Advertisement

Molecular Characterization of Canine Coronavirus

  • Rita de Cássia Nasser Cubel GarciaEmail author
Protocol
  • 676 Downloads
Part of the Springer Protocols Handbooks book series (SPH)

Abstract

Canine coronavirus (CCoV) is usually the cause of mild gastroenteritis in dogs and is known to have spread worldwide. In the last decade, as a consequence of the extraordinary large RNA genome, novel recombinant variants of CCoV have been found that are closely related to feline and porcine strains. Moreover highly virulent pantropic CCoV strains were recently identified in dogs. The molecular characterization of the CCoV circulating in canine population is essential for understanding viral evolution.

Key words

Canine coronavirus Enteritis RT-PCR Sequencing Genotype 

1 Introduction and Background

Canine coronavirus (CCoV), a common enteric pathogen of dogs, belongs to the Coronaviridae family, genus Alphacoronavirus along with feline coronavirus (FCoV) and transmissible gastroenteritis virus (TGEV); these viruses display greater than 96 % sequence identity within the replicase polyprotein gene [1, 2].

The CCoV genome is a single-stranded, positive-sense RNA of approximately 30 kb, and includes 7–10 open reading frames (ORFs). The 5′ two-thirds of the genome (ORF-1) consists of two overlapping regions (1a and 1b) that are translated in a polyprotein which is the precursor both of the viral replicase—Rep and proteases. Another one-third nucleotide sequences from the 3′ end contain smaller ORFs encoding for the structural proteins: ORF2—spike (S), ORF4—envelope (E), ORF5—membrane (M), and ORF6—nucleocapsid (N) proteins. These ORFs are interspersed with several ORFs (3a, 3b, 3c, 7a, and 7b) encoding various non-structural proteins, most of which of unknown function (Fig. 1) [2, 3, 4].
Fig. 1

Genetic structure of CCoV type II (a) and CCoV type I (b). Adapted from Pratelli, 2011. The numbers above the bars indicate ORFs. The arrow (b) indicates an intact ORF 3 downstream of the gene S, unique to CoCV-I

To date, CCoVs can be classified into two genotypes, CCoV-I and CCoV-II. This classification is not related to the chronologic order of the isolates but to the genetic identity between these viruses and FCoV types I and II [5].

Genetic analysis of several CCoVs detected in pups with diarrhea in Italy revealed a number of point mutations affecting a fragment of the M gene, which has led to the designation of these atypical CCoVs as FCoV-like CCoVs, based on their similarity to the commonly circulating FCoV strains (FCoV-I). Subsequently, these viruses were designated CCoV-I (prototype—Elmo/02 strains) to discriminate them from previously identified reference viruses which were classified as CCoV-II (prototypes—Insavac-1. K378) [5, 6, 7]. In addition to the genomic differences identified in M gene, it is now known that the major differences between viruses belonging to CCoV-I and CCoV-II are primarily found within the S protein (Fig. 2) [8].
Fig. 2

Representation of the different domains present within the spike proteins of alpha-coronaviruses of cats (FCoV), dogs (CCoV), and pigs (TGEV). Adapted from Licitra et al. 2014. The different NTDs are filled to indicate homology and proposed recombination events across the species, with the remainder of S1 depicted in light gray and S2 in dark gray

Recently, CCoV-II strain was divided in two subtypes: CCoV-IIa (classical strains) and IIb (TGEV-like strains) based on the sequence of the first 300 amino acids of the S protein: N-terminal domain-NTD region [9, 10]. CCoV-IIb emerged as a result of a putative recombination at the 5′ end of the S protein gene between CCoV-II and TGEV (Fig. 2). The CCoVIIa and IIb classifications are not officially accepted within CCoV taxonomy, but are widely cited in the literature [4].

Currently, CCoV-IIa exists in two biotypes that differ in pathogenicity and tissue tropism. The classical‖ CCoV-IIa is restricted to the small intestine, where it causes enteritis. In contrast, the emergent—pantropic CCoV-IIa biotype (prototypes CB/05 and 450/07)—can spread systemically, and has been detected by RT-PCR in various organs outside of the intestinal tract [11, 12, 13, 14, 15]. The genetic markers for pantropic CCoV-IIas are currently unknown.

The clinical signs associated with enteric CCoVs are not easily differentiated from those associated with other enteric pathogens. Consequently, CCoV diagnosis requires laboratory confirmation. PCR-based methods have been developed for detecting CCoV RNA in the feces of dogs and they are considered as the gold standard. A conventional RT-PCR test can detect alphacoronaviruses [16], and more specific PCR tests can be employed for further characterization into specific genotypes. It is particularly important since the two CCoV genotypes are commonly detected simultaneously in the same dog [2, 9, 17, 18, 19, 20, 21]. However, because of the highly variable nature of CCoV genomes, novel variants may be missed with this approach.

2 Materials

2.1 Solutions

2.1.1 Tris-Ca2+ 0.01 M pH 7.2 Solution

For a 1000 mL solution, weight 1.21 g of Tris base (C4H11NO3) (MW = 121.14) and dissolve in 800 mL deionized water using magnetic stirrer. Adjust pH to 7.2 with the appropriate volume of concentrated HCl. Add 0.02 g of CaCl2 (MW = 110.98). Bring final volume to 1 L with deionized water. Autoclave and store at room temperature.

2.1.2 Tris-Borate-EDTA Buffer

  1. 1.

    Prepare a stock solution of EDTA 0.5 M pH 8.0:

    EDTA will not go completely into solution until the pH is adjusted to about 8.0. For a 500 mL stock solution of 0.5 M EDTA, weigh out 93.05 g ethylenediaminetetraacetic acid (EDTA) disodium salt (MW = 372.2). Dissolve in 400 mL deionized water and adjust the pH with NaOH. Top up the solution to a final volume of 500 mL. The solution is sterilized by autoclaving.

     
  2. 2.

    Prepare a stock solution of TBE 5×:

    Make a concentrated (5×) stock solution of TBE by weighing 54 g Tris base (MW = 121.14) and 27.5 g boric acid (FW = 1.83) and dissolving both in approximately 900 mL deionized water. Add 20 mL of 0.5 M EDTA (pH 8.0) and adjust the solution to a final volume of 1 L. This solution can be stored at room temperature but a precipitate will form in older solutions. Store the buffer in glass bottles and discard if a precipitate has formed.

     
  3. 3.

    Prepare a working solution of TBE

    For agarose gel electrophoresis, TBE can be used at a concentration of 0.5× (1:10 dilution of the concentrated stock). Dilute the stock solution by 10× in deionized water. Final solute concentrations are 45 mM Tris-borate and 1 mM EDTA. The buffer is now ready for use in running an agarose gel.

     

2.1.3 Ethidium Bromide

Dissolve 0.2 g ethidium bromide to 20 mL water. Mix well and store in the dark (stock solution is 10 mg/mL concentration).

2.2 Oligonucleotides

The oligonucleotides for detection and characterization of CCoV strains are described in Table 1.
Table 1

Primers used for PCR amplification

Primer

Sequence (5′–3′)

Position

Amplicon size (bp)

CCoV type (gene)

CCV1 [16]

TCCAGATATGTAATGTTCGG

328–347a

410

I/II (M)

CCV2

TCTGTTGAGTAATCACCAGTC

717–737

EL1F [17]

CAAGTTGACCGTCTTATTACTGGTAG

3538–3563b

346

I (S)

EL1R

TCATATACGTACCATTATAGCTGAAGA

3857–3883

S5F [17]

TGCATTTGTGTCTCAGACTT

3486–3505c

694

IIa (S)

S6R

CCAAGGCCATTTTACATAAG

4160–4179

CEPol-1 [19]

TCTACAATTATGGCTCTATCAC

20168–20190d

370

IIb (S)

TGSP-2

TAATCACCTAAMACCACATCTG

20516–20537

aPrimer position refers to the sequence of M gene of CCoV type IIa strain Insavc-1 (accession number D13096)

bPrimer position refers to the sequence of S gene of CCoV type I strain Elmo/02 (accession number AY307020)

cPrimer position refers to the sequence of S gene of CCoV type IIa strain Insavc-1 (accession number D13096).

dPrimer position refers to the sequence of the complete genome of CCoV type IIb strain TGEV (accession number AJ271965-2)

3 Methods

3.1 Collection of Fecal Samples

  1. 1.

    Fecal samples are collected from dogs using swabs.

     
  2. 2.

    The rectal swabs are placed in isothermal boxes using ice bags.

     
  3. 3.

    Transport the samples to the laboratory under refrigeration.

     
  4. 4.

    The feces should be kept at −20 °C until processed.

     

3.2 Preparation of 20 % Fecal Suspensions

  1. 1.

    In a centrifuge tube add 1–2 g of feces to prepare 20 % fecal suspension in Tris-Ca2+ (0.01 M, pH 7.2) buffer.

     
  2. 2.

    Mix by vortexing.

     
  3. 3.

    Centrifuge at 3000 × g for 10 min.

     
  4. 4.

    Transfer the supernatant to another centrifuge tube.

     
  5. 5.

    Add 1/10 volume of chloroform.

     
  6. 6.

    Mix by vortexing.

     
  7. 7.

    Incubate at 4 °C for 10 min.

     
  8. 8.

    Centrifuge at 3000 × g for 10 min.

     
  9. 9.

    Transfer the supernatant to 1.5 mL microcentrifuge tube.

     
  10. 10.

    Proceed to RNA extraction (see Note 1 ).

     

3.3 RNA Extraction (See Note 2 )

  1. 1.

    Total RNA may be extracted from the supernatant fluid using a commercial RNA extraction kit following the manufacturer’s instructions.

     
  2. 2.

    After RNA extraction it is recommended to proceed the cDNA synthesis in order to avoid RNA degradation.

     
  3. 3.

    For long-term storage of RNA store at −70 °C.

     

3.4 cDNA Synthesis

Reverse transcription (RT) may be carried out using random primers and reverse transcriptase enzyme according to the manufacturer’s instructions (see Note 3 ).

3.5 PCR for CCoV Screening

To detect CCoV-I and CCoV-II, PCR may be performed with the CCV1-CCV2 primer pair which amplifies a 409 bp fragment of the gene encoding transmembrane protein M, as previously described [16]. The reagents for PCR reaction are described in Table 2.
Table 2

Reagents used in PCR with primers CCV1/CCV2

Reagents

Volume (μL)

DNase/RNase-free dH2O

27

10× PCR buffer

5

dXTP (dATP, dTTP, dCTP e dGTP) 2.5 mM

4

MgCl2 50 mM

1.5

CCV1 20 pmol

1

CCV2 20 pmol

1

Taq DNA polymerase(5 U/μL)

0.5

 

40

  1. 1.

    Prepare the reaction mix as described in Table 2.

     
  2. 2.

    Distribute 40 μL of the reaction mix to each PCR tube.

     
  3. 3.

    Add 10 μL of cDNA to each tube for a final volume of 50 μL.

     
  4. 4.

    PCR may be carried out in a DNA Thermal Cycler with the following reaction parameters: denaturation at 94 °C for 10 min followed by 35 cycles of (a) template denaturation at 94 °C for 1 min, (b) primer annealing at 55 °C for 1 min, and (c) extension at 72 °C 1 min, and complete the reaction with a single final extension step at 72 °C for 10 min.

     
  5. 5.

    Amplified products may be electrophoresed on 1.5 % (w/v) agarose gel in Tris-borate-EDTA (TBE) buffer at 80 V for about 90 min.

     
  6. 6.

    Visualize the DNA fragment by ethidium bromide staining under UV transillumination. A 100 bp DNA ladder can be used as size marker.

     
  7. 7.

    Samples that tested positive for CCoV may be subjected to direct sequencing.

     
  8. 8.

    The partial amplification of the gene M may be used to differentiate CCoV-I and CCoV-II strains based on the amino acid changes found in residues 127 (Ala → Ile/Ala → Val), 173 (Thr → Val), 193 (Met → Ile), 200 (Glu → Asp), and 201 (His → Asn) of the M protein [5, 21] (see Note 4 ).

     
  9. 9.

    To genotype/subtype CCoV strains or to diagnosis mixed CCoV infections it is necessary to amplify part of the S gene.

     

3.6 PCR for CCoV Genotyping/Subtyping

3.6.1 Differential Primers Directed to the Spike (S) Gene Should Be Used for CCoV Genotyping/Subtyping as Follows

  1. 1.

    EL1F/EL1R (2611–2956): To amplify a 346 bp fragment corresponding to the S gene of the CCoV-I Elmo/02 strain (AY170345) [17].

     
  2. 2.

    S5F/S6R (3991–4684): To amplify a 694 bp product corresponding to the S gene of the CCoV-IIa Insavc strain (D13096) [17].

     
  3. 3.

    CEPol-1 and TGSp-2: To amplify a 370 bp product corresponding to nucleotides (nt) 20168–20537 of the TGEV Purdue genome (AJ271965.1) [19].

     

3.6.2 The Reagents for PCR Reaction Are Described in Table 3

Table 3

Reagents used in PCR to amplify the S gene

Reagents

Volume (μL)

DNase/RNase-free dH2O

13.5

10× PCR buffer

2.5

dXTP (dATP, dTTP, dCTP e dGTP) 2.5 mM

2

MgCl2 50 mM

0.75

Forward Primer 20 pmol

0.5

Reverse Primer 20 pmol

0.5

Taq DNA polymerase (5 U/μL)

0.25

 

20

  1. 1.

    Prepare the PCR mix as described in Table 3.

     
  2. 2.

    Distribute 20 μL of the reaction mix to each PCR tube.

     
  3. 3.

    Add 5 μL of cDNA to each tube for a final volume of 25 μL.

     
  4. 4.
    PCR may be carried out in a DNA Thermal Cycler with the reaction parameters provided in Table 4.
    Table 4

    The reaction parameters for CCoV genotyping/subtyping

    PCR conditions

    Primer pair

     

    EL1F/EL1R [17]

    CEPol-1/TGSp-2 [19]

    S5F/S6R [17]

    Denaturation at

    94 °C for 10 min

    95 °C for 5 min

     

    94 °C for 1 min

    95 °C for 1 min

    35 cycles

    55 °C for 1 min

    50 °C for 1 min

     

    72 °C 1 min

    72 °C 1 min

    Final extension at

     

    72 °C for 10 min

     
  5. 5.

    Amplified products may be electrophoresed on 1.5 % (w/v) agarose gel in TBE buffer at 80 V for about 90 min.

     
  6. 6.

    Visualize the DNA fragment by ethidium bromide staining under UV transillumination. A 100 bp DNA ladder can be used as size marker.

     
  7. 7.

    Samples that tested positive may be subjected to direct sequencing (see Notes 5 and 6 ).

     

3.7 Sequencing (See Note 7 )

  1. 1.

    The amplicons obtained after partial amplification of the M and S genes may be purified using commercial kits according to manufacturers’ instructions.

     
  2. 2.
    After purification it is important to examine the DNA quality by using:
    1. (a)

      Agarose gel electrophoresis: purified DNA run as a single band.

       
    2. (b)

      Spectrophotometry : quantitate the amount of purified DNA by measuring the absorbance at 260 nm (the A260/A280 ratio should be 1.7–1.9).

       
     
  3. 3.

    The purified PCR products may be subjected to direct sequencing in both directions with the BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) according to standard protocols. Both strands of each amplicon should be sequenced at least twice.

     

3.8 Phylogenetic Analysis

  1. 1.

    For sequence comparisons the primer-binding sites should be excluded.

     
  2. 2.

    To perform the phylogenetic analysis, a database set containing sequences of CCoV-I, CCoV-IIa, and CCoV-IIb corresponding to the studied region should be retrieved from GenBank.

     
  3. 3.

    Nucleotide similarity with sequences deposited in the GenBank database may be assessed using the BLAST tool (http://blast.ncbi.nlm.nih.gov/Blast.cgi).

     
  4. 4.

    The sequences may be aligned with the BioEdit Sequence Alignment Editor v7.2.5(http://www.mbio.ncsu.edu/bioedit/bioedit.html).

     
  5. 5.

    The sequences should be subsequently analyzed using DAMBE software [22] to exclude identical sequences.

     
  6. 6.

    The Modeltest software 3.7 [23] may be used to test for a statistically justified model of DNA substitution that best fitted to the data set.

     
  7. 7.

    The evolutionary model should be selected and used for phylogenetic analysis.

     
  8. 8.

    Sequence analysis may be performed with the MEGA v.6.0 software [24].

     
  9. 9.

    For the construction of phylogenetic trees, deduced amino acid sequences should be used. Bootstrap analysis of 2000 replicates should be conducted to determine the significance of branching in the constructed tree.

     

4 Notes

  1. 1.

    If it is not possible to proceed RNA extraction keep the clarified suspension overnight at 4 °C. Long-term storage is not recommended.

     
  2. 2.

    Negative controls (fecal sample that tested positive for another enteric virus or fecal sample from normal dogs) and positive controls (CCoV-positive fecal sample or CCoV vaccine) should be included at every stage, from RNA extraction to PCR.

     
  3. 3.

    The advantages of using random hexamers instead of specific primers are as follows: It may give higher cDNA yield. The cDNA can be used in PCR assays specific for different viruses. It is a way of optimize the use of limited quantities of clinical sample.

     
  4. 4.

    This approach does not distinguish between single or multiple CCoVs in a dog or discriminate between IIa and IIb strains.

     
  5. 5.

    The conventional RT-PCR has high specificity and sensitivity and is a valuable diagnostic tool for the detection of CCoV in cases of single or multiple infections.

     
  6. 6.

    It is important to keep in mind the limitations of this methodology: It does not allow quantification of CCoV RNA in fecal samples which may be important in cases of multiple infections; another limitation is the inability to genotype divergent CCoVs that may not be amplified by the PCR primers.

     
  7. 7.

    Sequence analysis of the amplified fragment allows determining the types of CCoV circulating among dogs presenting mild or severe clinical signs of enteritis.

     

References

  1. 1.
    Adams MJ, Carstens EB (2012) Ratification vote on taxonomic proposals to the International Committee on Taxonomy of Viruses. Arch Virol 157:1411–1422CrossRefPubMedGoogle Scholar
  2. 2.
    Pratelli A (2011) The evolutionary processes of canine coronavirus. Adv Virol 2011, 562831CrossRefPubMedPubMedCentralGoogle Scholar
  3. 3.
    Woo PC, Huang Y, Lau SK, Yuen KY (2010) Coronavirus genomics and bioinformatics analysis. Viruses 2:1804–1820CrossRefPubMedPubMedCentralGoogle Scholar
  4. 4.
    Licitra BN, Duhamel GE, Whittaker GR (2014) Canine enteric coronaviruses: emerging viral pathogens with distinct recombinant spike proteins. Viruses 6(8):3363–3376CrossRefPubMedPubMedCentralGoogle Scholar
  5. 5.
    Pratelli A, Martella V, Pistello M, Elia G, Decaro N, Buonavoglia D, Camero M, Tempesta M, Buonavoglia C (2003) Identification of coronaviruses in dogs that segregate separately from the canine coronavirus genotype. J Virol Methods 107:213–222CrossRefPubMedGoogle Scholar
  6. 6.
    Pratelli A, Martella V, Elia G, Decaro N, Aliberti A, Buonavoglia D, Tempesta M, Buonavoglia C (2001) Variation of the sequence in the gene encoding for transmembrane protein M of canine coronavirus (CCV). Mol Cell Probes 15:229–233CrossRefPubMedGoogle Scholar
  7. 7.
    Decaro N, Buonavoglia C (2008) An update on canine coronaviruses: viral evolution and pathobiology. Vet Microbiol 132:221–234CrossRefPubMedGoogle Scholar
  8. 8.
    Pratelli A, Martella V, Decaro N, Tinelli A, Camero M, Cirone F, Elia G, Cavalli A, Corrente M, Greco G, Buonavoglia D, Gentile M, Tempesta M, Buonavoglia C (2003) Genetic diversity of a canine coronavirus detected in pups with diarrhoea in Italy. J Virol Methods 110:9–17CrossRefPubMedGoogle Scholar
  9. 9.
    Decaro N, Mari V, Campolo M, Lorusso A, Camero M, Elia G, Martella V, Cordioli P, Enjuanes L, Buonavoglia C (2009) Recombinant canine coronaviruses related to transmissible gastroenteritis virus of swine are circulating in dogs. J Virol 83:1532–1537CrossRefPubMedPubMedCentralGoogle Scholar
  10. 10.
    Decaro N, MariV EG et al (2010) Recombinant canine coronaviruses in dogs, Europe. Emerg Infect Dis 16(1):41–45CrossRefPubMedPubMedCentralGoogle Scholar
  11. 11.
    Decaro N, Martella V, Elia G, Addie DD, Camero M, Lucente MS, Martella V, Buonavoglia C (2007) Molecular characterization of the virulent canine coronavirus CB/05 strain. Virus Res 125(1):54–60CrossRefPubMedGoogle Scholar
  12. 12.
    Decaro N, Mari V, Von Reitzenstein M, Lucente MS, Cirone F, Elia G, Martella V, King VL, Di Bello A, Varello K, Zhang S, Caramelli M, Buonavoglia C (2012) A pantropic canine coronavirus genetically related to the prototype isolate CB/05. Vet Microbiol 14:239–244CrossRefGoogle Scholar
  13. 13.
    Ntafis V, Xylouri E, Mari V, Papanastassopoulou M, Papaioannou N, Thomas A, Buonavoglia C, Decaro N (2012) Molecular characterization of a canine coronavirus NA/09 strain detected in a dog's organs. Arch Virol 157:171–175CrossRefPubMedGoogle Scholar
  14. 14.
    Zicola A, Jolly S, Mathijs E, Ziant D, Decaro N, Mari V, Thiry E (2012) Fatal outbreaks in dogs associated with pantropic canine coronavirus in France and Belgium. J Small Anim Pract 53:297–300CrossRefPubMedGoogle Scholar
  15. 15.
    Pinto LD, Barros IN, Budaszewski RF, Weber MN, Mata H, Antunes JR, Boabaid FM, Wouters AT, Driemeier D, Brandão PE, Canal CW (2014) Characterization of pantropic canine coronavirus from Brazil. Vet J 202(3):659–662CrossRefPubMedGoogle Scholar
  16. 16.
    Pratelli A, Tempesta M, Greco G, Martella V, Buonavoglia C (1999) Development of a nested PCR assay for the detection of canine coronavirus. J Virol Methods 80:11–15CrossRefPubMedGoogle Scholar
  17. 17.
    Pratelli A, Decar N, Tinelli A, Martella V, Elia G, Tempesta M, Cirone F, Buonavoglia C (2004) Two genotypes of canine coronavirus simultaneously detected in fecal samples of dogs with diarrhea. J Clin Microbiol 42:1797–1799CrossRefPubMedPubMedCentralGoogle Scholar
  18. 18.
    Decaro N, Martella V, Ricci D, Elia G, Desario C, Campolo M, Cavaliere N, Di Trani L, Tempesta M, Buonavoglia C (2005) Genotype-specific fluorogenic RT-PCR assays for the detection and quantitation of canine coronavirus type I and type II RNA in faecal samples of dogs. J Virol Methods 130(1-2):72–78CrossRefPubMedGoogle Scholar
  19. 19.
    Erles K, Brownlie J (2009) Sequence analysis of divergent canine coronavirus strains present in a UK dog population. Virus Res 141:21–25CrossRefPubMedGoogle Scholar
  20. 20.
    Ntafis V, Mari V, Decaro N, Papanastassopoulou M, Pardali D, Rallis TS, Kanellos T, Buonavoglia C, Xylouri E (2013) Caninecoronavirus, Greece. Molecular analysis and genetic diversity characterization. Infect Genet Evol 16:129–136CrossRefPubMedGoogle Scholar
  21. 21.
    Costa EM, Castro TX, Bottino FO, Cubel Garcia RCN (2014) Molecular characterization of canine coronavirus strains circulating in Brazil. Vet Microbiol 168:8–15CrossRefPubMedGoogle Scholar
  22. 22.
    Xia X (2013) DAMBE5: a comprehensive software package for data analysis in molecular biology and evolution. Mol Biol Evol 30:1720–1728CrossRefPubMedPubMedCentralGoogle Scholar
  23. 23.
    Posada D (2006) ModelTest Server: a web-based tool for the statistical selection of models of nucleotide substitution online. Nucleic Acids Res 34:W700–W703CrossRefPubMedPubMedCentralGoogle Scholar
  24. 24.
    Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: molecular evolutionary genetics analysis version 6.0. Mol Biol Evol 30:2725–2729CrossRefPubMedPubMedCentralGoogle Scholar

Copyright information

© Springer Science+Business Media New York 2016

Authors and Affiliations

  1. 1.Departamento de Microbiologia e ParasitologiaInstituto Biomédico, Universidade Federal FluminenseNiteróiBrazil

Personalised recommendations