Background

Early 2007, a search for genes deleted in Wilms' tumors, a pediatric solid tumor of the kidney led to the identification of the X-linked gene WTX (also called AMER1) [1]. Using large-scale interactome mapping a second independent study demonstrated that WTX induces degradation of β-catenin via the proteasome system, thus identifying this gene as an important modulator of this crucial signaling pathway [2]. Wtx/Amer1 also physically interacts with APC [3], a tumor suppressor gene involved in colorectal cancer [4]. In addition, on the cellular level WTX localizes to subnuclear domains that have been identified as paraspeckles [5]. Recent analysis suggests that WTX may also play an important function during normal development: expression analysis demonstrated a dynamic expression pattern throughout embryogenesis [6] and mutations have been identified in patients suffering from a range of developmental defects including osteopathia striata congenita with cranial sclerosis (OSCS) and cardiac anomalies [7]. To better characterize the functional and structural properties of the WTX/AMER1 gene it is essential to understand its molecular evolution and its phylogenetic history. Duplications are common events during evolution and are one of the main driving forces for the emergence of new genes that can lead to the appearance of new gene families. The aim of the present study was to identify potential new members of the "WTX/AMER" family, characterize their phylogenetic relationships and analyze their evolutionary history.

Results and Discussion

Wtx/Amer1 is the founding member of a novel vertebrate gene family

Using the WTX/AMER1 sequence as a bait for protein-protein comparisons in the human genome, FAM123A (AMER2) and FAM123C (AMER3) were identified as two genes that share several domains of significant sequence identity with WTX/AMER1 and are located in chromosomes 13 and 2 respectively. Amer2 and Amer3 were also present in mouse mapping to chromosomes 14 and 1 respectively. Alignment of the mouse and human sequences highlighted the presence of six highly conserved blocks that we named B1 to B6 (Figure 1 and additional file 1, Figure SM1). The mouse and human AMER proteins are encoded by a single exon although 5' untranslated sequences map to additional exons (additional file 1, Figure SM1). In the case of WTX/AMER1 additional splicing within the coding exon can result in alternative protein variants [7]. These spliced forms are detected after transient transfection of mouse Wtx/Amer1 in human cells, but not in mouse embryos from E9.5 to E14.5 dpc (Figure 2). Sequencing of RT-PCR products from the embryonic samples indicated the presence of a shorter transcript than expected for Amer2 (Figure 2). This result showed that splicing leads to an in-frame deletion of amino acids within the N-terminal region of Amer2. The existence of two variants for human AMER2 had already been reported by Grohmann et al. (2007) [3] after in silico analysis. Alignment of the spliced form of Amer2 with the full-length transcript revealed a splice site donor with an AG-GT core sequence which is universally found at the exon/intron junction. Sequence analysis localized this splice site donor just after the conserved domain B2 (see Figure 1). By contrast, Amer3 does not seem to undergo splicing, as we detected only one long transcript by RT-PCR both in mouse embryos and in transiently transfected cells with mouse Amer3 (Figure 2).

Figure 1
figure 1

Primary structure and specific conserved sequence blocks of Amer proteins. Overall structure of human WTX/AMER1, AMER2 and AMER3 showing the relative position of the conserved blocks (B1 to B6), the APC interacting domains, the nuclear localization signal (NLS), the internal splicing sites (donor and acceptor), the phospholipid binding activity and the β-catenin binding region. Note that B2 partially overlaps with the NLS in human WTX/AMER1. In contrast, only the splicing acceptor is located in a conserved domain (B3). The conserved consensus sequences of domain B1 to B6 are depicted in Figure SM1 B (additional file 1).

Figure 2
figure 2

Alternative splicing of Amer transcripts. RT-PCR of the N-terminus of Amer transcripts performed from E9.5 to E14.5 mouse embryos and HEK293T cells transfected with Wtx/Amer1 (HEK-A1), Amer2 (HEK-A2) or Amer3 (HEK-A3). Two RNA products are detectable by RT-PCR after transfection of HEK293T cells with mouse Wtx/Amer1 as previously reported [5] (right gel in the Wtx/Amer1 box). By contrast, a single band corresponding to the full-length transcript is detected in mouse embryos suggesting that regulation of splicing may be cell type dependent (left gel). For Amer2, only one transcript is detected endogenously in mouse embryos and after transfection of HEK293T cells. Nucleotide sequence analysis revealed a 357-bp (119 amino acids) deletion and indicated that Amer2 mRNA is produced by alternative splicing in the 5' end of exon 1. For Amer3, a single band corresponding to the full-length transcript is detected either in mouse embryos or after transfection of HEK293T cells. Results have been obtained with three different primer pairs for each Amer gene. RT: RNA samples incubated with reverse transcriptase; control: RNA samples incubated without reverse transcriptase as a DNA contamination control.

To further investigate the evolutionary origin and phylogenetic distribution of the Amer genes, we extended the in silico searches to other available genomic databases. We could identify orthologs of Wtx/Amer1, Amer2 and Amer3 in primates (i.e. Pan troglodyte), and all other studied mammals (i.e. Canis familiaris), including the most basal therian groups, xenarthra (i.e. Dasypus novemcinctus), marsupials (i.e. Monodelphis domestica) and monotremes (i.e. Ornithorhynchus anatinus). The three Amer genes were also present in other tetrapod species such as birds (i.e. Gallus gallus), amphibians (i.e. Xenopus tropicalis) and in actinopterygians (i.e. the teleost fish Danio rerio) (for a complete list of orthologs see additional file 2; Table S1). We were unable to find any ortholog in cyclostome genomes such as the lamprey (Petromyzon marinus), but this is probably due to the fact that this genome has not yet been completely sequenced and assembled.

In stark contrast to their presence in apparently all vertebrates, no Amer genes could be identified in the genomes of model invertebrates including flies or nematodes and other protostomes such as mollusks (Lottia gigantea) and annelids (Capitella capitata). A similar situation already exists for other Wnt signaling components such as the Dkk family, which was believed to be vertebrate specific [8]. More recently, however, Dkk genes have been described in the diploblastic hydra and sea anemone [9]. It has, therefore, been postulated that gene families are missing in model protostomes due to the fast evolutionary rates and rampant gene loss in Drosophila and Caenorhabditis elegans genomes [10]. To test whether a similar situation may exist for the Amer gene family, we searched for Amer orthologs in a wide range of metazoans, from the most basal (cnidarians and placozoans) to the vertebrates' closest relatives. No hits in any of the analyzed genomes could be detected, not even in non-vertebrate chordates (i.e. Branchiostoma floridae, Ciona intestinalis) and other non-vertebrate deuterostomes such as sea urchin (Strongylocentrotus purpuratus) despite the low occurrence of gene loss in some of these species [11]. Although we cannot rule out the possibility that Amer-related genes are present in some of these species, but have diverged beyond recognition, our data strongly suggest that this gene family is vertebrate specific. While the six conserved blocks of sequences found in the human and mouse proteins are present in all the vertebrate orthologs (Figure 1 and additional file 1, Figure SM1), PROSITE analysis did not identify protein domains of known function (additional file 1, Figure SM2). Taken together, our data support the common origin of the three genes, which seemed to have arisen at the time of the origin of vertebrates.

Phylogenetic relationship of Wtx/Amer1, Amer2 and Amer3

To analyze in more detail the evolutionary history of the Amer gene family we constructed a phylogenetic tree using the protein sequences identified above. Phylogenetic analysis revealed that Wtx/Amer1, Amer2 and Amer3 form three independent groups in each class of vertebrate species from fish to placental mammals (Figure 3A). Among the three genes Wtx/Amer1 and Amer2 show a higher extent of sequence similarity (see similarity percentage Figure 3B). In all the species analyzed, the three genes are located on three different chromosomes suggesting that they evolved by genome duplications rather than tandem duplication events (additional file 1, Figure SM3). If Wtx/Amer1, Amer2 and Amer3 genes arise from a common ancestor, one should expect to find them in the vicinity of a common gene family. Schematic representation of chromosomal locations for each gene is given in Figure SM3 (additional file 1). The following genes were found in syntenic position with Wtx/Amer1, Amer2 and Amer3: MTMR6/8 (myotubulin related protein 6/8) and ARHGEF4/9 (cdc42 guanine nucleotide exchange factor (GEF) 4/9). In Drosophila the ortholog for both MTMR6 and MTMR8, is the gene (CG3530) located on chromosome 2R. Similarly, the ortholog for ARHGEF4 and ARHGEF9 is RhoGEF3, a gene located on the Drosophila chromosome 3L (additional file 1, Figure SM3). At those two putative syntenic regions, we could not find any gene with significant level of sequence conservation to the Amer gene family. More precisely none of the six conserved sequence blocks could be found in the genes neighbouring CG3530 or RhoGEF3. The fact that ARHGEF4/9 is a neighbour of both Wtx/Amer1 and Amer3 and that MTMR6/8 neighbours both Wtx/Amer1 and Amer2 suggested that the ancestors of these two gene families (ARHGEF and MTMR) were located close to each other early in the vertebrate lineage (additional file 1, Figure SM4). This suggests a loss of paralogs after or between the two rounds of complete duplication in vertebrates (additional file 1, Figure SM4). Based on our analysis, we propose an evolutionary model (additional file 1, Figure SM4) that is consistent with the two rounds of complete genome duplication in vertebrates [12]. In our model, a putative Amer4 gene may have been lost after duplication and the presence of a "protoAmer" at the basis of the vertebrate lineage would represent the ancestral vertebrate condition preceding the gene split into Amer1/2 and Amer3/4 (additional file 1, Figure SM4). Surprisingly, the ortholog distribution of Wtx/Amer1, Amer2 and Amer3 in teleosts does not reflect the additional round of genome duplication that occurred in these species (Figure 3A). A secondary loss of the duplicated genes can explain the present situation. Analysis of the degree of identical residues between human and zebrafish Amer gene products shows that it is relatively conserved (additional file 3, Figure SM5). In addition, residues showing a high degree of similarity after multiple alignment of Amer proteins from human and zebrafish correspond to the specific conserved domains found in Amer proteins (Block B1 to B6, Figure 1; additional file 1, Figure SM1).

Figure 3
figure 3

Phylogenetic analysis of the Amer gene family. A. Unrooted Bayesian phylogenetic tree of Wtx/Amer1, Amer2 and Amer3 from each class of the vertebrate subphylum using the whole sequence estimated under the JTT + I + G model (1 MrBayes run of 1,000,000 generations; 453,000 generation burn-in). Numbers indicate posterior probabilities. Abbreviations of taxa are described in Table S1 (additional file 2). Multiple alignment is provided in Figure SM7 (additional file 4). B. Similarity percentage between human and mouse Amer proteins for the whole sequence showing that WTX/Amer1 and Amer2 are more closely related. Identical results were obtained for chicken and teleost fishes (data not shown).

The radial phylogenetic tree (additional file 3, Figure SM6) confirmed the subdivision of the three genes into three different groups.

Divergent and conserved molecular functions of Wtx/Amer1 genes

As noted by François Jacob in 1977, it is at the molecular level that the tinkering aspect of evolution becomes most apparent [13]. Even when gene families evolve by duplication, their members can undergo significant changes leading to structural and functional diversity. According to this view, the protoAmer gene may have encoded a short protein to which the highly divergent C-terminal half of WTX/AMER1 and AMER3 might have been added at a later time point during evolution (Figure 1). This C-terminal part of the WTX/AMER1 protein is of importance as it has been demonstrated to be involved in the degradation of the Wnt signaling pathway effector β-catenin [2]. According to the primary structure we expect that Amer2 and Amer3 are unable to inhibit β-catenin activity. Indeed, Amer2 failed to counteract β-catenin activation in an in vitro reporter system (Figure 4). While Wtx/Amer1 and Amer3 are both long proteins, their C terminal half lacks significant sequence identity and our phylogenetic analysis places the two genes into two different groups (see radial phylogenetic tree and cladogramme). Functional experiments revealed that Amer3 was also unable to decrease β-catenin dependent gene activation (Figure 4). Taken together these data indicate that Wtx/Amer1 might have been co-opted to interact with β-catenin. While addition of the β-catenin interaction domain to Wtx/Amer1 seems to be the most likely scenario, we cannot completely rule out the possibility of a functional loss of this capability in Amer2 and 3 proteins. In contrast, the function of the Amer gene family as proteins that recruit APC to the membrane might be conserved, as both WTX/AMER1 and AMER2 possess sequences that allow the molecular interaction with APC (Figure 1; [3]). The APC interacting domains overlap four of the six conserved blocks (Figure 1) indicating that AMER3 might also be involved in APC shuttling. If so, it seems that the ability to recruit APC is one of the ancestral functions of the Amer family.

Figure 4
figure 4

Regulation of β-catenin activity by Amer proteins. Co-transfection experiments of β-catenin and mouse Amer expression constructs together with a luciferase reporter gene (TOP-flash) into HEK293T cells are shown. The TOP-FLASH construct is designed to measure transcriptional activation mediated by β-catenin. As previously reported, WTX/AMER1 acts as a negative regulator of β-catenin activity. In contrast, AMER2 and AMER3 do not interfere with β-catenin dependent activation of the TOP-flash reporter gene. Luciferase values were normalized to β-galactosidase. Data are the average of two independent experiments ± SEM. * p ≤ 0.01.

Conclusion

In this study we reported the first phylogenetic analysis of the Amer gene family and identify Amer3 as a novel family member. The common ancestry of the three Amer genes is supported by the presence of six conserved sequence blocks in all the orthologs, as well as the syntenic conservation with NTMR and ARHGEF paralogs in their three genomic loci. The absence of any sequence similarity to Amer genes in invertebrate genomes and the presence of three Amer paralogs in all studied vertebrate species strongly support the hypothesis that these genes are novel inventions that originated early in vertebrate evolution. Additional functional studies using animal models misexpressing Amer2 and Amer3 or knock out alleles will be required to determine their exact function in embryogenesis. Given the importance of Wtx/Amer1 in normal development and its involvement in human pathologies, it is tempting to speculate that mutations in Amer2 and Amer3 may also underlie developmental disorders.

Methods

Database search and sequence queries

Search for Amer homologous proteins in vertebrates was made through the NCBI and Ensembl (http://www.ensembl.org; release 56, september 2009) protein databases (see the complete list in additional file 2; Table S1). In silico proteins were obtained using GenomeScan software (http://genes.mit.edu/genomescan.html). In order to find potential orthologs in invertebrate genomes, mouse Wtx/Amer1, Amer2 and Amer3 were blasted against the amphioxus (http://genome.jgi-psf.org/Brafl1/Brafl1.home.html), the sea urchin (http://www.spbase.org/SpBase/) the sea anemone (Nematostella vectensis, http://genome.jgi-psf.org/Nemve1/Nemve1.home.html), annelid (Lottia gigantea, http://genome.jgi-psf.org/Lotgi1/Lotgi1.home.html), mollusk (Capitella capitata, http://genome.jgi-psf.org/Capca1/Capca1.home.html) and placozoan (Trichoplax adhaerens, http://genome.jgi-psf.org/Triad1/Triad1.home.html) genomes using tblastn under unrestrictive conditions (e-value = 100). No hits were found. The absence of Wtx/Amer1 from the Drosophila genome has been previously reported [1].

Alignment and phylogenetic analysis

Amino acid sequences of Wtx/Amer1, Amer2, Amer3 were aligned using Clustal W [14] and manually corrected with BioEdit [14, 15]. Bayesian Inference trees were performed using MrBayes 3.1.2 [16, 17] with the model recommended by ProTest 1.4 [18] under the Akaike information and the Bayesian information criterions. We used the JTT + I + G model for both trees. Convergence was reached when the value for the standard deviation of split frequencies stayed below 0.01. Burn-in was determined by plotting parameters across all runs for both analysis: all trees prior to convergence were discarded and consensus trees were calculated for the remaining trees. We used one MrBayes run of 1,000,000 generations and 453,000 generation burn-in for the tree presented in Figure 3A and one MrBayes run of 2,000,000 generations and 1,893,000 generation burn-in for the tree presented in Figure SM6 (additional file 3). The trees were viewed and edited with the TreeExplorer programme in MEGA 4.0 [19]. Maximum likelihood analysis was conducted using RAxML version 7.0.3 [20] using a JTT model of evolution, 1000 bootstrap replicates and the rapid bootstrapping algorithm. The phylogenetic tree obtained using ML is consistent with the one obtained by Bayesian inference (data not shown). Alignment files used to calculate the phylogenetic trees are presented in Figure SM7 and SM8 (additional file 4 and 5 respectively).

Plasmids

The plasmid expressing human β-catenin was kindly provided by Jurgen Behrens (University of Erlangen, Germany). The TOP-FLASH and FOP-FLASH luciferase reporter constructs have been described previously [21]. Briefly, the TOP-FLASH construct is designed to measure transcriptional activation mediated by β-catenin and FOP-FLASH is the mutated counterpart of the TOP-FLASH plasmid. Mouse Wtx/Amer1, Amer2 and Amer3 expression plasmids were obtained by PCR amplification of the coding sequence from BAC constructs (bMQ-277D5 for Wtx/Amer1, bMQ-344G22 for Amer2 and bMQ-123E19 for Amer3) (Geneservice, Cambridge, UK)) and insertion into the pAcGFP1-C1 plasmid (Clontech). All constructs were verified by DNA sequencing.

Detection of Wtx/Amer1 and Amer2 variants by RT-PCR

Total RNA from E9.5 to E14.5 dpc mouse embryos or Wtx/Amer1, Amer2 or Amer3 transfected HEK293T cells was extracted using TRIzol reagent (Invitrogen) and RNA purification was performed using the RNeasy Mini kit (Qiagen) and Rnase-free DNAse digestion (Qiagen). cDNA were synthesized from 1 μg of RNA using the MMLV reverse transcriptase system and random hexamers (Invitrogen). All PCR assays were performed using the GoTaq® Green Mix for PCR (Promega). Amplification of the N-terminus of Wtx/Amer1, Amer2 and Amer3 was performed using three different pairs of primers for each gene. Primer sequences used in Figure 2 are as follows: Wtx/Amer1, foward: tgaggcaacagaaggacca, reverse: tggagagtcaacaggatgaagctgttcaa; Amer2, foward: atggactcgcattgtgagtgcg, reverse: cgagctcccatctgcaaa; Amer3, foward: gaggagaggaaagaccttcatc, reverse: tcccagaacttgttgaagtctg. The other primer pairs used in this assay are available on demand. Briefly, all forward primers were located in the non-coding exon 1 or at the 5'end of exon 2 and all reverse primers just downstream of the internal splicing acceptor. PCR products were sequenced (SeqLAB, Sequence Laboratories, Göttingen, Germany) to check the specificity of Amer variants.

Reporter assay

HEK293T cells were cultured in DMEM supplemented with 10% (v/v) fetal calf serum, in a 5% CO2 humidified atmosphere. HEK293T cells were transiently transfected with the TOP-FLASH reporter or its mutated counterpart (FOP-FLASH) and β-catenin with either Wtx/Amer1, Amer2 and Amer3 expression plasmids (200 ng each). Cells were also co-transfected with 50 ng of CMV (cytomegalovirus)-β-galactosidase as an internal control. Transient transfection of expression plasmids was performed with Fugene according to manufacturers instructions (Invitrogen). After 36 h, luciferase activity was measured according to the Luciferase Assay System (Promega) and data were normalized to β-galactosidase activity and plotted. Luciferase activities obtained after transfection with the FOP-FLASH construct are not shown as they were close to zero for each condition.