Background

The vitamin D endocrine system takes part in various biological processes including musculoskeletal development, erythropoiesis, and blood pressure regulation. Yet, it was estimated that one billion people had deficient or insufficient levels of vitamin D based on population studies [1].

Factors that have been associated with increased risk of vitamin D deficiency include low skin exposure to sunlight, low dietary intake of vitamin D, high body mass index (BMI), and genetic predispositions [2].

Several hypotheses were proposed to correlate obesity with vitamin D deficiency. There was evidence that vitamin D storage, action, and metabolism influences adiposity, and an observational study had shown that there is an increased risk of deficiency among obese individuals, but detailed explained causes are not clear. The hormonal form of vitamin D is (1,25 dihydroxyvitamin D) hormone, which has many other activities such as the regulation of adipocytes [3].

Vitamin D deficiency has also been linked to an increased risk of metabolic syndrome components including abdominal obesity [4]. VDR is a gene that encodes a nuclear receptor to mediate the inhibitory impact of vitamin D3 on adipogenesis [5]. The VDR gene plays a crucial role in the modulation of vitamin D pathways and regulation of hormone responsive genes. Interestingly, the VDR gene is also expressed in adipocytes and pancreatic beta cells and thus may influence body composition by directly regulating the differentiation and metabolism of adipocytes, or indirectly by insulin modulation [6]. The relevance of VDR in the etiology of obesity has been connected to the existence of polymorphisms FokI, BsmI, ApaI, and TaqI [7]. SNPs that cause the lower expression of VDR mRNA and protein such as BsmI may be associated with an increase the liability to obesity [5]. The BsmI polymorphism (rs1544410), located in the intronic region (intron 8 near the 3′end), is thought to affect VDR translational activity due to its strong linkage disequilibrium with a polyadenosine (poly (A)) microsatellite repeat in the 3′untranslated region [8]. Studies as the study of Al-Hazmi et al. demonstrated that polymorphisms in BsmI loci of the VDR gene were closely associated with the susceptibility of obesity [9].

The present study was conducted to examine a possible correlation between BsmI polymorphism and vitamin D levels in obese Egyptian male medical students.

Methods

This study was based on a comprehensive investigation known as Nutritional Assessment of Medical Educational Students (NAMES) that was conducted in 2018 and involved 700 healthy subjects (men and women). A total of 30 healthy men were enrolled in this study of the 700 participants who matched our inclusion criteria. These patients attended Ain Shams University Hospital in Cairo. The research was carried out at Clinical Pathology Department, Ain Shams University Hospitals.

The participants were divided into two groups. Group I included 12 obese men with a vitamin D level of > 20 ng/dl who were subdivided into seven men with insufficient vitamin D levels (21–29 ng/ml) and five men with normal vitamin D levels (> 30 ng/ml). Group II included 18 obese men with vitamin D deficiency (< 20 ng/dl).

Inclusion criteria were age between 18 and 25 years, male gender, and a BMI of > 30 kg/m2. The exclusion criterion was a history of chronic medical illness.

All the study participants underwent (1) a detailed medical history, focusing on dietary habits and drug usage, as well as a family history of obesity; (2) anthropometric measurements such as weight in kilograms, height in meters, and BMI (kg/m2); (3) clinical evaluation, including blood pressure monitoring and bioelectrical impedance in the body; and (4) tests for glycated hemoglobin (HbA1c) levels, complete blood count (CBC), iron profile, vitamin D levels, and VDR (BsmI) gene polymorphisms identified using real-time PCR.

Specimen collection: From each subject, 6 ml of venous blood was collected into sterile EDTA-containing tubes under aseptic conditions. The tubes were frozen at − 20 °C until performing PCR for detecting VDR (BsmI) gene polymorphisms.

VDR gene polymorphism (BsmI) analysis: VDR SNP (BsmI) rs 1544410 analysis was conducted using a commercial real-time PCR kit with predesigned TaqMan probes (Applied Biosystems TaqMan Assay cat. no. 4351379, USA). DNA extraction was performed using a commercial real-time PCR kit with predesigned TaqMan probes (Applied Biosystems TaqMan Assay cat. no. 4351379, USA) (QIA amp DNA Blood Mini Kit, USA).

DNA purification was done using a spin technique (QIA amp NA Mini Kit). The entire process was completed in < 20 min. The easy QIA amp spin processes yield pure DNA that can be readily used for direct amplification, making it ideal for the simultaneous processing of several samples. Both frozen whole blood and EDTA-treated blood can be used in the QIA amp technique (QIA amp DNA Mini Kit (50) Cat. No. 51304). The entire procedure was performed as per manufacturer instructions.

Standard preparation: TaqMan genotyping assays are designed and calibrated to function with TaqMan Genotyping Master Mix under the same universal thermal cycling settings. Only the following are required: 1) Each plate well contains 10 ng of pure genomic DNA, 2) Master Mix for TaqMan genotyping, and 3) assay for SNP genotyping (specific for polymorphism).

Universal PCR Master Mix contains DNA polymerase, dNTPs, primers, and probes rs 1544410 from Thermo Fisher Scientific and uses the same thermal conditions and optimal mix components. These assays were acquired from Thermo Fisher Scientific and used on a real-time PCR Rotor-Gene Q thermocycler.

This SNP BsmI was genotyped using a VIC® labeled probe for detecting the C allele and a FAM® labeled probe for detecting the T allele. To prepare the final reaction volume of 20 µl, 10 µl TaqMan® Genotyping Master Mix, 1 µl TaqMan® SNP genotyping assay (TaqMan probes), 7 µl DNase-free water, and 2 µl DNA were used.

TaqMan MGB probes: TaqMan® MGB probes are oligonucleotides that are unique to a certain target, i.e., rs 1544410 VIC/FAM: (GAGCAGAGCCTGAGTATTGGGAATG [C/T] GCAGGCCTGTCTGTGGCCCCAGGAA). Each probe has a reporter dye at the 5ʹ end—the VIC® dye is attached to the 5ʹ end (B) of allele C probe—the FAM® dye is attached to the 5ʹ end (b) allele T probe. At the 3ʹ end of the probe, a nonfluorescent quencher (NFQ) is attached.

The conditions for real-time PCR were as follows: denaturation at 95 °C for 10 min, followed by 40 cycles of 96 °C for 15 s (denaturation) and 60 °C for 1 min (annealing/extension). Samples were run in duplicate for 45 cycles. All ingredients were used in the TaqMan® SNP genotyping assay (ABI) (www.appliedbiosystems.com).

In any TaqMan genotyping experiment, the real-time QIAGEN Rotor-Q-gene system was used for PCR amplification and plate read analysis.

Statistical methods

Data were analyzed using the SPSS (version 23) statistical software package from the USA, which was installed on an IBM compatible PC running Windows 10.

Descriptive statistics were used to describe qualitative data in the form of numbers and percentages. For parametric data, quantitative data were described in terms of mean and standard deviation (SD).

Analytical statistics were used to compare quantitative data using Student’s t test. A P value of > 0.05 indicated nonsignificant, P = 0.05 indicated significant, P = 0.01 indicated highly significant, and P = 0.001 represented highly significant.

Results

The mean ± SD BMI of the study participants was 33.1 ± 3.9 kg/m2 (range 29.9–45.9 kg/m2), and the mean ± SD waist–hip ratio (WHR) was 0.90 ± 0.07 (range 0.77–1.10) (Table 1).

Table 1 Anthropometric measures of obese male students
Full size table

All the InBody bioelectrical impedance test parameters showed no statistically significant relationship with vitamin D levels (P > 0.05) (Table 2).

Table 2 Vitamin D status in relation to InBody bioelectrical impedance among obese male medical student
Full size table

Bsml gene polymorphism also showed no statistically significant relationship with the InBody bioelectrical impedance parameters (P > 0.05) (Table 3).

Table 3 Bsml Polymorphism in relation to InBody bioelectrical impedance among obese male medical students
Full size table

The relationship between vitamin D levels and the genotypes BB and Bb of Bsml gene polymorphism is presented in Table 4 and Figs. 1 and 2. There was no statistically significant relationship between Bb and BB genotypes in Groups I and II, with the prevalence of BB genotype being higher in the vitamin-D-deficient group (P = 1.00 in Fisher’s exact test). The frequency of Bb genotype (80%) among obese subjects is shown in Fig. 2.

Table 4 BsmI gene polymorphism among male obese students with deficient and nondeficient vitamin D levels
Full size table
Fig. 1
figure 1

BsmI gene polymorphism among male obese students with deficient and nondeficient vitamin D levels

Full size image
Fig. 2
figure 2

BsmI gene polymorphism among obese male students

Full size image

We found no statistically significant relationship between the iron profile (iron level, ferritin level, TIBC, and transferrin saturation) and Bsml gene polymorphism, as shown in Table 5 and Fig. 3 (P > 0.05). However, the relationship between HbA1c level and Bsml gene polymorphism was statistically significant (P = 0.002), with a higher mean value in Bb genotype carriers than in BB genotype carriers. This figure shows that the relation between HbA1c and BsmI gene polymorphism was statistically significant with an increase in mean value in Bb genotype than BB genotype.

Table 5 Iron profile and HbA1C in relation to Bsml gene polymorphism among obese male medical students
Full size table
Fig. 3
figure 3

Relation between BsmI polymorphism and HbA1c

Full size image

Table 6 and Fig. 4 present the relationship between CBC parameters and Bsml gene polymorphism. A statistically significant difference was found in eosinophil count between the BB and Bb genotype carriers (P = 0.045), with the Bb genotype carriers showing a higher mean value than the BB genotype carriers. Other CBC parameters showed no statistically significant relationship with Bsml gene polymorphism (P > 0.05).

Table 6 Blood cells profile in relation to Bsml gene polymorphism among obese male medical students
Full size table
Fig. 4
figure 4

Relation between BsmI polymorphism and Eosinophil

Full size image

Discussion

Vitamin D deficiency has remained a global problem over the past 25 years. Due to polymorphic VDR expression, an individual may obtain little or no vitamin-D-related advantages even if his/her vitamin D levels are normal. Multiple clinical investigations have linked VDR gene polymorphisms, including FokI, ApaI, TaqI, and BsmI, to obesity and metabolic syndrome. Genetic and immunological investigations have been conducted on obese individuals to explore the mechanisms underlying VDR polymorphism (BsmI) in the etiology of obesity [10].

Regarding the VDR gene polymorphism BsmI, we found that 24 participants had the Bb genotype, and six had the BB genotype, indicating that the “b” allele was more prevalent among obese participants.

Vitamin D levels and BsmI gene polymorphism also showed a correlation. In Group I with normal vitamin D levels, all the seven subjects with insufficient vitamin D levels had the Bb genotype (six Bb genotype carriers and one BB genotype carrier), whereas in Group II with deficient vitamin D levels, all the five participants were Bb genotype carriers. In contrast, we detected 13 Bb genotype carriers and 5 BB genotype carriers in Group II with low vitamin D levels. The incidence of BB genotype was higher among vitamin-D-deficient individuals, and Bb genotype carriers were more common among obese participants than BB genotype carriers. Nevertheless, the findings were not statistically significant.

In some populations, VDR and its genetic variations are known to influence the risk of obesity. Although the significance of low vitamin D levels in the development of obesity remains uncertain, some studies have shed light on the link between the two conditions. According to Kull et al., obese people are less exposed to sunlight compared with nonobese adults because of reduced physical activity or clothing patterns that impair cutaneous vitamin D production [11]. Another in vitro study demonstrated that deficient vitamin D levels in obese subjects are due to adipose tissue sequestration of this vitamin [9].

Another notion is that due to hepatic steatosis, vitamin D production by the liver is reduced in obese people. Moreover, higher levels of circulating leptin and interleukin 6, which are largely produced by adipose tissue, may impede vitamin D production through their receptors [12].

Vitamin D deficiency also causes impaired insulin sensitivity, increased fat mass, and accelerated lipogenesis [13].

Human subcutaneous adipose tissue, visceral adipose tissue, and breast adipocytes have been found to express VDR. Vitamin D can both control and be regulated by adipose tissue. Human adipocytes have been shown to exhibit VDR, 25-hydroxyvitamin D 1-hydroxylase genes, and the 24-hydroxylase enzyme [14].

Ruiz-Ojeda et al. reported about relationships with VDR polymorphisms that could be attributed to either a major effect of vitamin D on adipocyte differentiation and metabolism or an indirect effect via the modulation of insulin secretion [15]. Vitamin D is known to suppress gluconeogenesis, enhance HDL cholesterol levels, improve the adipokine profile, and increase leptin levels in adipose tissue. The active metabolite of vitamin D affects pancreatic beta cells, changing insulin sensitivity and improving the lipid profile. Consequently, insulin receptor expression increases, and insulin sensitivity improves. Vitamin D is required for reducing the risk of type 2 diabetes and altering the adipokine secretion profile [16].

Although we found no statistical significance between VDR gene polymorphism and BMI, waist–hip ratio (WHR), or other InBody bioelectrical impedance parameters in our study concerning the association between VDR gene polymorphism and obesity development, we did observe a prevalence of Bb genotype carriers among obese male students. Because the BsmI gene is found in the introns of VDR gene, it may have an impact on gene expression, mRNA stability, and protein translation efficiency [17]. Thus, according to Chen et al., SNPs such as the “b” allele in BsmI, which can result in reduced VDR mRNA and protein expressions, may be related to an increased risk of developing obesity [18].

Bagheri et al. found that BsmI polymorphism was not associated with obesity risk in the Iranian population [19]. However, another study showed that the “b” allele of the BsmI marker was more common among obese Saudi Arabians [9].

The effects of VDR polymorphism on body size were also explored, and it was found that the “b” allele in BsmI was linked to obesity in Caucasian women [20].

There was no relationship between vitamin D levels and the InBody bioelectrical impedance characteristics in our study. Other studies on people with vitamin D deficiency and obesity also showed no relationship between vitamin D levels and visceral fat, which supports our findings [21]. In two clinical trials of obese people, no significant changes were detected in body weight, WHR, or vitamin D levels [22],23.

Our findings support those of Vimaleswaran et al., who found no relationship between VDR, waist circumference, BMI, and other obesity-related parameters. Tworowska-Bardziska et al. also validated this conclusion in their study on a Polish cohort [24]25.

However, our findings were in contrast to the study of Bienertová-Vašků et al. conducted on 882 Central European Caucasian individuals, in which weight, height, BMI, lean body mass, fat mass, body fat, waist and hip circumference, waist–hip ratio, and skinfold thickness were measured, and the VDR BsmI gene polymorphism was investigated, reporting a relationship with waist circumference [26]. The cross-sectional study of Karonova et al. on 697 participants supports our findings. They evaluated the VDR gene polymorphism rs1544410 (BsmI), serum vitamin D concentration, and anthropometric measurements and reported no significant relationship between the VDR SNP rs1544410 (BsmI), serum vitamin D concentration, anthropometric characteristics, and metabolic syndrome risk [27].

Zhao et al. conducted a study on Northern Chinese population and observed a strong relationship between the BsmI VDR gene polymorphism and metabolic syndrome, which is in contrast to our findings. They found that the BB genotype and B allele were risk factors for metabolic syndrome. The role of the bb genotype was unknown due to its rarity [28].

Marozik et al. predicted that the level of VDR mRNA was dramatically higher in BB genotype carriers than in bb genotype carriers, which could explain our study finding regarding the predominance of BB genotype with vitamin D deficiency in obese male students. VDR receptor expression was higher among BB genotype carriers, resulting in enhanced vitamin D catabolism. A possible mechanism is that a variation in VDR receptor activation alters vitamin-D-mediated gene expression [29].

Our findings, which were consistent with those of El-Hoseiny et al., showed that vitamin D insufficiency was more common among BB genotype carriers (66.7%) than among Bb and bb genotype carriers (33.3%) [30]. El-Edel et al. also found that patients with beta thalassemia with the BB genotype had significantly lower bone mineral density than those with the bb or Bb genotype [31].

We suggest that people with VDR genotypes have a wide range of serum vitamin D concentrations, which further suggests that vitamin D supplementation may not be appropriate for everyone. The association between genetic variations and vitamin D status should also be further investigated.

Vitamin D exerts functions such as antioxidation, free radical scavenging, and neuroprotection. Therefore, a deficiency in this vitamin plays an important role in the initiation and progression of hypertension. The renin–angiotensin system, which has been reported to regulate blood pressure through vitamin D, is well known to be at the center of hypertension regulation [32].

Vitamin D acts on VDR, which is found on B cells, T cells, dendritic cells, and macrophages, and possesses immunomodulatory capabilities. VDR-expressing eosinophils have a longer lifespan [33].

In the present study, we detected a statistically significant difference between BB and Bb genotype carriers in terms of eosinophil count, with Bb genotype carriers having a higher mean value than BB genotype carriers. This finding may have implications for VDR function and, therefore, the role of vitamin D in immunomodulation. Further research is required to understand better about this enigmatic association.

In contrast to the study of De Groot et al., Filho et al. reported that lower serum vitamin D levels were related to an increased blood eosinophil count [34] [35].

We observed a statistically significant relationship between HbA1c levels and BsmI gene polymorphisms and an increase in mean value in Bb genotype carriers compared with BB genotype carriers. According to Ezhilarasi et al., BsmI SNPs in the VDR gene are associated with a range of biochemical markers, including BMI, fasting glucose, HbA1c, and lipid profile [36]. The study of Mackawy and Badawi [37] also supports our findings.

The primary strength of our study was the fact that it is a pilot investigation, and moreover, all candidates were of same age and gender, which helps reduce gender disparities in various parameters. This study is also a continuation of a large project attempting to determine the effect of vitamin D and VDR gene polymorphism on obesity and its negative outcomes on various scales. In addition, laboratory tests were conducted by trained specialists, and the individuals provided detailed physical and medical history.

However, the small sample size may be the most significant limitation in our study. Moreover, we investigated only one VDR SNP, and hence, further research on other VDR gene polymorphisms is necessary to widen our study scope and understand better about the complex relationship between VDR gene polymorphism and obesity.

Conclusions

The VDR gene polymorphism BsmI and BMI, as well as the various InBody bioelectrical impedance parameters, showed no significant relationship. There was also no significant relationship between BsmI gene polymorphism and vitamin D levels; however, vitamin D deficiency was observed to be more common among BB genotype carriers than among Bb genotype carriers, suggesting that the BB VDR genotype is a key cause of vitamin D deficiency. Moreover, we found that obese students have a high incidence of the “b” allele. We also noticed a relationship between BsmI gene polymorphism and HbA1c level and eosinophil count, which requires further investigation.