Skip to main content
SpringerLink
Log in

Detection and Analysis of CRISPRs of Shigella

  • Published:
Current Microbiology Aims and scope Submit manuscript

Abstract

The recently discovered CRISPRs (Clustered regularly interspaced short palindromic repeats) and Cas (CRISPR-associated) proteins are a novel genetic barrier that limits horizontal gene transfer in prokaryotes and the CRISPR loci provide a historical view of the exposure of prokaryotes to a variety of foreign genetic elements. The aim of study was to investigate the occurrence and distribution of the CRISPRs in Shigella. A collection of 61 strains of Shigella were screened for the existence of CRISPRs. Three CRISPR loci were identified among 61 shigella strains. CRISPR1/cas loci are detected in 49 strains of shigella. Yet, IS elements were detected in cas gene in some strains. In the remaining 12 Shigella flexneri strains, the CRISPR1/cas locus is deleted and only a cas3’ pseudo gene and a repeat sequence are present. The presence of CRISPR2 is frequently accompanied by the emergence of CRISPR1. CRISPR3 loci were present in almost all strains (52/61). The length of CRISPR arrays varied from 1 to 9 spacers. Sequence analysis of the CRISPR arrays revealed that few spacers had matches in the GenBank databases. However, one spacer in CRISPR3 loci matches the cognate cas3 genes and no cas gene was present around CRISPR3 region. Analysis of CRISPR sequences show that CRISPR have little change which makes CRISPR poor genotyping markers. The present study is the first attempt to determine and analyze CRISPRs of shigella isolated from clinical patients.

This is a preview of subscription content, log in via an institution to check access.

Access this article

Log in via an institution

Price excludes VAT (USA)
Tax calculation will be finalised during checkout.

Instant access to the full article PDF.

Institutional subscriptions

Fig. 1
Fig. 2

Similar content being viewed by others

References

  1. Ashkenazi S, Cleary KR, Pickering LK, Murray BE, Cleary TG (1990) The association of Shiga toxin and other cytotoxins with the neurologic manifestations of shigellosis. J Infect Dis 161:961–965

    Article  CAS  PubMed  Google Scholar 

  2. Barrangou R, Fremaux C, Deveau H, Richards M, Boyaval P, Moineau S, Romero DA, Horvath P (2007) CRISPR provides acquired resistance against viruses in prokaryotes. Science 315:1709–1712

    Article  CAS  PubMed  Google Scholar 

  3. Bikard D, Hatoum-Aslan A, Mucida D, Marraffini LA (2012) CRISPR interference can prevent natural transformation and virulence acquisition during in vivo bacterial infection. Cell Host Microbe 12:177–186

    Article  CAS  PubMed  Google Scholar 

  4. Bateman A, Rawlings ND (2003) The CHAP domain: a large family of amidases including GSP amidase and peptidoglycan hydrolases. Trends Biochem Sci 28:234–237

    Article  CAS  PubMed  Google Scholar 

  5. Bennish ML, Harris JR, Wojtyniak BJ, Struelens M (1990) Death in shigellosis: incidence and risk factors in hospitalized patients. J Infect Dis 161:500–506

    Article  CAS  PubMed  Google Scholar 

  6. Diez-Villasenor C, Almendros C, Garcia-Martinez J, Mojica FJ (2010) Diversity of CRISPR loci in Escherichia coli. Microbiology 156:1351–1361

    Article  CAS  PubMed  Google Scholar 

  7. Horvath P, Barrangou R (2010) CRISPR/Cas, the immune system of bacteria and archaea. Science 327:167–170

    Article  CAS  PubMed  Google Scholar 

  8. Haft DH, Selengut J, Mongodin EF, Nelson KE (2005) A guild of 45 CRISPRassociated (Cas) protein families and multiple CRISPR/Cas subtypes exist inprokaryotic genomes. PLoS Comput Biol 1:e60

    Article  PubMed Central  PubMed  Google Scholar 

  9. Horvath P, Romero DA, Coute-Monvoisin AC, Richards M, Deveau H, Moineau S, Boyaval P, Fremaux C, Barrangou R (2008) Diversity, activity, and evolution of CRISPR loci in Streptococcus thermophilus. J Bacteriol 190:1401–1412

    Article  CAS  PubMed Central  PubMed  Google Scholar 

  10. Jin Q, Yuan Z, Xu J, Wang Y, Shen Y, Lu W, Wang J, Liu H, Yang J, Yang F et al (2002) Genome sequence of Shigella flexneri 2a: insights into pathogenicity through comparison with genomes of Escherichia coli K12 and O157. Nucleic Acids Res 30:4432–4441

    Article  CAS  PubMed Central  PubMed  Google Scholar 

  11. Makarova KS, Grishin NV, Shabalina SA, Wolf YI, Koonin EV (2006) A putative RNA-interference-based immune system in prokaryotes: computational analysis of the predicted enzymatic machinery, functional analogies with eukaryotic RNAi, and hypothetical mechanisms of action. Biol Direct 1:7

    Article  PubMed Central  PubMed  Google Scholar 

  12. Touchon M, Rocha EP (2010) The small, slow and specialized CRISPR and anti-CRISPR of Escherichia and Salmonella. PLoS ONE 5:e11126

    Article  PubMed Central  PubMed  Google Scholar 

  13. Makarova KS, Haft DH, Barrangou R, Brouns SJ, Charpentier E, Horvath P, Moineau S, Mojica FJ, Wolf YI, Yakunin AF (2011) Evolution and classification of the CRISPR/Cas systems. Nat Rev Microbiol 9:467–477

    Article  CAS  PubMed  Google Scholar 

  14. Marraffini LA, Sontheimer EJ (2008) CRISPR interference limits horizontal gene transfer in staphylococci by targeting DNA. Science 322:1843–1845

    Article  CAS  PubMed Central  PubMed  Google Scholar 

  15. Payne SM (1989) Iron and virulence in Shigella. Mol Microbiol 3:1301–1306

    Article  CAS  PubMed  Google Scholar 

  16. Pleckaityte M, Zilnyte M, Zvirbliene A (2012) Insights into the CRISPR/Cas system of Gardnerella vaginalis. BMC Microbiol 12:301

    Article  CAS  PubMed Central  PubMed  Google Scholar 

  17. Sneath PH, Mair NS, Sharpe ME, Holt JG (1986) Bergey’s manual of systematic bacteriology, vol 2. Williams & Wilkins, Baltimore

    Google Scholar 

  18. Sorek R, Kunin V, Hugenholtz P (2008) CRISPR—a widespread system that provides acquired resistance against phages in bacteria and archaea. Nat Rev Microbiol 6:181–186

    Article  CAS  PubMed  Google Scholar 

  19. Van Der Oost J, Jore MM, Westra ER, Lundgren M, Brouns SJ (2009) CRISPR-based adaptive and heritable immunity in prokaryotes. Trends Biochem Sci 34:401–407

    Article  PubMed  Google Scholar 

  20. Wei J, Goldberg MB, Burland V, Venkatesan MM, Deng W, Fournier G, Mayhew GF, Plunkett G 3rd, Rose DJ, Darling A et al (2003) Complete genome sequence and comparative genomics of Shigella flexneri serotype 2a strain 2457T. Infect Immun 71:2775–2786

    Article  CAS  PubMed Central  PubMed  Google Scholar 

  21. Xia S, Xu B, Huang L, Zhao J-Y, Ran L, Zhang J, Chen H, Pulsrikarn C, Pornruangwong S, Aarestrup FM (2011) Prevalence and characterization of human Shigella infections in Henan Province, China, in 2006. J Clin Microbiol 49:232–242

    Article  PubMed Central  PubMed  Google Scholar 

Download references

Acknowledgments

Our study was funded by the Important National Science & Technology Specific Projects (2013ZX10004607).

Author information

Authors and Affiliations

  1. College of Public Health, Zhengzhou University, Zhenghou, 450001, China

    Xiangjiao Guo, Guangcai Duan, Zerun Xue, Linlin Wang, Pengfei Wang, Yuanlin Xi & Haiyan Yang

  2. Henan University of Science and Technology, Luoyang, 471023, China

    Yingfang Wang

  3. Xinxiang Medical University, Xinxiang, 453003, China

    Guangcai Duan

  4. Academy of Military Medical Sciences, Beijing, 100091, China

    Shaofu Qiu

Authors
  1. Xiangjiao Guo
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Yingfang Wang
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Guangcai Duan
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Zerun Xue
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Linlin Wang
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Pengfei Wang
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Shaofu Qiu
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. Yuanlin Xi
    View author publications

    You can also search for this author in PubMed Google Scholar

  9. Haiyan Yang
    View author publications

    You can also search for this author in PubMed Google Scholar

Corresponding author

Correspondence to Guangcai Duan.

Electronic Supplementary Material

Below is the link to the electronic supplementary material.

Supplementary material 1 (PDF 9 kb)

Supplementary material 2 (PDF 7 kb)

Supplementary material 3 (PDF 4 kb)

284_2014_683_MOESM4_ESM.docx

Supplementary material 4 (DOCX 16 kb) There were two errors in this file. The primer of cas3 rev ‘GCCCCCTGATCGTATGGATG’ should be ‘GTCATTCCTGCTTCCAGCCT’. In addition, we should revise the length of PCR product of CRISPR, since the length of CRISPRs varied because the number of repeats/spacers changed among the different strains analyzed.

Rights and permissions

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Guo, X., Wang, Y., Duan, G. et al. Detection and Analysis of CRISPRs of Shigella . Curr Microbiol 70, 85–90 (2015). https://doi.org/10.1007/s00284-014-0683-8

Download citation

  • Received:

  • Accepted:

  • Published:

  • Issue Date:

  • DOI: https://doi.org/10.1007/s00284-014-0683-8

Keywords

Search

Navigation