Ambiguity aversion and familiarity bias: Evidence from behavioral and gene association studies

Abstract

It is increasingly recognized that decision making under uncertainty depends not only on probabilities, but also on psychological factors such as ambiguity and familiarity. Using 325 Beijing subjects, we conduct a neurogenetic study of ambiguity aversion and familiarity bias in an incentivized laboratory setting. For ambiguity aversion, 49.4% of the subjects choose to bet on the 50–50 deck despite the unknown deck paying 20% more. For familiarity bias, 39.6% choose the bet on Beijing’s temperature rather than the corresponding bet with Tokyo even though the latter pays 20% more. We genotype subjects for anxiety-related candidate genes and find a serotonin transporter polymorphism being associated with familiarity bias, but not ambiguity aversion, while the dopamine D5 receptor gene and estrogen receptor beta gene are associated with ambiguity aversion only among female subjects. Our findings contribute to understanding of decision making under uncertainty beyond revealed preference.

Appendix I. Genotyping method

The polymorphism for the SLC6A4 44 bp deletion/insertion (5-HTTLPR) in the promoter region was characterized using PCR amplification procedure with the following primers: F5′-GGCGTTGCCGCTCTGAATTGC-3′, R5′-GAGGGACTGAGCTGGACAACC-3′. PCR reactions were performed using 5 μl Master Mix (Thermo scientific), 2 μl primers (0.5 μM), 0.6 μl Mg/Cl2 (2.5 mM), 0.4 μl DMSO 5% and 1 μl of water to total of 9 μl total volume and an additional 1 μl of genomic DNA was added to the mixture. All PCR reactions were employed on a Biometra T1 Thermocycler (Biometra, Güttingem, Germany). PCR reaction conditions were as follows: preheating step at 94.0°C for 5 min, 34 cycles of denaturation at 94.0°C for 30 s, reannealing at 55°C for 30 s and extension at 72°C for 90 s. The reaction proceeded to a hold at 72°C for 5 min. All reaction mixtures were electrophoresed on a 3% agarose gel (AMRESCO) with ethidium bromide to screen for genotype.

Amplification of the DRD5, ESR1 and ESR2 microsatellites was achieved using the following primers: DRD5: forward: 5′- CGTGTATGATCCCTGCAG -3′; reverse: 5′- GCTCATGAGAAGAATGGAGTG -3′; ESR1 (corresponds to the TA dinucleotide repeat in the 5′ promoter region): forward 5′- AGACGCATGATATACTTCACC -3′; reverse 5′- GTTCACTTGGGCTAGGATAT -3′. ESR2 (corresponds to the CA dinucleotide repeat in intron 5): forward (fluorescent) 5′- GGTAAACCATGGTCTGTACC -3′; reverse 5′- AACAAAATGTTGAATGAGTGGG -3′. PCR reactions were performed using 5 μl Master Mix (Thermo scientific), 0.5 μl primers (0.5 μM), 0.4 μl Mg/Cl2 (2.5 mM) and 3.1 μl of water to total of 9 μl total volume and an additional 1 μl of genomic DNA was added to the mixture. All PCR reactions were employed on a Biometra T1 Thermocycler (Biometra, Güttingem, Germany). PCR reaction conditions were as follows: preheating step at 95.0°C for 5 min, 30 cycles of denaturation at 95.0°C for 30 s, reannealing at 55°C for 30 s and extension at 72°C for 40 s. The reaction proceeded to a hold at 72°C for 10 min. The PCR product was analyzed on an ABI 310 DNA Analyzer.