Skip to main content
SpringerLink
Log in

Cloning of an alkaline lipase gene from Penicillium cyclopium and its expression in Escherichia coli

  • Articles
  • Published:
Lipids

Abstract

The gene encoding an alkaline lipase of Penicillium cyclopium PG37 was cloned with four steps of PCR amplification based on different principles. The cloned gene was 1,480 nucleotides in length, consisted of 94 bp of promoter region, and had 6 exons and 5 short introns ranging from 50 to 70 nucleotides. The open reading frame encoded a protein of 285 amino acid residues consisting of a 27-AA signal peptide and a 258-AA mature peptide, with a conserved motif of Gly-X-Ser-X-Gly shared by all types of alkaline lipases. However, this protein had a low homology with lipases of P. camembertii (22.9%), Humicola lanuginosa (25.6%), and Rhizomucor miehei (22.3%) at the amino acid level. The mature peptide-encoding cDNA was cloned and expressed in Escherichia coli on pET-30a for confirmation. A distinct band with a M.W. of 33 kDa was detected on SDS-PAGE. Results of a Western blot analysis and an enzyme activity assay verified the recombinant 33-kDa protein as an alkaline lipase. Its catalytic properties were not changed when compared with its natural counterpart.

This is a preview of subscription content, log in via an institution to check access.

Access this article

Log in via an institution

Price excludes VAT (USA)
Tax calculation will be finalised during checkout.

Instant access to the full article PDF.

Institutional subscriptions

Similar content being viewed by others

Abbreviations

Primer AP:

GGATCCCTTCACTCTCAAGTGC

primer CE3:

GCGCGGCCGCTCAGCTCAGATAGCCAC

primer CE5:

GGAATTCGCAACTGCTGACGCCG

primer G3:

AACTGCAGTCAGCTCAGATAGCCAC

primer G5:

ATGTTGTTCAACTACCAATC

primer N1:

GA(C/T)GC(C/T)GC(C/T)GC(C/T)TTCCC

primer N2:

CC(C/T)GA(C/T)CT(G/C/T)CA(C/T)CG(C/T)GC(A/G/C/T)GC

primer OT:

oligo dT-M13 primer M4

primer PR1:

GAAGGCTGCTGGACCGTTGT

primer PR2:

CCGTTGTCTTTGGCTGC

primer RM1:

CTCTCATGATCTTCACATCAG

primer S5:

AAGCAGTGGTAACAACGCAGCAGTACGCGGG

PVA:

polyvinyl alcohol

RACE:

rapid amplification of cDNA end

References

  1. Klibanov, A.M. (1989) Enzymatic Catalysis in Anhydrous Organic Solvents, Trends Biochem. Sci. 14, 141–144.

    Article  PubMed  CAS  Google Scholar 

  2. Kirchner, G., Scollar, M.P., and Klibanov, A.M. (1985) Resolution of Racemic Mixture via Lipase Catalysis in Organic Solvents, J. Am. Chem. Soc. 107, 7072–7076.

    Article  CAS  Google Scholar 

  3. Marlot, C., Langrand, G., Triantaphylides, C., and Baratti, J. (1985) Ester Synthesis in Organic Solvent Catalyzed by Lipases Immobilized on Hydrophilic Supports, Biotechnol. Lett. 7, 647–649.

    Article  CAS  Google Scholar 

  4. Saad, R.R. (1995) Production of Lipase from Aspergillus tamarii and Its Compatibility with Commercial Detergents, Folia Microbiol. 40, 263–266.

    CAS  Google Scholar 

  5. Macrae, A., Roehl, E.L., and Brand, H.M. (1990) Bio-esters in Cosmetics, J. Drug Cosmet. Ind. 147, 36–39.

    Google Scholar 

  6. Ghosh, P.K., Saxena, R.X., Gupta, R., Yadav, R.P., and Davidson, S. (1996) Microbial Lipase: Production and Applications, Sci. Prog. 79, (Pt. 2), 119–157.

    PubMed  CAS  Google Scholar 

  7. Gandhi, N.N. (1997) Applications of Lipase, J. Am. Oil Chem. Soc. 74, 621–634.

    CAS  Google Scholar 

  8. De Caro, J., Ferrato, F., Verger, R., and De Caro, A. (1995) Purification and Molecule Characterization of Lamb Pregastric Lipase, Biochim. Biophys. Acta 1252, 321–329.

    PubMed  Google Scholar 

  9. Lin, S.F., Chiou, C.M., and Yeh, C.M. (1996) Purification and Partial Characterization of an Alkaline Lipase from Pseudomonas pseudoalcaligenes F-111, Appl. Environ. Microbiol. 62, 1093–1095.

    PubMed  CAS  Google Scholar 

  10. Hiol, A., Jonzo, M.D., Rugani, N., Druet, D., Sarda, L., and Comeau, L.C. (2000) Purification and Characterization of an Extracellular Lipase from a Thermophilic Rhizopus oryzae Strain Isolated from Palm Fruit, Enzyme Microb. Technol. 26, 421–430.

    Article  PubMed  CAS  Google Scholar 

  11. Hassanien, F.R., and Mukherjee, K.D. (1986) Isolation of Lipase from Germinating Oilseeds for Biotechnological Processes, J. Am. Oil. Chem. Soc. 63, 893–897.

    CAS  Google Scholar 

  12. Ollis, D.L., Cheah, E., Cygler, M., Dijkstra, B., Frolow, F., Franken, S.M., Harel, M., Remington, S.J., Silman, I., Schrag, J.D., et al. (1992) The α/β Hydrolase Fold, Protein Eng. 5, 197–211.

    PubMed  CAS  Google Scholar 

  13. Schrag, J.D., and Cygler, M. (1997) Lipase and the α/β Fold, in Methods in Enzymology (Rubin, B. and Dennis, E.A., eds.), Vol. 284, pp. 85–106, Academic Press, New York.

    Google Scholar 

  14. Brady, L., Brzozowski, A.M., Derewenda, Z.S., Dodson, E., Dodson, G., Tolley, S., Turkenburg, J.P., Christiansen, L., Huge-Jensen, B., Norskov, L., et al. (1990) A Serine Protease Triad Forms the Catalytic Centre of a Triacylglycerol Lipase, Nature 343, 767–770.

    Article  PubMed  CAS  Google Scholar 

  15. Boston, M., Requadt, C., Danko, S., Jarnagin, A., Ashizawa, E., Wu, S., Poulose, A.J., and Bott, R. (1997) Structure and Function of Engineered Pseudomonas mendocina Lipase, in Methods in Enzymology (Rubin, B., and Dennis, E.A., eds.), Vol. 284, pp. 298–317, Academic Press, New York.

    Google Scholar 

  16. Patkar, S.A., Svendsen, A., Kirk, O., Clausen, I.G., and Borch, K. (1997) Effect of Mutation in Non-consensus Sequence Thr-X-Ser-X-Gly of Candida antarctica Lipase B on Lipase Specificity, Specific Activity and Thermostability, J. Mol. Catal. B: Enzymatic 3, 51–54.

    Article  CAS  Google Scholar 

  17. Shinkai, A., Hirano, A., and Aisaka, K. (1996) Substitutions of Ser for Asn-163 and Pro for Leu-264 Are Important for Stabilization of Lipase from Pseudomonas aeruginosa, J. Biochem. 120, 915–921.

    PubMed  CAS  Google Scholar 

  18. Batenburg, A.M., Egmond, M.R., and Frenken, L.G.J. (1990) Enzymes and Enzymatic Detergent Compositions, European Patent EP 0 407 225 A1.

  19. Huge-Jensen, B., Andreasen, F., Christensen, T., Christensen, M., Thim, L., and Boel, E. (1989) Rhizomucor miehei Triglyceride Lipase Is Processed and Secreted from Transformed Aspergillus oryzae, Lipids 24, 781–785.

    PubMed  CAS  Google Scholar 

  20. Wu, M.C., Wang, S., Huang, W.D., and Sun, C.R. (1999) Purification and Characterization of an Alkaline Lipase from Penicillium cyclopium PG37, Acta Biochim. Biophys. Sin. 31, 664–668.

    PubMed  CAS  Google Scholar 

  21. Ibrik, A., Chahinian, H., Rugani, N., Sarda, L., and Comeau, L.C. (1998) Biochemical and Structural Characterization of Triacylglycerol Lipase from Penicillium cyclopium, Lipids 33, 377–384.

    Article  PubMed  CAS  Google Scholar 

  22. Chahinian, H., Nini, L., Boitard, E., Dubes, J.P., Sarda, L., and Comeau, L.C. (2000) Kinetic Properties of Penicillium cyclopium Lipases Studied with Vinyl Esters, Lipids 35, 919–925.

    Article  PubMed  CAS  Google Scholar 

  23. Garber, R.C., and Yoder, O.C. (1983) Isolation of DNA from Filamentous Fungi and Separation into Nuclear, Mitochondrial, Ribosomal, and Plasmid Components, Anal. Biochem. 135, 416–422.

    Article  PubMed  CAS  Google Scholar 

  24. Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd edn., Cold Spring Harbor Laboratory Press, New York.

    Google Scholar 

  25. Mourey, A., and Kilbertus, G.J. (1976) Simple Media Conditioning Stabilized Tributyrin for Demonstrating Lipolytic Bacteria in Foods and Soils, J. Appl. Bacteriol. 40, 47–51.

    PubMed  CAS  Google Scholar 

  26. Harlow, E., and Lane, D. (1988) Antibodies: A Laboratory Manual, pp. 92–112, Cold Spring Harbor Laboratory Press, New York.

    Google Scholar 

  27. Verma, I.M. (1977) Reverse Transcriptase, in The Enzymes (Boyer, P.D., ed.) Vol. 14A, pp. 87–104, Academic Press, New York.

    Google Scholar 

  28. Schmidt-Dannert, C. (1999) Recombinant Microbial Lipases for Biotechnological Applications, Bioorg. Med. Chem. 7, 2123–2130.

    Article  PubMed  CAS  Google Scholar 

  29. Herrgard, S., Gibas, C.J., and Subramaniam, S. (2000) Role of an Electrostatic Network of Residues in the Enzymatic Action of the Rhizomucor miehei Lipase Family, Biochemistry 39, 2921–2930.

    Article  PubMed  CAS  Google Scholar 

  30. Chahinian, H., Vanot, G., Ibrik, A., Rugani, N., Sarda, L., and Comeau, L.C. (2000) Production of Extracellular Lipases by Penicillium cyclopium Purification and Characterization of a Partial Acylglycerol Lipase, Biosci. Biotechnol. Biochem. 64, 215–222.

    Article  PubMed  CAS  Google Scholar 

  31. Iwai, M., Okumura, S., and Tsujisaka, Y. (1975) The Comparison of the Properties of Two Lipases from Penicillium cyclopium Westring, Agric. Biol. Chem. 39, 1063–1070.

    CAS  Google Scholar 

  32. Okumura, S., Iwa, M., and Tsujisaka, Y. (1980) Purification and Properties of Partial Glyceride Hydrolase of Penicillium cyclopium M1, J. Biochem. 87, 205–211.

    PubMed  CAS  Google Scholar 

  33. Druet, D., El Abbadi, N., and Comeau, L.C. (1992) Purification and Characterization of the Extracellular and Cell-Bound Lipases from Penicillium cyclopium Variety, Appl. Microbiol. Biotechnol. 37, 745–749.

    Article  CAS  Google Scholar 

Download references

Author information

Authors and Affiliations

  1. Medical Department, Southern Yangtze University, 214063, Jiangsu, Wuxi, P.R. China

    Minchen Wu

  2. Department of Biochemistry, School of Life Sciences, Fudan University, 200433, Shanghai, P.R. China

    Zhikang Qian, Peihong Jiang, Taishan Min, Chongrong Sun & Weida Huang

Authors
  1. Minchen Wu
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Zhikang Qian
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Peihong Jiang
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Taishan Min
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Chongrong Sun
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Weida Huang
    View author publications

    You can also search for this author in PubMed Google Scholar

Corresponding author

Correspondence to Weida Huang.

Additional information

Zhikang Qian and Peihong Jiang are equal contributors as first author of this paper.

About this article

Cite this article

Wu, M., Qian, Z., Jiang, P. et al. Cloning of an alkaline lipase gene from Penicillium cyclopium and its expression in Escherichia coli . Lipids 38, 191–199 (2003). https://doi.org/10.1007/s11745-003-1051-7

Download citation

  • Received:

  • Revised:

  • Accepted:

  • Issue Date:

  • DOI: https://doi.org/10.1007/s11745-003-1051-7

Keywords

Search

Navigation