Abstract
The addition of biochar could mitigate the bioavailability of heavy metals during livestock manure composting. However, the main action mechanism of biochar, such as how it worked, was ambiguous. Therefore, in this study, materials (biochar, alkali modified biochar, pretreated cotton ball) were added by embedding with nylon mesh bags to explore the adsorption performance of added materials and its influence on the composting process. The results showed that embedded materials promoted the formation of humic acid and reduced the distribution proportion of bioavailable fraction of heavy metals during composting (Cu: at least 15.72%; Zn: at least 33.44%). The surface of biochar extracted from composting contained attachments, however, the attachment of heavy metal was not detected and functional groups on the materials did no change significantly. This indicated that the addition of biochar did not directly adsorb heavy metals. Most notably, the microbial network changed after embedding materials, and the succession of microbial community promoted the formation of humic acid. Ultimately, structural equation models verified that embedded materials promoted the formation of humic acid through stable microbial groups, thereby accelerating the passivation of heavy metals during composting. This study provides theoretical and technical supports for mitigating the biotoxicity of heavy metals by biochar during composting.
Graphical Abstract
Highlights
-
Embedded material promoted humic acid formation and reduced the toxicity of metals.
-
The bacterial community structure and function distribution changed.
-
Biochar addition promoted humic acid formation through stable community.
-
The added biochar did not adsorb heavy metals, but promote passivation by humic acid.
Similar content being viewed by others
Explore related subjects
Find the latest articles, discoveries, and news in related topics.Avoid common mistakes on your manuscript.
1 Introduction
A large quantity of livestock manure is produced owing to intensive farming, which exceeds the absorptive capacity of farmland (Dotaniya et al. 2022). Therefore, how to accelerate the utilization of livestock manure is an urgent problem to be solved. Composting and anaerobic digestion are the main treatment means of livestock manure (Zhou et al. 2021; Liu et al. 2021). Composting has the characteristics of simple operation and is environment-friendly, so the technology is widely applied to the comprehensive utilization of livestock manure (Zhang et al. 2020; Qian et al. 2018). Composting can degrade organic substances in manure and transform them into more valuable humus substances (Li et al. 2021a; Qu et al. 2022). Meanwhile, pathogenic bacteria are killed in the thermophilic phase of composting (Gou et al. 2018; Mishra et al. 2022), and most pollutants such as antibiotics and polycyclic aromatic hydrocarbons can also be biodegraded, thereby obtaining more valuable and less toxic organic fertilizers (Congilosi and Aga 2021). However, livestock manure also contains a large number of refractory pollutants, such as heavy metals. This was caused by the addition of a large amount of Cu and Zn in the breeding process to promote animal growth and reduce intestinal diseases (Duan et al. 2021). The heavy metal content presented the increased trend due to the degradation of organic matters during composting. The content of heavy metals in compost products was at least 20% higher than that of initial materials, and some were even more than twice as high (Cui et al. 2020; Duan et al. 2021). Therefore, heavy metal pollution is a potential threat in the application of composting products (Zhang et al. 2017).
It is difficult to remove heavy metals during composting, therefore, mitigating the bioavailability of heavy metals is the main way to alleviate heavy metal pollution during composting. Many studies have demonstrated that the proportion of weak acid extracted or reducible heavy metals reduced during composting, while the proportion of organically bound and residual heavy metals increased. The organically bound heavy metals were mostly combined with humus substances to realize heavy metal passivation (Zhang et al. 2017). In addition, heavy metal ions added to composting could also be quickly transformed into the carbonate-bound state, and mitigated the toxicity of heavy metals (Chen et al. 2022). Nevertheless, the passivation efficiency of heavy metals was at a relatively low level during composting. Therefore, researchers have widely developed techniques and methods that can strengthen the heavy metal passivation during composting (Liu et al. 2019; Li and Song 2020). Biochar, as a popular material, has also been found to possess a nearly all-around role during composting (Hou et al. 2021). The application of biochar to composting was conducive to composting improvement and contaminant reduction (Godlewska et al. 2017), including influencing microbial community structure, reducing nitrogen loss, promoting organic matter degradation and humification, and mitigating the bioavailability and mobility of heavy metals (Cui et al. 2020; Zhou et al. 2018; Awasthi et al. 2020). In the previous studies, the relevant studies almost used black-box research methods, focusing only on the change of indicators, without specifying the specific impact pathway. Specifically, biochar has strong adsorption capacity for heavy metals (Mahmoud and Kathi 2022). The addition of biochar can theoretically adsorb heavy metals to mitigate the bioavailability of heavy metals. In addition, biochar can also improve the quality of compost (Godlewska et al. 2017; Cui et al. 2020), such as the elevation of humus substance and other organic substances and the increase of pH value, so as to accelerate the passivation of heavy metals. However, in fact, the specific mechanism for biochar to reduce the bioavailability of heavy metals was unclear during composting.
At present, biochar was often added to compost in scattered form, which was difficult to recover to determine the adsorption performance of biochar. Given that, this study adopted the method of wrapping and embedding biochar. Specifically, a certain amount of biochar was put into the nylon mesh bag and then added to compost. This was conducive to the separation of added biochar from the composting to explore the action mechanism of materials. In addition, this way was convenient to change the implementation position of biochar and replace contained biochar at any time, which was also conducive to improving the application efficiency. Collectively, the object of this paper was to: (1) explore the effect of embedded biochar on basic indexes of composting in the context of heavy metal stress; (2) clarify the main action mode of added biochar during composting; (3) reveal action mechanism that biochar reduced the biotoxicity of heavy metals during composting. This study provided the theoretical and technical supports for mitigating the biotoxicity of heavy metals by biochar during composting.
2 Materials and methods
2.1 The preparation of materials
Biochar was made from corn straw under a vacuum and oxygen-free state in an atmosphere furnace (Kejia Furnace, KJ-M1200-8LZ, China). The temperature program of atmosphere furnace was set as follows: Heating up to 400 °C at the rate of 5 °C/min, keeping for 1h, and finally, cooling to room temperature at the rate of 5 °C/min. Biochar was obtained by carbonization in the state of no oxygen or low oxygen for 12 h. Biochar was ground into fine particles with a diameter of 100 mesh for use.
To have a better comparison, biochar was modified by different methods to enhance the ability to adsorb heavy metals in this experiment, including acid modification (HNO3, H2SO4 solution and mixtures) (Sahin et al. 2017), alkali modification (NaOH solution) (An et al. 2020), salt modification (AlCl3, MgCl2, FeCl3 solution) (Akgül et al. 2019) and oxidation modification (H2O2 solution) (Zuo et al. 2016). The performance of different modification methods was evaluated by measuring the adsorption capacity of Zn due to the greater toxicity (Additional file 1). The adsorption capacity of 2 mol L− 1 NaOH modified biochar was the highest, which was 81.62% higher than that of unmodified biochar. This is due to the increase of surface area of biochar by alkali modification (Ahmed et al. 2016), which also was confirmed by the result of electron microscope (Additional file 1). Therefore, the alkali modification was selected to treat biochar in this experiment. The specific modification method was as follows: The prepared biochar was added to 2 mol L-1 NaOH solution in the ratio of 1:20 and placed in a 70 oC water bath, during which it was shaken and stirred several times to make it fully mixed. Then, it was washed to neutral and dried in an oven at 80 oC. Finally, the modified biochar was collected for use.
For easy reference, cotton ball was selected owing to its excellent adsorption capacity (Abdelhameed et al. 2018). The cotton balls were pretreated to be rich in nutrients such as carbon and more similar to biochar in adsorption capacity and nutrient element composition. The specific treatment method was to soak the cotton ball in the sterilized LB medium and dry it naturally to keep it dry and contain voids.
2.2 Implementation of composting test
Chicken manure from the college of animal medicine in school and corn stalks from the surrounding area were chosen as raw materials. The C/N ratio of chicken manure and corn straw were determined, as shown in Additional file 1. Chicken manure and corn straw were mixed to make the C/N value reach about 25 (Wu et al. 2017). The mixed pollution of Cu and Zn was taken as the stress condition of heavy metals in this study because Cu and Zn were the main heavy metals in chicken manure (Chen et al. 2022). The addition amount was confirmed based on the approximate content of Cu and Zn after chicken manure composting (Cu2+: 200 mg/kg and Zn2+: 400 mg/kg). Simultaneously, sterilized water was added to make moisture content reach about 60%. The three adsorption materials were placed in nylon mesh bags with a size of 5 * 7 cm (width * length). The nylon mesh bags were purchased from the store. Each mesh bag was filled with 1 g biochar or alkali modified biochar. To ensure a univariate test, the pretreated cotton ball was also changed into a flake and put into the mesh bag to increase its contact area. Four treatments were set up in this experiment: control group (CK), biochar treatment (BC), modified biochar treatment (MB) and cotton ball treatment (CB). To meet the uniform distribution of nylon mesh bags in the composting reactor and ensure that biochar can fully contact with composting materials, the 10 nylon mesh bags containing corresponding materials were added to each reactor, and evenly placed in the compost materials. The device was a special cylindrical reactor (Chen et al. 2022). Each treatment had three parallels, for a total of 12 reactors. The temperature change is displayed in Additional file 1. The ventilation rate of composting was maintained at 0.5 L kg−1 min−1. It was necessary to turn it over regularly during composting, and constantly change the position of nylon mesh bags to make them contact more fully. The composting test lasted for 50 days based on the degree of humification. The five-point sampling method was adopted to take samples on days 1, 5, 8, 13, 30 and 50, which represented different stages of the composting. One part of the obtained mixed samples was naturally air-dried for the determination of basic physiochemical indexes and heavy metal related indexes. The other part was cryopreserved for DNA extraction and microbial community determination.
2.3 The physicochemical property determination
The organic matter (OM) content was measured through weight difference. Samples were ignited at 550 °C for 6 h to constant weight, and the value of weight difference was the OM content (Li et al. 2021a). The pH value was measured at the ratio of 1:10 (w/v) using a digital pH meter. The humic acid (HA) and fulvic acid (FA) contents were measured according to the following procedure: samples with a mix solution of 0.1 M Na4P2O7·10H2O and 0.1 M NaOH at 1:10 (w:v) ratio were shaking for 24 h at room temperature. The supernatant was filtered through the 0.45 μm membrane after centrifugation, and then pH was adjusted to 1 and left to stand at 4oC for 12 h. After centrifugation, the supernatant was FA, while the precipitate was dissolved with 0.05 M NaHCO3 to obtain HA. The total organic carbon was measured to represent HA and FA content (Zhu et al. 2021; Li et al. 2021b). To measure ammonia nitrogen (NH4+–N) and nitrate nitrogen (NO3−–N) concentration, fresh samples were shaken with 2 mol·L−1 KCl (1:10 ratio) at 200 rpm for 1 h. Then the filtrates were assayed by NaRSH’S colorimetry and UV-spectrophotometry (Yu et al. 2021). The heavy metal content was measured by the digestion method using concentrated acid (Cui et al. 2020). The four forms of heavy metal, acid-soluble fraction (F1), reducible fraction (F2), oxidizable fraction (F3) and residual fraction (F4), were extracted by the modified BCR sequential extraction method (Li et al. 2021b).
2.4 Characterization techniques
The nylon mesh bags were taken out on the 10th, 20th, 25th and 43rd days of composting, and ten new mesh bags containing materials were replaced. The removed mesh bags were marked and stored in a freezer at -20oC. To obtain an insight into the effectiveness of material adsorption, the Fourier transform infrared spectrometry (FTIR) (Nicolet is50) and scanning electron microscope coupled with energy dispersive spectroscopy (SEM-EDX) (SU8010-Element) were employed to determine the characterization of biochar and modified biochar.
2.5 Microbial community analysis
Fresh samples were employed to extract sample DNA by DNA kit. The universal primers 341 F (ACTCCTACGGGAGGCAGCAG) and 806R (GGACTACHVGGGTWTCTAAT) were employed to amplify the V3 and V4 regions of 16 S rRNA gene. The PCR product was used to perform high-throughput sequencing through an Illumina MiSeq platform by BGI Genomics.
2.6 Statistical analysis
The dynamics of physicochemical properties were analyzed by Origin 2021. SPSS version 23.0 was employed for multivariate statistical analysis. The network analysis was constructed in the R language (version 4.0.2) through the packages of Hmisc and igraph, and the network was visualized in the Gephi 0.9.2. The correlation heatmaps with Mantel test were also performed in the R language through the packages of Hmisc, corrplot, vegan and dplyr. The structural equation models were constructed by AMOS 20.0 software though the maximum likelihood evaluation program, which were used to reveal the potential ways of alleviating biotoxicity of heavy metals during composting.
3 Results and discussion
3.1 Effects of embedded materials on physicochemical properties
The OM content was decreased during composting (Fig. 1a). There were no significant differences in OM content among the four treatments on days 1, 5 and 8 of composting, however, the OM content in BC, MB and CB treatments was significantly lower than that in CK treatment during the maturity phase of composting (P < 0.05), indicating that adding materials effectively facilitated the degradation of OM in the context of heavy metal stress. Meanwhile, no significant difference in OM final content was found among BC, MB and CB treatments. In addition, embedded materials also significantly improved the HA content (Fig. 1b). HA is the main component of humic substance, which is significantly related to the degree of humification and represents the quality of composting (Zhu et al. 2021). Compared with CK treatment, the HA content in BC, MB and CB treatments increased by 57.18%, 59.55% and 103.97% on the 30th day of composting, respectively. The content of HA decreased slightly on the 50th day in each treatment, which was due to the formation of more complex structures by polymerization (Liu et al. 2020a). On the 50th day of composting, the HA content in MB and CB treatments was still significantly higher than that of CK treatment (P < 0.05).
Embedded materials had no pronounced effects on the changing trend of FA content, pH value, NO3−–N and NH4+–N content (Additional file 1). There were no differences among the treatments. In this experiment, the biochar was modified with NaOH solution, then washed to neutral and added to compost. Compared with CK and BC composting, the pH value of MB composting had no significant difference, indicating that the modified treatment was washed thoroughly. In addition, it was noteworthy that biochar itself was alkaline (Thomas et al. 2020), however, the pH value of composting environment was not changed compared with CK composting when it was embedded. This implied that the addition of biochar by embedding would not change the pH of composting. Therefore, pH would not be the main driving factor to reduce the biological toxicity of heavy metals during composting in this study (Novak et al. 2019). Consequently, embedded materials promoted the degradation of OM and the formation of HA without affecting the environmental pH and inorganic nitrogen trasformation during composting.
3.2 Changes in heavy metal content and speciation during composting
Differences in heavy metal content emerged between treatments from the 13th day of composting, which was due to the replacement of materials (Fig. 1c, d). Nevertheless, the OM content had also a pronounced difference on the 13th day of composting (Fig. 1a). Thus, it was difficult to judge the contribution of embedded materials to the change of heavy metal content. From another perspective, the OM degradation rate was tiny during the maturity phase of composting (from day 30 to day 50), and heavy metal content of CK composting remained relatively constant. However, heavy metal content decreased in treatments, especially Cu and Zn content in CB treatment and Zn content in BC treatment. Therefore, heavy metals could be removed by embedded materials, and pretreated cotton balls had a preferable effect, but the removal effect of heavy metals was nonsignificant (P > 0.05).
The proportion of the acid-soluble fraction of Cu (CuF1) increased after one day of embedding materials. However, the distribution proportion of CuF1 in BC, MB and CB composting was lower compared to CK composting at the end of composting (Fig. 2). The distribution proportion of CuF1 of BC, MB and CB composting decreased by 15.72%, 21.25% and 19.39%, respectively. Meanwhile, the distribution proportion of the residual fraction of Cu (CuF4) was expanded. These results indicated that embedded materials could reduce the biotoxicity of Cu during composting. Zn mainly existed in the form of F2 during composting (Fig. 3), which was identical with other research results (Guo et al. 2021; Chen et al. 2022). Compared with CK composting, embedded materials reduced the distribution proportion of the acid-soluble fraction of Zn (ZnF1) and increased the proportion of the reducible fraction of Zn (ZnF2). The distribution proportion of ZnF1 of BC, MB and CB composting decreased by 45.38%, 38.72% and 33.44%, respectively. This suggested that embedded materials also effectively mitigated the bioavailability of Zn during composting. The effect of embedded materials to mitigate the bioavailability of Zn was better than that of Cu. To summarize, embedded materials effectively reduced the bioavailability of heavy metals, albeit it was difficult to remove heavy metals.
3.3 Adsorption characterization of materials
To reveal the underlying mechanism of embedded materials, this study explored the adsorption properties of the materials. The above results found that the speciation changes of heavy metals mainly occurred in the early stage of composting. Therefore, the materials (including biochar and modified biochar) that were taken out on the 10th (M10d) and 20th (M20d) days of composting were used for the determination of FTIR and SEM-EDX analysis to judge the variations in functional groups and atomic composition of materials. The FTIR absorbing peaks of biochar were observed at 3394, 2923, 1577 and 1383 cm−1 (Additional file 1). The peaks at 3394 cm−1 and 1383 cm−1 were assigned to associated intermolecular hydrogen bond O-H stretching vibration and C–H bending vibration, respectively (Liu et al. 2020b; Wesley et al. 2021). The peaks at 3394 and 1577 cm−1 indicated the presence of aromatic compounds (Periyasamy et al. 2018), which suggested that the prepared biochar had high aromaticity. The peak at 2923 cm−1 indicated that the saturated hydrocarbon of biochar contained methylene peak (Yao et al. 2015). The peak at 1106 cm−1 appeared in M20d, which was caused by the C–O stretching vibration of fatty ether substances (Liu et al. 2020b). This indicated that the surface structure of biochar and modified biochar changed during composting, which produced ether structure. The spectral difference was mainly in the range of 850–400 cm−1. The three peaks at 792, 601 and 469 cm−1 appeared for biochar, while only one peak at 594 cm−1 for the modified biochar, indicating that the C–H stretching vibration weakened and the substituents of aromatic rings changed after alkali modification (Kumar et al. 2018). The above results showed that there was no obvious peak change in FTIR spectra of the materials taken out from composting, implying that no apparent adsorption of functional groups occurred during composting (Liang et al. 2021). In fact, besides functional group adsorption, biochar could also adsorb heavy metals through electrostatic interaction or ionic interaction (Thomas et al. 2020; Mahmoud et al. 2022b). Therefore, this study further revealed the adsorption capacity of biochar for heavy metals by SEM–EDS analysis.
The SEM pattern showed that the biochar had a honeycomb structure with a neat arrangement and a smooth surface, while the alkali-modified biochar had a barbed shape with an irregular arrangement and a rough surface (Additional file 1). This suggested that alkali modification significantly changed the surface structure of biochar and increased the contact area (An et al. 2020). This was also the reason why the adsorption capacity was stronger after modification. The emergence of attached substances on the surface of M10d and M20d suggested that they could adsorb substances through nylon mesh bags during composting. Furthermore, the surface atomic ratio of biochar and modified biochar was explored by EDS analysis (Fig. 3a). The original biochar was dominated by the C atom (67.0%), followed by the O atom (27.1%), followed by a small amount of N and Si atoms, and the content of other atoms was less than 1%. After alkali modification, no change in the proportion of C and O atoms was found, however, the content of Na atom increased significantly, accounting for 2%. This was caused by the modification with NaOH solution, which also indicated that the biochar was successfully modified. In addition, the proportion of C atom of M10d and M20d decreased significantly, while the proportion of O and N atoms increased. Meanwhile, the proportion of nutrient elements on the surface of M10d also increased significantly. This may be caused by the absorption of nutrient elements from composting, or biochar and modified biochar released C atom into composting because the proportion of C atom decreased (Li et al. 2020; Ye et al. 2019), resulting in an increase in the proportion of other atoms. In addition, the proportion of Cu and Zn atoms of M10d and M20d was higher than that of the original materials, however, the proportion was still less than 1%. This also proved that the adsorption of heavy metals by embedded materials was nonsignificant. The main reason was that heavy metals were easy to combine with organic substances to form complexes (Chen et al. 2022; Wei et al. 2022), resulting in almost no free heavy metals contacting with the adsorption materials.
3.4 Effects of embedded materials on microbial community structure
To explore the influence of embedded materials to microbial community, this study constructed network maps based on significant correlations (P < 0.05) between predominated microorganisms with relative abundance greater than 0.005 (Fig. 3b–e).
The network maps of CK, BC, MB and CB composting consisted of 79, 74, 91, 78 nodes, 196, 199, 297 and 152 edges, respectively. Compared with CK composting, the microbial relationship was closer during BC composting. More nodes and edges were found during MB composting, indicating that the microbial network of MB composting was more complex. The number of nodes of CB and CK composting was basically the same, but the number of edges of CB composting was less, indicating that the correlations between microorganisms were weak during CB composting. In addition, there was an obvious clustering phenomenon in the microbial network. Microorganisms were divided into several small microbial groups during CB composting, indicating that the microbial network of CB composting might have multiple modules, clear division of labor and high degree of order. The composition of clustered microorganisms at the phyla level in the network of CK (mainly the phyla Proteobacteria and Bacteroidetes) and treatments composting (mainly the phyla Proteobacteria and Firmicutes) was different. This indicated that the embedded materials changed the microbial network. Furthermore, the 6, 4, 9 and 14 negative correlation relationships were found in the networks of CK, BC, MB and CB composting, respectively. This suggested that the embedded biochar and modified biochar enhanced the cooperative relationship between microorganisms (Zhang et al. 2021). The negative correlation in the network of CK composting accounted for 8.16%, however, while that of CB composting accounted for 9.21%, suggesting that the embedded pretreated cotton balls increased the competitive relationship between microorganisms. This was mainly because the pretreated cotton balls contained easily available carbon sources, which elicited microbial competition when added to compost. Collectively, embedded materials changed the microbial network during composting in the context of heavy metal stress, and different materials had diverse effects.
This study further compared the differences of predominated microorganisms (Fig. 4f). There were 30 shared microorganisms in the four treatments, indicating that at least one third of predominated microorganisms existed in the four treatments. However, the number of unique microorganisms was relatively small, of which the largest number of unique microorganisms (13) were found during MB composting. In addition, compared to CK composting, at least 60% of microorganisms still existed after embedding materials (BC: 62.16%; MB: 60.44%; CB: 65.38%). In this study, 30 shared microorganisms were defined as stable community, which still stably existed in each treatment after the addition of different materials. The remaining predominated microorganisms were called variable community.
3.5 Response characteristic of different microbial groups in heavy metal passivation
To further reveal the functional role of different microbial groups, this study explored the response relationship between environmental factors and microbial groups. Compared with CK composting, the relationship between HA, OM and heavy metal speciation enhanced after embedding materials (Fig. 5), indicating that the combining capacity between organic substances and heavy metals enhanced. This might be the reason for the decrease of bioavailability of heavy metals. Previous studies have found that organic substances combined with heavy metals through adsorption and coordination during composting (Li et al. 2021b; Zhang et al. 2017), reducing the bioavailability of heavy metals. Therefore, it was inferred from the results of correlation analysis that embedded materials strengthened the combination of organic substances and heavy metals, thereby promoting the passivation of heavy metals. In addition, the correlation among various forms of heavy metals also enhanced after embedding materials. Most notably, the significant relationship between different microbial groups (stable community and variable community) and environmental factors was different in the four treatments. The stable community was significantly correlated with ZnF2 and the residual fraction of Zn (ZnF4) during CK composting, and variable community was significantly correlated with CuF1, CuF4, OM and HA, indicating that stable community had a great impact on Zn speciation, while variable community had a great impact on Cu speciation and organic substance conversion. The stable community and variable community were merely and significantly related to ZnF2 and CuF1 during BC composting, respectively. Notably, the stable community was significantly correlated with OM, HA and speciation of heavy metals, while variable community was only significantly correlated with ZnF1 during MB and CB composting. These results suggested that variable community played a major role in the conversion of OM and HA during CK composting, however, stable community had a significant impact on OM and HA after embedding materials. This implied that the conversion of organic substances and heavy metal speciation was not affected by emerging microorganisms after embedding materials, albeit microbial network was changed, but by stable community. Therefore, the microbial community and functional distribution changed after embedding materials. The succession of microbial community promoted the formation of HA and the mitigation of heavy metal bioavailability (Cui et al. 2020; Awasthi et al. 2021).
3.6 Verification of action mechanism of biochar
To confirm the mechanism of biochar alleviating the biotoxicity of heavy metals during composting, the structural equation models were constructed to clarify the causal relationship between microbial groups, organic substance conversion and biotoxicity of heavy metals (Fig. 6). Both stable community and variable community could significantly affect the biotoxicity of heavy metals during CK composting (Fig. 6a). Compared to stable community, variable community had a greater influence on the biotoxicity of heavy metals. The variable community also significantly affected the formation of HA. However, the causal relationship was different after embedding materials. The influence of stable community on the biotoxicity of heavy metals was greater than that of variable community (Fig. 6b). It is worth noting that the stable community also indirectly affected the toxicity of heavy metals by affecting the HA content. Therefore, the stable community had a key role in alleviating the biotoxicity of heavy metals during composting of treatment groups. The main reason for these differences was that the embedded materials changed the microbial community of composting, and then affected the composting process. These results suggested that the embedded materials promoted the formation of HA by stable community, so as to accelerate the passivation of heavy metals. The results of structural equation model further verified the above results. To summarize, despite different materials had different effects on microbial community, the action mechanism of adsorption materials was the same. Biochar and other adsorption materials improved the formation of HA by changing the function of stable microbial groups, so as to achieve heavy metal passivation and mitigate the bioavailability. Therefore, the added adsorption materials such as biochar did not directly adsorb heavy metals, but indirectly mitigate the biotoxicity by affecting the composting process.
4 Conclusion
Embedded adsorption materials such as biochar effectively facilitated the degradation of OM and the formation of HA, and mitigated the bioavailability of heavy metals during composting. This indicated that the embedded materials effectively improved the composting. The results of FTIR and SEM–EDX analysis showed that the materials did not adsorb heavy metals obviously, however, the microbial networks changed after embedding materials. Statistical analysis suggested that the succession of microbial community promoted the formation of HA, thereby improving the mitigation of heavy metal bioavailability. Ultimately, structural equation models verified that the addition of biochar promoted the HA formation through stable community, thereby accelerating the passivation of heavy metals. Therefore, this study revealed the action mechanism of biochar during composting in detail, which provided theoretical and technical supports for mitigating the biotoxicity of heavy metals by biochar during composting.
Availability of data and materials
The data that support the finding of this study are available from the corresponding author upon reasonable request.
References
Abdelhameed RM, EI-Zawahry M, Emam HE (2018) Efficient removal of organophosphorus pesticides from wastewater using polyethylenimine-modified fabrics. Polymer 155:225–234
Ahmed MB, Zhou JL, Ngo HH, Guo W, Chen M (2016) Progress in the preparation and application of modified biochar for improved contaminant removal from water and wastewater. Bioresour Technol 214:836–851
Akgül G, Maden TB, Diaz E, Jiménez EM (2019) Modification of tea biochar with Mg, Fe, Mn and Al salts for efficient sorption of PO43- and Cd2+ from aqueous solution. J Water Reuse Desalt 9(1):57–66
An Q, Miao Y, Zhao B, Li Z, Zhu S (2020) An alkali modified biochar for enhancing Mn2+ adsorption: Performance and chemical mechanism. Mater Chem Phys 248:122895
Awasthi MK, Duan YM, Liu T, Awasthi SK, Zhang ZQ (2020) Relevance of biochar to influence the bacterial succession during pig manure composting. Bioresour Technol 304:122962
Awasthi SK, Duan YM, Liu T, Zhang ZQ, Pandey A, Varjani S, Awasthi MK, Taherzadeh MJ (2021) Can biochar regulate the fate of heavy metals (Cu and Zn) resistant bacteria community during the poultry manure composting? J Hazard Mater 406:124593
Chen XM, Du Z, Guo T, Wu JQ, Wang B, Wei ZM, Jia LM, Kang KJ (2022) Effects of heavy metals stress on chicken manures composting via the perspective of microbial community feedback. Environ Pollut 294:118624
Congilosi JL, Aga DS (2021) Review on the fate of antimicrobials, antimicrobial resistance genes, and other micropollutant in manure during enhanced anaerobic digestion and composting. J Hazard Mater 405:123634
Cui H, Ou Y, Wang LX, Yan BX, Li YX, Ding DW (2020) The passivation effect of heavy metals during biochar-amended composting: emphasize on bacterial communities. Waste Manag 118:360–368
Dotaniya ML, Meena VD, Saha JK, Dotaniya CK, Mahmoud AED, Meena BL, Sanwal RC, Meena RS, Doutaniya RK, Solanki P, Lata M, Rai PK (2022) Reuse of poor-quality water for sustainable crop production in the changing scenario of climate. Environ Dev Sustain. https://doi.org/10.1007/s10668-022-02365-9
Duan YM, Yang JF, Guo YR, Wu XP, Tian YL, Li HK, Awasthi MK (2021) Pollution control in biochar-driven clean composting: emphasize on heavy metal passivation and gaseous emissions mitigation. J Hazard Mater 420(15):126635
Godlewska P, Schmidt HP, Ok YS, Oleszczuk P (2017) Biochar for composting improvement and contaminants reduction. A review. Bioresour Technol 246:193–202
Gou M, Hu HW, Zhang YJ, Wang JT, Hayden H, Tang YQ, He JZ (2018) Aerobic composting reduces antibiotic resistance genes in cattle manure and the resistome dissemination in agricultural soils. Sci Total Environ 612:1300–1310
Guo HY, Zhao SF, Xia DP, Shen Y, Lv JH, Liu XL, Xu XK (2021) Speciation transformation and bioavailability of heavy metals during biogas production from coal slime. Biochem Eng J 176:108208
Hou LJ, Zhang LP, Chen XT, Li XW, Zhang ZQ, Lin YB (2021) The benefits of biochar: enhanced cadmium remediation, inhibited precursor production of nitrous oxide and a short-term disturbance on rhizosphere microbial community. Environ Pollut 272:116040
Kumar A, Joseph S, Tsechansky L, Privat K, Schreiter IJ, Schüth C, Graber ER (2018) Biochar aging in contaminated soil promotes Zn immobilization due to changes in biochar surface structural and chemical properties. Sci Total Environ 626:953–961
Li JB, Song NN (2020) Graphene oxide-induced variations in the processing performance, microbial community dynamics and heavy metal speciation during pig manure composting. Process Saf Environ 136:214–222
Li HH, Zhang T, Tsang DCW, Li GX (2020) Effects of external additives: biochar, bentonite, phosphate, on co-composting for swine manure and corn straw. Chemosphere 248:125927
Li G, Zhu QH, Niu QQ, Meng QR, Yan HL, Wang SS, Li QL (2021a) The degradation of organic matter coupled with the functional characteristics of microbial community during composting with different surfactants. Bioresour Technol 321:124446
Li CN, Li HY, Yao T, Su M, Ran F, Li JH, He L, Chen X, Zhang C, Qiu HZ (2021b) Effects of swine manure composting by microbial inoculation: heavy metal fractions, humic substances, and bacterial community metabolism. J Hazard Mater 415:125559
Liang Y, Feng LJ, Liu X, Zhao YX, Chen Q, Sui ZY, Wang N (2021) Enhanced selective adsorption of NSAIDs by covalent organic frameworks via functional group tuning. Chem Eng J 404:127095
Liu H, Yin H, Tang SY, Wei K, Peng H, Lu GN, Dang Z (2019) Effects of benzo [a] pyrene (BaP) on the composting and microbial community of sewage sludge. Chemosphere 222:517–526
Liu XM, Hou Y, Li Z, Yu Z, Tang J, Wang YQ, Zhou SG (2020a) Hyperthermophilic composting of sewage sludge accelerates humic acid formation: elemental and spectroscopic evidence. Waste Manag 103:342–351
Liu Y, Ran CM, Siddiqui AR, Chtaeva P, Siyal AA, Song YM, Dai JJ, Deng ZY, Fu J, Ao WY, Jiang ZH, Zhang TH (2020b) Pyrolysis of sewage sludge in a benchtop fluidized bed reactor: characteristics of condensates and non-condensable gases. Renew Energ 160:707–720
Liu YW, Li X, Wu SH, Tan Z, Yang CP (2021) Enhancing anaerobic digestion process with addition of conductive materials. Chemosphere 278:130449
Mahmoud AED, Kathi S (2022) Chap. 7—Assessment of biochar application in decontamination of water and wastewater. In: Kathi S, Devipriya S, Thamaraiselvi K (eds) Cost effective technologies for solid waste and wastewater treatment. Advances in environmental pollution research. Elsevier, Amsterdam, pp 69–74
Mahmoud AED, Hosny M, EI-Maghrabi N, Fawzy M (2022) Facile synthesis of reduced graphene oxide by Tecoma stans extracts for efficient removal of Ni (II) from water: batch experiments and response surface methodology. Sustain Environ Res 32:22
Mishra B, Tiwari A, Mahmoud AED (2022) Microalgal potential for sustainable aquaculture applications: bioremediation, biocontrol, aquafeed. Clean Technnol Environ Policy. https://doi.org/10.1007/s10098-021-02254-1
Novak JM, Ippolito JA, Watts DW, Sigua GC, Ducey TF, Johnson MG (2019) Biochar compost blends facilitate switchgrass growth in mine soils by reducing Cd and Zn bioavailability. Biochar 1:97–114
Periyasamy S, Gopalakannan V, Viswanathan N (2018) Enhanced chromium sorption and quick separation of magnetic hydrotalcite anchored biopolymeric composites using the hydrothermal method. J Chem Eng Data 63(5):1286–1299
Qian X, Gu J, Sun W, Wang XJ, Su JQ, Stedfeld R (2018) Diversity, abundance, and persistence of antibiotic resistance genes in various types of animal manure following industrial composting. J Hazard Mater 344:716–722
Qu FT, Wu D, Li D, Zhao Y, Zhang RJ, Qi HS, Chen XM (2022) Effect of Fenton pretreatment combined with bacterial inoculation on dissolved organic matter concentration during rice straw composting. Bioresour Technol 344:126198
Sahin O, Taskin MB, Kaya EC, Atakol O, Emir E, Inal A, Gunes A (2017) Effect of acid modification of biochar on nutrient availability and maize growth in a calcareous soil. Soil Use Manag 33:447–456
Thomas E, Borchard N, Sarmiento C, Atkinson R, Ladd B (2020) Key factors determining biochar sorption capacity for metal contaminants: a literature synthesis. Biochar 2:151–163
Wei ZM, Mohamed TA, Zhao L, Zhu ZC, Zhao Y, Wu JQ (2022) Microhabitat drive microbial anabolism to promote carbon sequestration during composting. Bioresour Technol 346:126577
Wesley RJ, Durairaj A, Ramanathan S, Obadiah A, Justinabraham R, Lv XM, Vasanthkumar S (2021) Potato peels biochar composite with copper phthalocyanine for energy storage application. Diam Relat Mater 115:108360
Wu SH, Shen ZQ, Yang CP, Zhou YX, Li X, Zeng GM, Ai SJ, He HJ (2017) Effects of C/N ratio and bulking agent on speciation of Zn and Cu and enzymatic activity during pig manure composting. Int Biodeter Biodegr 119:429–436
Yao CX, Joseph S, Li LQ, Pan GX, Lin Y, Munroe P, Pace B, Taherymoosavi S, Zwieten LV, Thomas T, Nielsen S, Ye J, Donne S (2015) Developing more effective enhanced biochar fertilisers for improvement of pepper yield and quality. Pedosphere 25:703–712
Ye SJ, Zeng GM, Wu HP, Liang J, Zhang C, Dai J, Xiong WP, Song B, Wu SH, Yu JF (2019) The effects of activated biochar addition on remediation efficiency of co-composting with contaminated wetland soil. Resour Conserv Recyl 140:278–285
Yu QL, Zhou R, Wang YJ, Su WH, Yang JW, Feng TS, Dou YQ, Li H (2021) Carcass decay deteriorate water quality and modifies the nirS denitrifying communities in different degradation stages. Sci Total Environ 785:147185
Zhang X, Wang XQ, Wang DF (2017) Immobilization of heavy metals in sewage sludge during land application process in China: a review. Sustainability 9(11):2020
Zhang M, He LY, Liu YS, Zhao JL, Zhang JN, Chen J, Zhang QQ, Ying GG (2020) Variation of antibiotic resistome during commercial livestock manure composting. Environ Int 136:105458
Zhang HJ, Wang SJ, Zhang JX, Tian CJ, Luo SS (2021) Biochar application enhances microbial interactions in mega-aggregates of farmland black soil. Soil Till Res 213:105145
Zhou HB, Meng HB, Zhao LX, Shen YJ, Hou YQ, Cheng HS, Song LQ (2018) Effect of biochar and humic acid on the copper, lead, and cadmium passivation during composting. Bioresour Technol 258:279–286
Zhou Q, Li X, Wu SH, Zhong YY, Yang CP (2021) Enhanced strategies for antibiotic removal from swine wastewater in anaerobic digestion. Trends Biotechnol 39:8–11
Zhu N, Gao J, Liang D, Zhu YY, Li BQ, Jin HM (2021) Thermal pretreatment enhances the degradation and humification of lignocellulose by stimulating thermophilic bacteria during dairy manure composting. Bioresour Technol 319:124149
Zuo XJ, Liu ZG, Chen MD (2016) Effect of H2O2 concentrations on copper removal using the modified hydrothermal biochar. Bioresour Technol 207:262–267
Acknowledgements
Funding from the National Natural Science Foundation of China is gratefully acknowledged. In addition, we wish to thank the timely help given by Heilongjiang Province Environmental Monitoring Center in determining the large number of samples.
Funding
This work was supported by the National Natural Science Foundation of China [Grant Numbers: 51878132 and 51978131] and National Key Research and Development Project [Grant Number: 2019YFC1906403].
Author information
Authors and Affiliations
Contributions
All authors participated in conceiving the study. XC: conceptualization, methodology, writing—original draft. ZD: investigation, formal analysis. DL: investigation, data curation. LW: visualization, software. CP: resources, investigation. ZW: supervision, funding acquisition, writing—review and editing. LJ: investigation. RZ: investigation. All authors read and approved the final manuscript.
Corresponding author
Ethics declarations
Competing interests
The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
Additional information
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary Information
Additional file 1: Table S1.
Initial carbon and nitrogen content of chicken manure and corn straw. Fig S1. Adsorption capacity of Zn on biochar treated by different modification methods. Fig S2. The profile of temperature during composting. Fig S3. Changes in the physicochemical indexes during composting. Fig S4. FTIR spectral characterization of biochar and modified biochar that taken out from composting. Fig S5. Electron microscopy of biochar and modified biochar. (a) biochar; (b) biochar that taken out from the 10th day of composting; (c) biochar that taken out from the 20th day of composting; (d) modified biochar; (e) modified biochar that taken out from the 10th day of composting; (f) modified biochar that taken out from the 10th day of composting.
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Chen, X., Du, Z., Liu, D. et al. Biochar mitigates the biotoxicity of heavy metals in livestock manure during composting. Biochar 4, 48 (2022). https://doi.org/10.1007/s42773-022-00174-x
Received:
Accepted:
Published:
DOI: https://doi.org/10.1007/s42773-022-00174-x