and Ng-2 (red), and (c) PECAM-1 (green) and Pdgfr-β (red), to evaluate pericyte vascular coverage of prostate samples. DAPI (blue) stains nuclei. White arrows indicate endothelial coverage of vSMCs, Ng-2, and Pdgfr-β cells

3.4 Immunofluorescence Analysis of Vascular Perfusion

  1. 1.

    Anesthetize the mice with avertin (2.5%) (see Subheading 2.2) (±0.2 ml of avertin solution per each 10 g of mice weight) administered IP. Within 2–5 min, the mouse should display complete loss of consciousness (see Note 3 ).

     
  2. 2.

    Inject biotin-conjugated lectin from Lycopersicon esculentum (100 μl of prepared solution—see Subheading 2.2) via caudal vein and allow to circulate for 5 min before perfusing the vasculature transcardially with 4% PFA in PBS for 3 min.

     
  3. 3.

    Prostate samples are then collected and processed as described above (see Subheadings 3.1 and 3.2).

     
  4. 4.

    Tissue sections are then stained (see Subheading 3.3) with rat monoclonal anti-mouse PECAM-1 (Table 1), followed by Alexa 594 goat anti-rat IgG (Table 2). And biotinylated lectin is visualized with Streptavidin-Alexa 488 (Table 2).

     
  5. 5.

    The images are then obtained and processed as described above (see Subheading 3.3.2). Prostatic tumor perfusion area is quantified by determining the percentage of PECAM-1-positive structures that co-localize with Alexa 488 signals (Fig. 5a).

     
Fig. 5

Prostate tumor vascular perfusion and extravasation . (a) Lectin (red) and PECAM-1 (green) confocal immunostaining (20× amplification) (maximum intensity projections) to evaluate the co-localization of both signals, indicative of vessel perfusion. (b) Evans’ Blue (red) and PECAM-1 (green) confocal immunostaining (20× amplification) images (maximum intensity projections) showing the extravasation areas. DAPI (blue) stains nuclei

3.5 Immunofluores-cence Analysis of Vascular Permeability

  1. 1.

    Anesthetize the mice with avertin (2.5%) (see Subheading 2.2) (±0.2 ml of avertin solution per each 10 g of mice weight) administered IP. Within 2–5 min, the mouse should be completely unconscious (see Note 3 ).

     
  2. 2.

    Inject 1% Evans’ Blue dye solution (see Subheading 2.2) via caudal vein, and perfuse transcardially 5 min later with 4% PFA in PBS for 3 min.

     
  3. 3.

    Prostatic tumor sections are stained (see Subheading 3.3) with rat monoclonal anti-mouse PECAM-1 (Table 1), followed by Alexa 488 goat anti-rat IgG (Table 2). Extravasation is visualized by observing Evans’ Blue red fluorescence in contrast with green fluorescent vascular structures [13] (Fig. 5b).

     
  4. 4.

    Tumor vascular extravasation area is quantified by determining the section field of Evans’ Blue red positive signal per vessel area (given by vascular density measurements) (Fig. 5b).

     

3.6 Tissue Preparation for Histopathological or Immunohistochemis-try Analysis

  1. 1.

    Proceed accordingly to Subheading 3.1 to dissect and collect the prostates.

     
  2. 2.

    Prostates are then fixed in 10% buffered formalin solution for 24 h (20× the volume of the prostatic piece), and then put into the automatic tissue processor (Leica TP 1020) which will proceed with dehydration in alcohol, clearing in xylene and embedding in paraffin.

     
  3. 3.

    Section the paraffin cassettes at 3 μm.

     

3.6.1 Histopathological Analysis: H&E Staining

  1. 1.

    Rinse the paraffin tissue slides in distilled water for 2 min.

     
  2. 2.

    Immerse the slides in hematoxylin for 1 min.

     
  3. 3.

    Rinse in running tap warm water.

     
  4. 4.

    Rinse in distilled water for 1 min.

     
  5. 5.

    Immerse the slides in a solution of EtOH 70% for 3 min.

     
  6. 6.

    Stain with eosin for 1 min.

     
  7. 7.
    Dehydration (see Note 4 ):

    • Alcohol bath solutions: EtOH 70% for 1 min; 85% for 1 min; 95% for 1 min; 100% for 1 min.

    • Xylene for 5 min.

    • Allow the slide to dry.

     
  8. 8.

    Mount the slides with a coverslip using mounting medium, like Entellan (see Note 5 ).

     
  9. 9.

    The sections are then analyzed blindly by a pathologist and scored according to the literature [12].

     

3.6.2 Immunohisto-chemistry Analysis

This technique can be used when one needs to have a structural and histopathological view of the tissue which by IF becomes harder. (There are also commercially available abs for PECAM, SMA, etc. that work using this technique).
  1. 1.

    Prepare the slides (to soften paraffin) by putting them at 57 °C for 7 min (in the incubation oven).

     
  2. 2.
    Tissue slides are deparaffinized and rehydrated:

    • Xylene bath solutions: 1× 10 min + 1× 5 min.

    • Alcohol bath solutions: 100%—2× for 2 min + 95%—for 4 min + 75%—for 4 min.

     
  3. 3.

    Permeabilize in 3% H2O2 distilled solution (see Note 6 ) at 37 °C for 15 min (in the dark).

     
  4. 4.
    Antigen retrieval: using either citrate buffer (pH 6.0) or Tris-EDTA buffer (pH 9.0) solutions (see Subheading 2.2) (depending on the primary antibody used).

    • Heat the antigen retrieval solution, prior to putting the slides in, for 3 min at 700 W (in the microwave).

    • Incubate the slides in the pre-heated antigen retrieval solution for 3 × 5 min at 700 W (in the microwave).

    • After the three incubation cycles, the slides should be cooled at RT for about 20–30 min.

     
  5. 5.

    Wash in PBS-Triton 0.3% solution (see Subheading 2.2) 2× 5 min.

     
  6. 6.

    Unfreeze blocking solution (for IHC blocking solution—2%BSA in PBS (1×)).

     
  7. 7.

    Blocking—Allow the excess washing solution to be drained from each slide and distribute 200 μl of blocking solution. Incubate during 1 h at RT in a humid chamber (keep the blocking solution on ice).

     
  8. 8.

    Slides are then incubated overnight at 4 °C with specific primary antibodies.

     
  9. 9.

    Rinse the slides in PBS (1×) solution—4× 10 min.

     
  10. 10.

    Incubate 1 h at RT with specific secondary antibodies (anti-species in which the primary ab is produced conjugated with HRP) in a humid chamber. Also use adequate isotype IgGs for the negative controls (see Note 7 ).

     
  11. 11.

    Rinse the slides in PBS (1×) solution—2× 10 min.

     
  12. 12.

    DAB chromogen solution (100 μl per slide) is then applied to the tissue sections on the slides, until reaction occurs and proper staining is reached (see Note 8 ).

     
  13. 13.

    To stop DAB reaction, rinse in distilled water—2× 5 min.

     
  14. 14.

    Slides are then counterstained by immersion in Mayer’s hematoxylin for 30 s to 1 min.

     
  15. 15.

    Rinse in current tap warm water to remove the excess of hematoxylin.

     
  16. 16.
    Dehydrate the slides in bath solutions:

    • Alcohol 95%, 100%—2 min each.

    • Xylene 2× 5 min.

     
  17. 17.

    Finally, mount the slides applying Entellan and a coverslip (see Note 5 ).

     

3.7 Hypoxia Analysis

For evaluation of hypoxic levels, two alternative methods can be used: Hif1α and pimonidazole-thiol adducts (Hypoxyprobe) detection.

3.7.1 Immunostaining Hif1α in Gelatin Embedded Prostatic Tissues

Using the previous mentioned protocol (see Subheading 3.3.1), immunofluorescence is performed on prostatic tissue sections (20 μm):
  1. 1.

    Incubate with the primary antibody—rabbit anti-Hif1α (see Table 1) and with an appropriate secondary antibody (see Table 2).

     
  2. 2.

    If desired, this staining can be combined with PECAM and/or SMA and/or other vascular marker.

     
  3. 3.

    Tumor Hif1α area is quantified by determining the section field of Hif1α green (or other) positive signal in pixel2 (Fig. 6a).

     
Fig. 6

Prostate tumor hypoxia analysis. (a) Representative images of Hif1α immunofluorescence (green) (20× amplification) (maximum intensity projections) DAPI (blue) stains nuclei. (b) Hypoxyprobe immunohistochemistry staining, showing strong positive staining in TRAMP prostates

3.7.2 Immunostaining Hypoxyprobe™-1 Adducts Formation in Paraffin Embedded Prostatic Tissues

Similarly to Hif1α detection, which is produced by cells in hypoxic conditions, the Hypoxyprobe Plus kit (see Note 9 ) is used to detect cells with low oxygen pressure (pO2 = 10 mmHg). Pimonidazole is reductively activated in hypoxic cells and forms stable adducts with thiol groups in proteins, peptides, and aminoacids. The ab included in the kit (FITC-Mab1) binds to these adducts allowing their detection by immunochemical means.
  1. 1.

    Anesthetize the mice with avertin (2.5%) (see Subheading 2.2) (±0.2 ml of avertin solution per each 10 g of mouse weight) administered IP. Within 2 to 5 min, the mouse should be completely unconscious (see Note 3 ).

     
  2. 2.

    Inject 100 μl Hypoxyprobe solution (see Subheading 2.2—dosage 60 mg/kg) and allow to circulate for 1 h before proceeding with the collection of the prostate (see Subheading 3.1).

     
  3. 3.

    Prepare and fix the tissues as described in Subheading 3.6.

     
  4. 4.

    Prostatic tumor paraffin sections are stained according to the protocol described in Subheading 3.6.2 with FITC Mab1 (see Table 1), followed by rabbit anti-FITC HRP (see Table 2). The hypoxic areas should appear in brown color and the intensity directly related with decreasing oxygen levels (Fig. 6b).

     

3.8 Collection, Preparation, and Staining of Prostatic Tissues for Sorting Isolation of ECs and Vascular Mural Cells

3.8.1 Collection and Preparation of Prostatic Tissues for Sorting Isolation

  1. 1.

    Collect the prostates as described in Subheading 3.1 but in this case use DPBS as dissection medium.

     
  2. 2.

    Place the microdissected prostate in a clean solution of DPBS.

     
  3. 3.

    Finely cut the prostate into pieces of 2–4 mm size.

     
  4. 4.

    Wash the prostatic tissue at least one time in DPBS (it is enough to pass it to fresh DPBS once).

     
  5. 5.

    Pass the samples to 1 ml of digestion solution of 0.1% collagenase (500 ml) and 2.4 U/ml dispase (500 ml) (in 1.5 ml Eppendorf).

     
  6. 6.

    Incubate 2 h at 37 °C with agitation.

     
  7. 7.

    At the end of the 2 h, add 0.70 μl DNAse I to each sample and continue incubation at 37 °C with agitation for an extra 30 min.

     
  8. 8.

    Aspirate the samples (the tissue is dissociated and the solution becomes opaque) and pass them through a cell strainer (50 μm) to eliminate debris.

     
  9. 9.

    Centrifuge the cellular suspension 4–5′ (300–400 × g) at 4 °C.

     
  10. 10.

    Discard the supernatant.

     
  11. 11.

    Resuspend in DPBS to remove the enzyme (first wash) (1/3 of the volume of the Falcon).

     
  12. 12.

    Repeat centrifugation and discard supernatant.

     
  13. 13.

    (Second wash) resuspend in DPBS.

     
  14. 14.

    Repeat centrifugation and discard supernatant.

     
  15. 15.

    Resuspend the cellular pellet in the cytometry buffer (FCSB 1× supplemented with 3% FBS—see Subheading 2.2).

     
  16. 16.

    Count the number of cells (and viability assay if necessary).

     
  17. 17.

    Centrifuge cells 4–5′ (300–400 × g) at 4 °C.

     
  18. 18.

    Discard the supernatant and resuspend cells in FCSB in order to obtain 2 × 107 cells/ml.

     

3.8.2 Staining of ECs (Lin− (cd45− ter119−) cd31+) and vSMCs (Lin− (cd45− ter119−) cd146+ cd31−)

  1. 1.
    Prepare an antibody mix solution (for a final volume of 100 μl per each sample):

    • Anti-mouse ter-119 PE-Cy7 (see Table 1)—0.8 μl per sample.

    • Anti-mouse cd45 PE-Cy7 (see Table 1)—0.2 μl per sample.

    • Anti-mouse cd31 FITC (see Table 1)—3 μl per sample.

    • Anti-mouse cd146 PE (see Table 1)—2 μl per sample.

     
  2. 2.

    Add 50 μl antibody mix solution to 50 μl cell suspension sample.

     
  3. 3.

    To set up the compensation samples, put four extra tubes of cells (and put the adequate antibody concentration in a final volume of 50 μl solution). Leave one tube of cells unstained for the Unstained Ctrl. For the Lineage Ctrl, add 0.8 μl of anti-mouse ter-119 PE-Cy7 and 0.2 μl of anti-mouse cd45 PE-Cy7 to a second tube with cells; for the CD31 Ctrl, add 3 μl of anti-mouse cd31 FITC to the third tube; and for the Cd146 Ctrl, add 2 μl of anti-mouse cd146 PE to the fourth tube.

     
  4. 4.

    Mix smoothlygently.

     
  5. 5.

    Incubate 45 min at 4 °C (on ice) in the dark.

     
  6. 6.

    Wash cells in FCSB (1/3 volume Eppendorf)—(1.5 ml eppendorf—500 μl).

     
  7. 7.

    Centrifuge 300–400 × g 5′ at 4 °C.

     
  8. 8.

    Discard supernatant.

     
  9. 9.

    Repeat wash and centrifugation.

     
  10. 10.

    Discard supernatant.

     
  11. 11.

    Resuspend cells in FCSB (500 μl per sample and 250 μl per antibody controls or compensation samples).

     
  12. 12.

    Transfer cells into 50 μm filter top FACS tubes.

     

3.8.3 FACS of ECs and Vascular Mural Cells

Cells are sorted in a FACS Aria III cytometer (see Subheading 2.4). When setting up the gates for the first time, beyond the compensation samples described above, FMO (All Minus One) compensation Ctrls should also be performed. For demarcating and sorting ECs and mural cells, first standard quadrant gates are set, subsequently to differentiate cd31+ (>103 log FITC fluorescence) and cd146+ (>10 log PE fluorescence) cells (Fig. 7b) from the lineage negative population (≤102 log PE-Cy7 fluorescence) (Fig. 7a). Cells are collected in appropriate collection medium according to the desired following use for the cells (Fig. 1) (see Subheading 2.2).
Fig. 7

FACS plots of the Lineage- and ECs and vSMCs. FACS plots showing the (a) lineage negative population (Lin-PE Cy7) from which the (b) ECs (Lin− (cd45− ter119−) cd31+) and vSMCs (Lin− (cd45− ter119−) cd146+ cd31−) were sorted and isolated for posterior specific gene transcription analysis

3.9 RT-PCR Analysis of EC and Vascular Mural Cell Populations or Whole Prostate Snap Frozen

  1. 1.

    For ECs and vSMCs specific analysis, samples are collected at the endpoint of each experiment and prepared for FACS sorting (as described in Subheading 3.8). ECs and mural cells are sorted directly into the lysis buffer of the RNeasy Micro Kit.

     
  2. 2.

    For whole prostate analysis, tumor samples are collected at the endpoint of each experiment to an Eppendorf and snap frozen for RNA extraction in isopentane cooled at −80 °C by liquid nitrogen (Fig. 1).

     
  3. 3.

    Total RNA is isolated according to manufacturer’s protocol using the RNeasy Micro Kit and the RNeasy Mini Kit, for the ECs and vSMCs isolated or whole prostate, respectively.

     
  4. 4.

    A total of 100 ng RNA per reaction (ECs and vSMCs) and 400 ng per reaction (whole prostate) is used to generate cDNA with the SuperScript III First Strand Synthesis Supermix Q RT-PCR Kit.

     
  5. 5.

    Relative quantification real-time PCR analysis is performed using Sybergreen Fastmix ROX dye (Primer pair sequences used are described in Table 3). The housekeeping gene β-actin is used as endogenous control.

     
  6. 6.

    Results are presented as fold change relative to a Ctrl sample (which is always attributed the value 1) [14] (see Note 10 ).

     
Table 3

Primer pair sequence list

Gene

Forward sequence (5′–3′)

Reverse sequence (5′–3′)

Pecam

CAAGCAAAGCAGTGAAGCTG

TCTAACTTCGGCTTGGGAAA

Vegf-a

GGAGAGCAGAAGTCCCATGA

ACACAGGACGGCTTGAAGAT

Vegf-r1

GACCCTCTTTTGGCTCCTTC

CAGTCTCTCCCGTGCAAACT

Vegf-r2

GGACTCTCCCTGCCTACCTC

CGGCTCTTTCGCTTACTGTT

Vegf-r3

CGAAGCAGACGCTGATGATA

CCCAGGAAAGGACACACAGT

Pdgfr-β

TGATGAAGGTCTCCCAGAGG

AGGAGATGGTGGAGGAAGTG

Pdgf-b

CCTCGGCCTGTGACTAGAAG

TTTCGGTGCTTGCCTTTG

Tek

CCCCTGAACTGTGATGATGA

CTGGGCAAATGATGGTCTCT

Ang-1

CCATTTCGAGACTGTGCAGAT

CCCATTCACATCCATATTGC

Ang-2

CCTGGAGGTTGGACTGTCAT

CCCAGCCAGTACTCACCATC

Hif1α

GCCTTAACCTGTCTGCCACT

GGAGCCATCATGTTCCATTT

Control primers

β-Actin

TGTTACCAACTGGGACGACA

GGGGTGTTGAAGGTCTCAAA

4 Notes

  1. 1.

    If the prostatic tumor is large, it should appear immediately after entering the abdominal cavity (Fig. 2b I). We recommend in this cases to proceed with the dissection very similarly to what was described previously. Retract the fat pads (that should be laterally to the tumor) (Fig. 2b II–IV) to expose the testis and ductus deferens (Fig. 2b IV). Then proceed by looking for the bladder (which in very large tumors can be displaced from its normal location) and pulling it up (Fig. 2b V–VI). Proceed with cutting the ductus deferens (Fig. 2b VII), and the urethra (Fig. 2b VIII) separating the testis and the connective tissue from the rest of UGS.

     
  2. 2.

    One can choose to mount up a Petri dish with black background (e.g., using black resin or Indian ink) to allow better contrast and facilitate the microdissection of the mouse prostate, or alternatively this also can be done using a dissecting microscope or stereoscope.

    If the prostatic tumor is large, proceed in a similar fashion as described previously, but pay extra attention, because the normal structures may be harder to identify (Fig. 3b). Always use the seminal vesicles and the bladder as a reference (Fig. 3b I). Proceed with separating the bladder and the seminal vesicles from the prostate, as described previously (Fig. 3b II–V). Transfer the prostate into a new 10 cm Petri dish containing fresh Dissecting Media. In the end always use the entrance of the urethra as a reference point if division of the prostate is desired (Fig. 3b VI–VIII).

     
  3. 3.

    Mice can respond differently to avertin. Therefore if the indicated dosage proves insufficient to drive a complete loss of consciousness, evidenced by complete loss of response to toe or tail pinch, an additional 0.05–0.1 ml of avertin solution can be administered. Preferably always use fresh (less than 1 month old) avertin 2.5% solution due to degradation of tribromoethanol which can lead to hepatotoxic and nephrotoxic effects. The mice should remain anesthetized for 30 m to 1 h and fully recover after 1–2 h.

     
  4. 4.

    This step should be performed inside the laminar flux chamber to avoid the toxic vapors of xylene.

     
  5. 5.

    Put a little bit of mounting medium, like Entellan, with the help of a plastic pipette in the periphery of the slide and gently cover with the coverslip in a way that no air bubbles are formed between the two.

     
  6. 6.

    Some antibodies work better in a 3% H2O2 methanol solution, so if your antibody is not working using 3% H2O2 in distilled water try using 3% H2O2 in methanol.

     
  7. 7.

    For the negative Ctrls of the stainings, use appropriate isotype IgGs (rabbit or goat—see Table 1) as primary antibodies followed by appropriate secondary antibodies using the same exact conditions in the staining used for the tested antibody.

     
  8. 8.

    Reaction occurs when a brown color begins to appear, and the time may vary between abs (1–10 min). It is important to be consistent in relation to incubation time between different slides using the same ab.

     
  9. 9.

    The Hypoxyprobe™-1 Plus Kit brings solid pimonidazole HCl (which has to be diluted according to the manufacturer’s instructions), the primary (FITC conjugated to mouse IgG1 monoclonal antibody—FITC Mab1), and the secondary abs (rabbit anti-FITC conjugated with horseradish peroxidase).

     
  10. 10.

    When performing a relative transcription analysis on whole prostatic tissues (not when ECs are selected and isolated) between two mouse groups in which the variant (e.g., induction of an over-expression of a specific gene) causes changes in the number of vessels present, the fold changes in mRNA levels of other analyzed target genes should be normalized to Pecam mRNA levels, to compensate for variations in vascular density.

     

References

  1. 1.
    Jemal A, Bray F, Center MM et al (2011) Global cancer statistics. CA Cancer J Clin 61:69–90CrossRefPubMedPubMedCentralGoogle Scholar
  2. 2.
    World Health Organization (2014) World cancer report, 2014, WHO report. WHO, GenevaGoogle Scholar
  3. 3.
    Taylor RA, Toivanen R, Risbridger GP (2010) Stem cells in prostate cancer: treating the root of the problem. Endocr Related Cancer 17:R273–R285CrossRefGoogle Scholar
  4. 4.
    Hayward SW, Rosen MA, Cunha GR (1997) Stromal-epithelial interactions in the normal and neoplastic prostate. Br J Urol 79(Suppl 2):18–26CrossRefPubMedGoogle Scholar
  5. 5.
    Russo G, Mischi M, Scheepens W et al (2012) Angiogenesis in prostate cancer: onset, progression and imaging. BJU Int 110:E794–E808CrossRefPubMedGoogle Scholar
  6. 6.
    Borre M, Offersen BV, Nerstrøm B et al (1998) Microvessel density predicts survival in prostate cancer patients subjected to watchful waiting. Br J Cancer 78:940–944CrossRefPubMedPubMedCentralGoogle Scholar
  7. 7.
    Bono AV, Celato N, Cova V et al (2002) Microvessel density in prostate carcinoma. Pros Cancer Pros Dis 5:123–127CrossRefGoogle Scholar
  8. 8.
    Papetti M, Herman IM (2002) Mechanisms of normal and tumor-derived angiogenesis. Am J Physiol Cell Physiol 282:C947–C970CrossRefPubMedGoogle Scholar
  9. 9.
    Greenberg NM, DeMayo F, Finegold MJ et al (1995) Prostate-cancer in a transgenic mouse. Proc Natl Acad Sci U S A 92:3439–3443CrossRefPubMedPubMedCentralGoogle Scholar
  10. 10.
    Cunha GR, Donjacour AA, Cooke PS et al (1987) The endocrinology and developmental biology of the prostate. Endocr Rev 8:338–362CrossRefPubMedGoogle Scholar
  11. 11.
    Berquin IM, Min Y, Wu R et al (2005) Expression signature of the mouse prostate. J Biol Chem 280:36442–36451CrossRefPubMedGoogle Scholar
  12. 12.
    Kaplan-Lefko PJ, Chen T-M, Ittmann MM et al (2003) Pathobiology of autochthonous prostate cancer in a pre-clinical transgenic mouse model. Prostate 55:219–237CrossRefPubMedGoogle Scholar
  13. 13.
    Gratton JP, Lin MI, Yu J et al (2003) Selective inhibition of tumor microvascular permeability by cavtratin blocks tumor progression in mice. Cancer Cell 4:31–39CrossRefPubMedGoogle Scholar
  14. 14.
    Pedrosa A-R, Trindade A, Carvalho C et al (2015) Endothelial Jagged1 promotes solid tumor growth through both pro-angiogenic and angiocrine functions. Oncotarget 6:24404–24423CrossRefPubMedPubMedCentralGoogle Scholar

Copyright information

© Springer Science+Business Media, LLC, part of Springer Nature 2018

Authors and Affiliations

  1. 1.Faculdade de Medicina Veterinaria – ULisboa, Av. da Universidade Tecnica, Centro Interdisciplinar de Investigação em Sanidade Animal (CIISA)University of LisbonLisbonPortugal
  2. 2.Instituto Gulbenkian de CiênciaOeirasPortugal

Personalised recommendations

Cite protocol

Download book