Skip to main content
SpringerLink
Log in

Epigenetic Modification of fruitless in the Protocerebrum Influences Male Drosophila Courtship Behaviour

  • Conference paper
  • First Online:
IRC-SET 2021

  • 289 Accesses

Abstract

Epigenetic modifications are known to influence phenotypes such as morphology, behaviour and learning in insects. However, the role of the epigenome in courtship behaviour in Drosophila melanogaster remains unexplored. Epigenetic control such as acetylation and deacetylation of histones play an important role in the expression profile of fruitless, a gene implicated in the male courtship response. To investigate how epigenetic modifications of fruitless would affect courtship behaviour, we modified the epigenome of D. melanogaster using CRISPR-dCAS9. Here we show that fruitless followed an all-or-none response to elicit male courtship behaviour by creating transgenic lines of D. melanogaster. We assessed transcription states of fruitless in the transgenic lines using RT-qPCR, and behavioural changes using the RING assay and the Courtship Index. Our results demonstrated that males overexpressing fruitless displayed more sexually aggressive behaviour, whilst males underexpressing fruitless became behaviourally sterile. These findings show that epigenetics is implicated in the genetic control of courtship behaviour in D. melanogaster. Together, these results will contribute to the understanding of neurological memory as well as behavioural epigenetics in D. melanogaster.

This is a preview of subscription content, log in via an institution to check access.

Access this chapter

Log in via an institution
Chapter
USD 29.95
Price excludes VAT (USA)
  • Available as PDF
  • Read on any device
  • Instant download
  • Own it forever
eBook
USD 89.00
Price excludes VAT (USA)
  • Available as EPUB and PDF
  • Read on any device
  • Instant download
  • Own it forever
Softcover Book
USD 119.99
Price excludes VAT (USA)
  • Compact, lightweight edition
  • Dispatched in 3 to 5 business days
  • Free shipping worldwide - see info
Hardcover Book
USD 169.99
Price excludes VAT (USA)
  • Durable hardcover edition
  • Dispatched in 3 to 5 business days
  • Free shipping worldwide - see info

Tax calculation will be finalised at checkout

Purchases are for personal use only

Institutional subscriptions

References

  1. Spieth, H. T. (1974). Courtship behavior in Drosophila. Annual Review of Entomology, 19, 385–405. https://doi.org/10.1146/annurev.en.19.010174.002125

    Article  Google Scholar 

  2. Zars, T. (2000). Behavioral functions of the insect mushroom bodies. Current Opinion in Neurobiology, 10(6), 790–795. https://doi.org/10.1016/s0959-4388(00)00147-1

    Article  Google Scholar 

  3. Guven-Ozkan, T., & Davis, R. L. (2014). Functional neuroanatomy of Drosophila olfactory memory formation. Learning & Memory, 21(10), 519–526. https://doi.org/10.1101/lm.034363.114

    Article  Google Scholar 

  4. Kohatsu, S., Koganezawa, M., & Yamamoto, D. (2011). Female contact activates male-specific interneurons that trigger stereotypic courtship behavior in Drosophila. Neuron, 69, 498–508. https://doi.org/10.1016/j.neuron.2010.12.017

    Article  Google Scholar 

  5. Kimura, K.-I., Hachiya, T., Koganezawa, M., Tazawa, T., & Yamamoto, D. (2008). fruitless and doublesex coordinate to generate male-specific neurons that can initiate courtship. Neuron, 59, 759–769. https://doi.org/10.1016/j.neuron.2008.06.007

    Article  Google Scholar 

  6. Kim, W. J., Jan, L. Y., & Jan, Y. N. (2012). Contribution of visual and circadian neural circuits to memory for prolonged mating induced by rivals. Nature Neuroscience, 15, 876–883. https://doi.org/10.1038/nn.3104

    Article  Google Scholar 

  7. Siegel, R. W., & Hall, J. C. (1979). Conditioned responses in courtship behavior of normal and mutant Drosophila. PNAS, 76, 3430–3434. https://doi.org/10.1073/pnas.76.7.3430

    Article  ADS  Google Scholar 

  8. Rideout, E. J., Billeter, J. C., & Goodwin, S. F. (2007). The sex-determination genes fruitless and doublesex specify a neural substrate required for courtship song. Current Biology, 17, 1473–1478. https://doi.org/10.1016/j.cub.2007.07.047

    Article  Google Scholar 

  9. Mackay, T. F. C., Heinsohn, S. L., Lyman, R. F., Moehring, A. J., Morgan, T. J., & Rollmann, S. M. (2005). Genetics and genomics of Drosophila mating behavior. PNAS, 102(Supplement 1), 6622–6629. https://doi.org/10.1073/pnas.0501986102

    Article  ADS  Google Scholar 

  10. Pavlou, H. J., & Goodwin, S. F. (2013). Courtship behavior in Drosophila melanogaster: Towards a ‘courtship connectome.’ Current Opinion in Neurobiology, 23(1), 76–83. https://doi.org/10.1016/j.conb.2012.09.002

    Article  Google Scholar 

  11. von Philipsborn, A. C., Liu, T., Yu, J. Y., Masser, C., Bidaye, S. S., & Dickson, B. J. (2011). Neuronal control of Drosophila courtship song. Neuron, 69, 509–522. https://doi.org/10.1016/j.celrep.2013.09.039

    Article  Google Scholar 

  12. Pan, Y., Robinett, C. C. & Baker, B. S. (2011). Turning males on: activation of male courtship behavior in Drosophila melanogaster. PLoS One, 6, e21144.https://doi.org/10.1371/journal.pone.0021144

  13. Pan, Y., & Baker, B. S. (2014). Genetic identification and separation of innate and experience-dependent courtship behaviors in Drosophila. Cell, 156(1–2), 236–248. https://doi.org/10.1016/j.cell.2013.11.041

    Article  Google Scholar 

  14. Yamamoto, D., & Kohatsu, S. (2017). What does the fruitless gene tell us about nature vs. nurture in the sex life of Drosophila? Fly, 11(2), 139–147. https://doi.org/10.1080/19336934.2016.1263778

  15. Villella, A., Gailey, D. A., Berwald, B., Ohshima, S., Barnes, P. T., & Hall, J. C. (1997). Extended reproductive roles of the fruitless gene in Drosophila melanogaster revealed by behavioral analysis of new FRU mutants. Genetics, 147, 1107–1130.

    Article  Google Scholar 

  16. Dupont, C., Armant, D. R., & Brenner, C. A. (2009). Epigenetics: Definition, mechanisms and clinical perspective. Seminars in Reproductive Medicine, 27(5), 351–357. https://doi.org/10.1055/s-0029-1237423

    Article  Google Scholar 

  17. Anreiter, I., Kramer, J. M., & Sokolowski, M. B. (2017). Epigenetic mechanisms modulate differences in Drosophila foraging behavior. PNAS, 114(47), 12518–12523. https://doi.org/10.1073/pnas.1710770114

    Article  Google Scholar 

  18. Xu, S., Wilf, R., Menon, T., Panikker, P., Sarthi, J., & Elefant, F. (2014). Epigenetic control of learning and memory in Drosophila by Tip60 HAT action. Genetics, 198(4), 1571–1586. https://doi.org/10.1534/genetics.114.171660

    Article  Google Scholar 

  19. Riddle, N. C., Minoda, A., Kharchenko, P. V., Alekseyenko, A. A., Schwartz, Y. B., Tolstorukov, M. Y., Gorchakov, A. A., Jaffe, J. D., Kennedy, C., Linder-Basso, D., Peach, S. E., Shanower, G., Zheng, H., Kuroda, M. I., Pirrotta, V., Park, P. J., Elgin, S. C., & Karpen, G. H. (2011). Plasticity in patterns of histone modifications and chromosomal proteins in Drosophila heterochromatin. Genome Research, 21(2), 147–163. https://doi.org/10.1101/gr.110098.110

    Article  Google Scholar 

  20. Ito, H., Sato, K., Koganezawa, M., Ote, M., Matsumoto, K., Hama, C., & Yamamoto, D. (2012). fruitless recruits two antagonistic chromatin factors to establish single-neuron sexual dimorphism. Cell, 149(6), 1327–1338. https://doi.org/10.1016/j.cell.2012.04.025

    Article  Google Scholar 

  21. Saleem, S., Ruggles, P. H., Abbott, W. K., & Carney, G. E. (2014). Sexual experience enhances Drosophila melanogaster male mating behavior and success. PLoS One, 9(5), e96639.https://doi.org/10.1371/journal.pone.0096639

  22. Brocken, D. J. W, Tark-Dame, M., & Dame, R. T. (2018). dCas9: A versatile tool for epigenome editing. Current Issues in Molecular Biology, 26, 15–32. https://doi.org/10.21775/cimb.026.015

  23. Hilton, I. B., D’Ippolito, A. M., Vockley, C. M., Thakore, P. I., Crawford, G. E., Reddy, T. E., & Gersbach, C. A. (2015). Epigenome editing by a CRISPR-Cas9-based acetyltransferase activates genes from promoters and enhancers. Nature Biotechnology, 33(5), 510–517. https://doi.org/10.1038/nbt.3199

    Article  Google Scholar 

  24. Kwon, D. Y., Zhao, Y.-T., Lamonica, J. M., & Zhou, Z. (2017). Locus-specific histone deacetylation using a synthetic CRISPR-Cas9-based HDAC. Nature Communications, 8, 15315. https://doi.org/10.1038/ncomms15315

    Article  ADS  Google Scholar 

  25. Han, C., Jan, L. Y., & Jan, Y.-N. (2011). Enhancer-driven membrane markers for analysis of nonautonomous mechanisms reveal neuron-glia interactions in Drosophila. Proceedings of the National Academy of Sciences, 108(23), 9673–9678. https://doi.org/10.1073/pnas.1106386108

    Article  ADS  Google Scholar 

  26. Billeter, J. C., & Goodwin, S. F. (2004). Characterization of Drosophila fruitless-GAL4 transgenes reveals expression in male-specific fruitless neurons and innervation of male reproductive structures. The Journal of Comparative Neurology, 475(2), 270–287. https://doi.org/10.1002/cne.20177

    Article  Google Scholar 

  27. Naito, Y., Hino, K., Bono, H., & Ui-Tei, K. (2015). CRISPRdirect: Software for designing CRISPR/Cas guide RNA with reduced off-target sites. Bioinformatics, 31, 1120–1123. https://doi.org/10.1093/bioinformatics/btu743

    Article  Google Scholar 

  28. Banerjee, T., & Monteiro, A. (2018). CRISPR-Cas9 mediated genome editing in Bicyclus anynana butterflies. Methods and Protocols, 1(2), 16. https://doi.org/10.3390/mps1020016

    Article  Google Scholar 

  29. Kallman, B.R., Kim, H., & Scott, K. (2015). Excitation and inhibition onto central courtship neurons biases Drosophila mate choice. eLife. 4, e11188. https://doi.org/10.7554/eLife.11188

  30. Wohl, M., Ishii, K., & Asahina, K. (2020). Layered roles of fruitless isoforms in specification and function of male aggression-promoting neurons in Drosophila. eLife. 9, e52702 https://doi.org/10.7554/elife.52702

  31. Aranha, M. M., & Vasconcelos, M. L. (2018). Deciphering Drosophila female innate behaviors. Current Opinion in Neurobiology, 52, 139–148. https://doi.org/10.1016/j.conb.2018.06.005

    Article  Google Scholar 

  32. Neville, M. C., Nojima, T., Ashley, E., Parker, D. J., Walker, J., Southall, T., Van de Sande, B., Marques, A. C., Fischer, B., Brand, A. H., Russell, S., Ritchie, M. G., Aerts, S., & Goodwin, S. F. (2014). Male-specific fruitless isoforms target neurodevelopmental genes to specify a sexually dimorphic nervous system. Current Biology, 24(3), 229–241. https://doi.org/10.1016/j.cub.2013.11.035

    Article  Google Scholar 

Download references

Acknowledgements

We would like to thank Rachel Seah, Bernetta Kwek, Tirtha Banerjee, Suriya Narayanan Murugesan, Jocelyn Wee, Tan Lu Wee, Dr. Antonia Monteiro and other members of the Butterfly/Spider Lab for guiding and overseeing us throughout our experiments. This study was partially supported by the Ministry of Education AcRF grant (R-154-000-B72-114).

Author information

Authors and Affiliations

  1. Hwa Chong Institution, Singapore, Singapore

    You Chen Roy Quah

  2. Department of Biological Sciences, National University of Singapore, Singapore, Singapore

    Daiqin Li

Authors
  1. You Chen Roy Quah
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Daiqin Li
    View author publications

    You can also search for this author in PubMed Google Scholar

Corresponding author

Correspondence to You Chen Roy Quah .

Editor information

Editors and Affiliations

  1. International Researchers Club, Singapore, Singapore

    Huaqun Guo

  2. Department of Biomedical Engineering, National University of Singapore, Singapore, Singapore

    Hongliang Ren

  3. Singapore Institute of Technology, Singapore, Singapore

    Victor Wang

  4. Department of Information Systems Technology and Design, Singapore University of Technology and Design, Singapore, Singapore

    Eyasu Getahun Chekole

  5. Agency for Science Technology and Research, Experimental Drug Development Centre, Singapore, Singapore

    Umayal Lakshmanan

Appendix

Appendix

Note

  1. 1.

    P1 promoter sequence: 5’TGCTGCTGTCGCCGTGCTGCGCCTGCTGCTGCTGCGTTTCGTTGGTGCTGCGACAGCAGAGTCGTTGCAACAATCGCAGCTTGCACATCCAGCAGCAGTCAGTTG GACGCGGCGGCTCCTTCAGCAAGGACGCACAGCTCACACAATCCCTTCGAAGGAAATCAGCAGCCGACATACCGAACGACCTGCCACAA

    CATTCCA3’

  2. 2.

    For CRISPRa, the target sequence was CAGCAGCAGTCAGTTGGACGCGG (+). There were no 20 mer or 12 mer off-target sites. The corresponding sgRNA was: 5′GAAATTAATACGACTCACTATAGGCAGCAG CAGTCAGTTGGACGGTTTTAGAGCTAGAAATAGC3′

  3. 3.

    For CRISPRi, the target sequence was CCGACATACCGAACGACCTGCCA (−). There were no 20 mer or 12 mer off-target sites. The most corresponding sgRNA was: 5′GAAATTAATACGACTCACTATAGGT GGCAGGTCGTTCGGTATGTGTTTTAGAGCTAGAAATAGC3′.

  4. 4.

    Gene expression quantification formula (ΔΔCT method): The fold change in gene expression is given by the formula 2(Δ(ΔCTE−ΔCTC)) where ΔCTE and ΔCTC are defined as the difference between the gene of interest and the reference gene (Δ(GOI-RG)) of the experiment and control respectively. In this case, the gene of interest was fruitless, whilst the reference gene was ACT42A.

Supplementary Fig. 45.4.

Fig. 45.4
figure 4

ACT42A (left) and fruitless (right) PCR amplification in WT as proof of concept. As the gene sequences were conserved in the dCAS9-p300 and dCAS9-hHDAC3 lines, the RT-qPCR amplification results remains valid. The top bands show amplification of the target sequence, whilst the bottom bands indicate primer dimers

Full size image

Legend:

Samples 1, 2 and 3 are mRNA extracts from WT protocerebrum converted to cDNA, which was used as the template for PCR. The control (ctrl) used was PCR performed without any template DNA.

Supplementary Table 45.1.

Table 45.1 Results of RT-qPCR expression quantification
Full size table

Rights and permissions

Reprints and permissions

Copyright information

© 2022 The Author(s), under exclusive license to Springer Nature Singapore Pte Ltd.

About this paper

Check for updates. Verify currency and authenticity via CrossMark

Cite this paper

Quah, Y.C.R., Li, D. (2022). Epigenetic Modification of fruitless in the Protocerebrum Influences Male Drosophila Courtship Behaviour. In: Guo, H., Ren, H., Wang, V., Chekole, E.G., Lakshmanan, U. (eds) IRC-SET 2021. Springer, Singapore. https://doi.org/10.1007/978-981-16-9869-9_45

Download citation

Publish with us

Policies and ethics

Search

Navigation