H-NS as a Defence System

Navarre, William Wiley

doi:10.1007/978-90-481-3473-1_13

H-NS as a Defence System

William Wiley Navarre⁴

Chapter

1131 Accesses
6 Citations

Abstract

The genomes of free-living bacteria are not static but, quite to the contrary, are highly dynamic entities over evolutionary time. Bacteria evolve rapidly by constantly swapping genetic material through lateral (horizontal) gene transfer. Even potentially useful foreign DNA can interfere with pre-existing regulatory networks and disrupt nucleoid structure and chromatin organization. The nucleoid associated protein H-NS plays a major role in binding and silencing expression from genes acquired by enteric bacteria from foreign sources by specifically targeting those sequences with significantly lower GC-content than the rest of the genome. As a result of this property H-NS regulates a large majority of virulence-associated genes in enteric bacteria including Salmonella, E. coli, and Yersinia. This chapter will focus on what is known about H-NS-mediated silencing, anti-silencing by H-NS antagonists, H-NS phylogeny, the accessory molecules Hha and YdgT, and the role H-NS plays in protecting the bacterial cell from the negative consequences of genetic exchange.

Download chapter PDF

Introduction

The sequencing of thousands of bacterial genomes over the past decade has led to a revolution in our understanding of how these unicellular organisms evolve. We have learned that bacterial chromosomes are not static but, quite to the contrary, can display large variations in gene content even between strains that are closely related. This striking amount of genetic variability is due in large part to the fact that the genomes of free-living bacteria frequently undergo genetic exchange via lateral (or horizontal) gene transfer (LGT), picking up new genetic material through processes such as conjugation and transduction while rapidly losing genes that do not confer a selective advantage (Ochman and Davalos 2006; van Passel et al. 2008). The role of LGT in bacterial evolution has been primarily studied in the context of pathogens as a large majority of virulence-associated genes in most pathogens were acquired by LGT. It is clear, however, that genetic exchange is also a commonplace phenomenon in non-pathogenic bacteria and evidence of LGT has been observed in the genomes of every free-living bacterial species sequenced thus far.

Any E. coli strain can differ from any Salmonella strain by as much as a quarter of its genetic content despite the fact that the genomes are largely conserved in their gene order (i.e. are syntenic) and only diverged approximately 100 MYr ago (Groisman and Ochman 1997; Lawrence and Ochman 1998; McClelland et al. 2001; van Passel et al. 2008). Individual isolates of other bacterial species, such as members of the high GC Gram-positive Frankia, can vary in their genetic content from one another by nearly 50% (Normand et al. 2007). All of this begs the question of how bacterial cells can organize, structure, and regulate their genome in the background of extensive and rapid gene acquisition by LGT and reduction through gene loss.

Genes acquired by LGT can be associated with either intact or degraded phage elements or are located adjacent to tRNA loci, but many other genes appear to have inserted into the genome with no apparent clue as to the underlying mechanism of their transfer. Xenogeneic sequences frequently exhibit variant base composition and codon usage from that of their host genome; in a majority of cases, genes acquired by LGT are relatively rich in adenine and thymine (i.e. are “AT-rich”) (Daubin et al. 2003a; Lawrence and Ochman 1997).

This chapter will focus on the bacterial nucleoid protein H-NS and the recent evidence that suggests it plays a primary role in targeting and silencing those genes obtained via LGT with AT contents significantly higher than the genome average. This chapter will explore specific properties that make H-NS ideally suited to serve as a silencer of gene expression and the mechanisms by which H-NS-silenced genes are activated. Despite recent progress and almost three decades of intense study, a complete understanding of H-NS and its function has been elusive and virtually every aspect of H-NS structure and function remains controversial to one degree or another.

H-NS

H-NS was originally identified as a small heat-stable factor that could stimulate E. coli RNA polymerase (RNAP)-directed transcription in vitro from phage templates when present at low concentrations but would inhibit transcription at high concentrations (Cukier-Kahn et al. 1972; Jacquet et al. 1971). H-NS was rediscovered in 1977 and yet again in 1981 during biochemical screens for bacterial “histone-like” proteins that could be isolated under conditions that were successful in isolating eukaryotic histones (Bakaev 1981; Varshavsky et al. 1977). It was named H-NS (heat-stable nucleoid structuring protein) during preliminary structural and functional studies of bacterial “histone-like” proteins (Falconi et al. 1988; Gualerzi et al. 1986; Lammi et al. 1984; Paci et al. 1986) and was concurrently identified in several independent studies as responsible for regulating a large number of disparate biological processes. As such H-NS and its corresponding gene, hns, have been at some point referred to as H1 (Cukier-Kahn et al. 1972), H1a (Spassky et al. 1984), 16K (Laine et al. 1984), B1 (Varshavsky et al. 1977), bglY (Defez and De Felice 1981), osmZ (May et al. 1990), drdX (Goransson et al. 1990), virR (Hromockyj et al. 1992), cur (Diderichsen 1980) and pilG (Spears et al. 1986). Any confusion regarding the name of this gene and its product was resolved by the early 1990s and hns/H-NS, with a few unfortunate exceptions, has been used almost exclusively since that time.

H-NS has frequently been called one of the “histone-like proteins of bacteria”. This statement carries not only the misconception that H-NS is functionally equivalent to a histone, but also that it is a molecule found in most bacteria. Although several comparisons have been made between H-NS and eukaryotic histones, and despite the fact that they share some gross overall characteristics like the ability to compact and increase the thermal stability of DNA (Friedrich et al. 1988; Lammi et al. 1984; Spassky et al. 1984), it is important to note that H-NS bears no primary sequence homology to any histone subunit nor is H-NS similar to histones in the manner by which it interacts with DNA.

Analysis of available genome sequences has revealed that members of the family of H-NS-like molecules are incredibly diverse in their primary sequence. Many are so divergent that they cannot be easily aligned with H-NS for much of their sequence nor can they be identified through simple BLAST searches (Tendeng and Bertin 2003; Tendeng et al. 2003b). The distribution of H-NS-like molecules is limited to subsets of the alpha-, beta-, and gamma-proteobacteria. Furthermore the distribution of these proteins is quite odd with many H-NS like molecules encoded on genomic islands or plasmids that have been acquired via LGT. E. coli can encode between two and four H-NS like molecules while species like Burkholderia can encode as many as eighteen. The implications of these observations are discussed further in section 11 regarding H-NS phylogeny.

Structure of H-NS

H-NS is a small (15.5 kDa, 137 amino acids) neutral DNA-binding protein that is one of the most abundant proteins in E. coli at approximately 20,000 copies per cell (Falconi et al. 1988; Lammi et al. 1984). A complete, high-resolution structure of the H-NS protein has proven elusive but data from several studies support a model where H-NS consists of an N-terminal domain and flexible linker that are involved in multimerization and higher order structuring and a C-terminal DNA-binding domain (Rimsky 2004; Shindo et al. 1999; Smyth et al. 2000; Ueguchi et al. 1996, 1997). The N-terminal domain is contained within residues 1-64 while the C-terminal domain extends approximately from residues 80 to 136. Structures of the N-terminal (Bloch et al. 2003; Esposito et al. 2002; Renzoni et al. 2001) and C-terminal domains (Shindo et al. 1995, 1999) from the E. coli or Salmonella H-NS molecules have been resolved by NMR analysis, but no high-resolution molecular structure exists of full-length H-NS in complex with target DNA. The salient features of each domain are explained in greater detail in the following sections with a central focus on how they contribute to the ability of H-NS to act as a transcriptional silencer.

Dimerization and Higher-Order Complexes - A Role for the N-Terminus

Several studies have demonstrated that the N-terminal domain of H-NS plays a role in H-NS multimerization but despite considerable effort by several labs we still have a very unclear picture of how H-NS self-associates. Interpretations regarding the role of specific regions and even the degree of multimerization vary widely depending on the approach used. An early study by Falconi et al. found that in solution H-NS is predominately dimeric above concentrations of 10 µM and that at even higher concentrations a significant amount of H-NS can be found in trimers and tetramers (Falconi et al. 1988). In this study the presence of DNA did not significantly affect the multimerization state of H-NS. Another study by Ueguchi et al. observed dimers and tetramers in a concentration dependent manner as determined by the elution profile through a gel-filtration matrix (Ueguchi et al. 1996). A similar approach on the isolated N-terminal domain (residues 1-64) using both gel filtration and analytical ultracentrifugation found that the N-teriminal domain exists primarily as a trimer in solution and that the full-length protein can form ≈20mers in solution at sufficiently high concentration (0.34 mM) (Smyth et al. 2000), but this finding is disputed by a similar study of the same domain that found the 1-64 region forms a dimer during analytical ultracentrifugation (Esposito et al. 2002). Yet another study in which large-zone gel permeation was employed found that dimers exist only transiently and that the majority of the protein could be found in the tetrameric form at higher protein concentrations (Ceschini et al. 2000). These examples illustrate the difficulty that has plagued structure/function studies on H-NS using traditional biochemical approaches.

High-resolution solution structures of the N-terminal domain from E. coli (residues 1 to 46) (Bloch et al. 2003) and Salmonella enterica Serovar. Typhimurium (residues 1-64) (Esposito et al. 2002; Renzoni et al. 2001) have been solved by multidimensional NMR. Another N-terminal domain structure (residues 2-49) from the H-NS-like VicH protein of Vibrio cholerae was solved through crystallography (Cerdan et al. 2003). In agreement with earlier studies of this domain by circular dichroism, these studies each found that the N-terminal domain is alpha helical, composed of two short alpha helices followed by a longer one. The structures also agree with other findings that the N-terminal domain forms a homodimer. The agreements appear to end there, however, as the Vibrio and E. coli structures have the dimer arranged in an “antiparallel” handshake arrangement (Fig. 13.1) while the Salmonella structure finds the two dimers are arranged in parallel - an arrangement also inferentially supported by measurements derived from another NMR study and single molecule manipulations of H-NS complexed to DNA (Dame et al. 2006; Garcia et al. 2006). Both proposed arrangements share certain central and important features. The primary interaction between monomers occurs through a hydrophobic coiled-coil interaction using residues contained primarily in helix 3 and several charged residues are also predicted to interact with one another via salt bridges. The two proposed dimer arrangements differ almost completely in the pairings between critical interacting residues. For example, in the parallel structure the arginine at position 15 is predicted to pair with glutamates at positions 24 and 27, while in the anti-parallel structure this same arginine is paired with the glutamate at position 39. Both structures predict that the surface of the dimerization domain is negatively charged, suggesting that it is unlikely to interact directly with DNA.

DNA Binding - A Role for the C-Terminal Domain of H-NS

The structure of the C-terminal domain (residues 91-137) of H-NS was resolved through NMR analysis (Shindo et al. 1995). This 47 residue fragment was isolated by limited trypsin proteolysis and was shown to retain partial DNA binding activity, albeit with approximately 3 orders of magnitude less affinity than full-length H-NS. The structure consists of a two-stranded beta-sheet, an alpha helix, and a 3₁₀ helix, each separated by small loops. A follow up study used NOE NMR to measure the interaction of a C-terminal H-NS fragment containing residues 60-137 with a 14 basepair oligonucleotide duplex. The H-NS residues that interact with DNA were localized to two separate areas: a disordered loop preceding the beta-sheet region (residues A80 to K96) and the loop between the beta-sheet and the alpha-helix regions (T110 to A117) (Shindo et al. 1999). These loops are adjacent in the folded structure and contain several positively charged residues that likely facilitate their interaction with DNA. The DNA interaction domain as defined in the NOE NMR study is consistent with an extensive mutagenesis study that identified residues in these two loops are important for DNA binding but not for protein stability or multimerization (Ueguchi et al. 1996).

Despite having a detailed structure of the H-NS DNA-binding domain and information about which residues interact with DNA, it remains unclear how the interaction occurs between H-NS and DNA including what interactions determine specificity, although footprinting analyses indicate that interactions occur primarily within the major groove (Rimsky and Spassky 1990; Tippner et al. 1994). Mutational analysis on the domain has identified several residues critical for DNA binding. Notably, a mutation in P115 leads to a molecule that has lost its ability to distinguish between a model curved sequence and a non-curved sequence suggesting there may be two modes of binding (Spurio et al. 1997). Multiple binding modes for H-NS have also been proposed as the result of two different biophysical studies, but no details about exactly how the two binding modes specifically differ have been determined (Shindo et al. 1999; Tippner and Wagner 1995). Even without a clear model of the specific binding mechanism a sufficient amount of progress has been made to propose a rational working model for how H-NS binds to specific genes and how it regulates transcription. The model and the data supporting it are outlined in the following section.

Binding of H-NS to DNA

Much of our current understanding about how H-NS interacts with DNA is derived from studies of several different H-NS regulated promoters that employed standard techniques to measure protein-DNA interactions including electrophoretic mobility shift (EMSA, gel-shift) assays and footprinting analysis. However recent advances in both single molecule analysis (e.g. atomic force microscopy and single molecule manipulation) as well as high-throughput analysis of H-NS binding sites by chromatin immunoprecipitation and microarray analysis have greatly expanded our working knowledge of which sequences are H-NS targets and how binding of H-NS generates higher-order nucleoprotein complexes.

DNAse I protection assays performed by several laboratories studying different loci have revealed that H-NS binds to multiple sites in cooperative fashion (i.e. multiple sites are occupied simultaneously in a very narrow concentration range) (Donato et al. 1997; Falconi et al. 1998; Rimsky and Spassky 1990). Footprints often extend well beyond what would be expected for a single bound protein dimer, indicating that H-NS may be capable of generating higher-order complexes on DNA. The vast majority of these footprints cover regions that are very AT-rich and a surprisingly large number of them are found quite distant from the -35 and -10 core promoter elements (Nagarajavel et al. 2007; Zuber et al. 1994). Studies of individual loci as well as high-throughput chromatin immunoprecipitation studies have found that the regions bound by H-NS are often well upstream or downstream of the promoter start site and appear quite often within the coding region of the gene (Dattananda et al. 1991; Grainger et al. 2006; Lucchini et al. 2006; Navarre et al. 2006; Olekhnovich and Kadner 2006; Overdier and Csonka 1992; Owen-Hughes et al. 1992; Schnetz 1995; Wolf et al. 2006; Yang et al. 2005).

It is unclear what specific feature of AT-rich sequences is recognized by H-NS. Many groups have proposed that H-NS targets intrinsically curved DNA, specifically DNA with planar curvature (Owen-Hughes et al. 1992; Prosseda et al. 2004; Tupper et al. 1994). Indeed, H-NS was identified in a biochemical screen as a DNA binding protein that displayed a marked preference for a model curved sequence over a non-curved sequence (Yamada et al. 1990). However, a genome-wide analysis of H-NS binding sites by chromatin immunoprecipitation found a much stronger correlation between H-NS binding and AT-content than with curvature (Lucchini et al. 2006) - specifically that AT-rich regions were 20 times more likely to be bound by H-NS than GC-neutral or GC-rich regions whereas curved regions were only twice as likely to be bound as regions predicted to have no curvature. Lucht et al. found that H-NS bound strongly to an extended region at the 5′ end of the proV gene despite the fact it contained no measurable curvature (Lucht et al. 1994) and in other studies H-NS binding has been difficult to demonstrate at some regions predicted to be curved (Jordi et al. 1997; O’Gara and Dorman 2000). A highly curved synthetic DNA sequence (Ulanovsky et al. 1986) employed in a number of other H-NS binding studies is also incidentally extremely AT-rich (TCTCTAAAAAATATATAAAAA; %GC = 9.5) (Zuber et al. 1994), which further confounds interpretations whether AT-richness or curvature is the critical feature being recognized. It is clear that the AT-rich sequences bound by H-NS are highly variable, and the affinity of H-NS for some bona fide sites (i.e. sites bound by H-NS in vivo) differs from that of non-specific sites by less than an order of magnitude (Lucht et al. 1994; Tupper et al. 1994). Addition of high concentrations of H-NS to a binding reaction can lead to a DNA-molecule that is almost completely coated with H-NS (Dame et al. 2000; Schneider et al. 2001). Indeed, overexpression of H-NS in vivo can lead to a complete compaction of the chromosome, resulting in cell death (Spurio et al. 1992).

The fact that H-NS binds such a wide variety of sequences led to the widespread belief that H-NS lacks a “consensus” recognition motif typical for most proteins that interact with DNA. This view has been challenged by the recent discovery of a defined 10 nucleotide high-affinity binding site in the proV promoter (Bouffartigues et al. 2007). H-NS displays remarkable affinity for this site with an apparent K_D of approximately 15 nM. This small binding motif can be introduced into other sequences including GC-rich regions and retain much of its affinity indicating that this motif is alone sufficient for H-NS recognition. A bioinformatic analysis determined that sequences highly similar to this motif are statistically overrepresented in many regions bound by H-NS in vivo as determined by genome wide chromatin-immunoprecipitation studies (Lang et al. 2007). These high affinity sites may serve as nucleation sites for H-NS binding, which facilitate the subsequent recruitment of other H-NS molecules to adjacent or nearby sites of lower affinity.

In addition to its ability to act cooperatively to form extended nucleoprotein filaments on target DNA, H-NS and related molecules also display another unusual characteristic that is important for their function. Atomic (or scanning) force microscopy has revealed that H-NS and related proteins are capable of “bridging” DNA strands; suggesting that the DNA binding subunits of each protomer are arranged in a manner that orients them on opposing faces of the H-NS dimer (Dame et al. 2000, 2001, 2002, 2005). These mechanistic distinctions may seem trivial at first but they are actually quite powerful in explaining much of what we know about how H-NS silences transcription, condenses DNA, and constrains supercoils (Fig. 13.2).

Advances in the ability to manipulate individual DNA molecules in complex with proteinacious factors have provided insights into H-NS function that could not be easily addressed using traditional approaches. A recent study performed by Dame, Noom, and Wuite provided important data regarding the H-NS/DNA interaction (Dame et al. 2006). In this study the ends of two individual bacteriophage lambda DNA molecules were each tethered to micrometer sized polystyrene beads. Each of these beads could be manipulated by means of a specialized instrument (the “Q-trap”) with four independently movable optical traps. This setup allowed force to be applied to a bridged DNA/H-NS/DNA complex by pulling on the DNA ends in directions that result in either “unzipping” or “shearing” of the complex (Fig. 13.3). The measurements obtained while unzipping an H-NS bound region indicate that the spacing of each barrier (a single H-NS binding event) is highly variable and sometimes corresponds to a size of one H-NS DNA binding domain. This suggests that the fundamental unit of binding/bridging is likely to be a dimer and that the apparent cooperativity between H-NS molecules as they polymerize along an AT-rich patch is not due to interactions between H-NS molecules per se, but rather that AT-rich DNA duplexes are brought into proximity with one another which facilitates the binding of additional H-NS subunits to lower affinity sites. This observation conflicts somewhat with the earlier studies indicating that the functional unit of H-NS binding is a tetramer or larger multimer (Esposito et al. 2002; Spurio et al. 1997); leaving the question of whether higher-order H-NS complexes play a role in gene regulation unresolved.

Measurements with the Q-trap also revealed several other H-NS binding parameters that were difficult to determine with more traditional approaches (Dame et al. 2006). First, it was found that H-NS dimers create a barrier to transcription of approximately 7 pN, which is relatively weak compared to the force generated by translocating RNAP (25 pN) (Wang et al. 1998). Second, the Q-trap enabled the measurement of off-rates, which were measured to be relatively fast for each DNA binding domain in a dimer. The combination of cooperativity and a high off-rate indicated that H-NS bound stretches are stable in their overall structure, yet are able to “breathe” to enable interactions with competing molecules as well as to enable processes like DNA replication and transcription.

Together the data generally support a model whereby H-NS initially nucleates at target sequences for which it has high-affinity (e.g. the proV consensus motif). After the initial nucleation event additional H-NS molecules can be recruited to form extended filaments along lower affinity (AT-rich) sites and also bridge adjacent helices. This “bind, bridge, and spread” model not only has strong experimental support but it also has the power to explain several previously perplexing observations regarding H-NS. As outlined in Fig. 13.2 the current model provides a plausible explanation for the observed preference of H-NS for curved DNA (or its higher affinity for regions with AT bases on the same face of the helix) (Bracco et al. 1989; Owen-Hughes et al. 1992; Yamada et al. 1990), its ability to constrain supercoiling into distinct domains (Hardy and Cozzarelli 2005; Hulton et al. 1990), its ability to facilitate DNA bending (Spurio et al. 1997), its ability to affect gene expression by binding regions downstream of the transcription start site (Atlung and Ingmer 1997; Chen et al. 2005; Dole et al. 2004b; Jordi and Higgins 2000; Owen-Hughes et al. 1992; Yang et al. 2005) and the cooperative interaction of two distantly spaced H-NS binding sites (Donato et al. 1997; Falconi et al. 1998; Nagarajavel et al. 2007; Pul et al. 2008; Rimsky and Spassky 1990).

Under certain conditions DNA bridging is not the only way in which H-NS binds to DNA. In the single molecule manipulation experiments performed by Dame et al., it was possible to pre-coat individual strands with H-NS and prevent their mutual interaction via bridging. One explanation is that the AT-rich sites on each strand were bound by H-NS dimers in such a manner that one binding site of each dimer was left unoccupied. Since both strands would be coated in this fashion there would be no sites available on each strand to allow bridging between them. Another possible explanation is that H-NS dimers may be able to bind with both DNA-binding subunits oriented toward the same strand. This experiment also indicates that bridging does not occur through protein-protein interactions between bound dimers, but rather that adjacent DNA is linked through interactions with each dimer. The possibility that, under certain conditions, H-NS can bind DNA with each of its subunits interacting with the same strand (the “non-bridging mode”), could theoretically explain discrepant results in DNA binding observed in single molecule studies performed by Amit and Stavans where H-NS/DNA interactions were analyzed using magnetic tweezers whereby the addition of H-NS to single DNA molecules was found to extend and stiffen the DNA with no evidence of bridging, which would be expected to compact the molecule (Amit et al. 2003; Amit et al. 2004; Dame and Wuite 2003).

The bridging model of H-NS binding suggests that H-NS binding can be facilitated by curvature without recognizing curvature per se. The correlation with curvature may in part reflect the fact that the DNA arms flanking the curve are brought within proximity to each other, an arrangement that would facilitate bridging by lowering a significant entropy barrier. This model has been invoked to explain the ability of H-NS to trap RNAP in a loop at the rrnB promoter (Dame et al. 2002), the hdeAB promoter (Shin et al. 2005) and the virF promoter (Prosseda et al. 2004). This model can also explain why distamycin, a drug that binds the minor groove and alters curvature, can disrupt H-NS binding at a model curved AT-rich sequence (Yamada et al. 1990).

H-NS as a Negative Regulator of Foreign-Derived (Xenogeneic) DNA

Across the bacterial kingdom surprising plurality of sequences obtained via LGT is AT-rich when compared to their resident genomes (Daubin et al. 2003b). For the enteric bacteria this includes the vast majority of virulence-associated sequences (i.e. pathogenicity islands and islets) as well as several genes involved in antibiotic resistance, almost all of which are xenogeneic (derived from a foreign source). The ability of H-NS to selectively bind and silence AT-rich sequences makes it the major virulence regulator in E. coli and Salmonella as well as in other bacterial species including the Yersiniae and the Vibrios. Accordingly, H-NS is essential for virulence in Salmonella (Harrison et al. 1994) and uropathogenic E. coli (Muller et al. 2006) and it also plays a role in drug resistance by negatively regulating the expression of plasmid encoded β-lactamase and multiple drug pumps in E. coli as well as the cryptic eefABC multidrug resistance pump in Enterobacter sp. (Masi et al. 2005; Nishino and Yamaguchi 2004; Zuber et al. 1994).

Two separate studies have employed genome-wide cDNA microarray analysis to identify genes that display altered expression in hns mutants of S. Typhimurium (Lucchini et al. 2006; Navarre et al. 2006). In accordance with previous estimates, increased expression of more than 400 genes was documented in an hns mutant. Most of these H-NS silenced genes were AT-rich; the average GC-content of an H-NS silenced ORF was 46.8%, in comparison to 52.2% for the overall genome. Approximately 90% of the H-NS silenced genes showed evidence of being acquired by LGT, and 65% of H-NS silenced genes were unique to Salmonella spp., indicating the major role that H-NS plays in regulating expression from xenogeneic genes. Furthermore H-NS could bind and silence the expression of an AT-rich gene from Helicobacter pylori that was engineered along with its promoter into a large non-essential GC-neutral region of the Salmonella genome. As predicted, H-NS did not target the adjacent GC-neutral regions as determined by chromatin immunoprecipitation. This finding demonstrated that H-NS silences newly introduced sequences based on increased adenine and thymine content per se and irrespective of their position on the chromosome.

Both of the studies mentioned above also performed H-NS chromatin immunoprecipitation combined with microarray analysis (“ChIP-on-chip”) to determine the binding sites of H-NS throughout the Salmonella chromosome (Lucchini et al. 2006; Navarre et al. 2006). This approach revealed a striking correlation between %AT content and H-NS binding with the magnitude of interaction with H-NS corresponding closely with the degree of local AT-content. More than 400 AT-rich regions of the Salmonella chromosome, including the plasmid virulence region, all five pathogenicity islands and nearly every AT-rich islet, were bound by H-NS. A high-resolution oligonucleotide array used in one study (Navarre et al. 2006) demonstrated that binding is not necessarily restricted to promoter regions, as several AT-rich coding regions were also bound by H-NS. These findings are consistent with what was been previously noted in the bgl, proU and eltAB operons (Dole et al. 2004a; Lucht et al. 1994; Madhusudan et al. 2005; Yang et al. 2005). By using identical growth conditions for both expression analysis and chromatin immunoprecipitation, Lucchini et al. concluded that H-NS acts almost exclusively as a silencer of gene expression and that almost all cases of gene activation by H-NS were due to indirect mechanisms (Lucchini et al. 2006).

Two parallel studies that employed ChIP-on-chip technology to determine the binding sites for H-NS in E. coli came to conclusions similar to those of the studies in Salmonella (Grainger et al. 2006; Oshima et al. 2006). Namely, H-NS primarily targets AT-rich sequences and, although biased toward intergenic regions, frequently binds within coding sequences. Like Lucchini et al., Oshima et al. found that H-NS acts primarily as silencer of transcription as most H-NS bound loci were transcriptionally downregulated. Earlier attempts to characterize the H-NS regulon in E. coli K-12 had been performed using proteomic or cDNA “macroarray” analysis (Hinton et al. 1992; Hommais et al. 2001). In the study by Hommais et al. approximately 5% of the E. coli transcriptome was altered in the hns mutant and many of the genes identified were involved in stress adaptation or cell envelope biogenesis. Although a correlation with foreign DNA was not noted, several genes acquired by LGT were found to be H-NS regulated, including several adhesion loci. A correlation between H-NS binding and foreign genes may have been overlooked because the K-12 laboratory strain lacks obvious large LGT-derived genomic regions such as pathogenicity islands, and the experiments were performed before many related genome sequences were available. More recently, genes under the control of H-NS were determined in a uropathogenic strain of E. coli (UPEC) using an expanded “pathoarray” designed specifically to analyze genes involved in virulence (Muller et al. 2006). In this study every UPEC virulence locus was found to be downregulated by H-NS, strongly corroborating the findings in Salmonella and indicating that H-NS function as a master virulence regulator is conserved between the two species.

Mutations in hns are lethal in Yersinia and this fact has slowed the characterization of H-NS and its role in these bacteria (Ellison and Miller 2006; Heroven et al. 2004). Banos et al. have recently exploited the dominant negative properties of truncated H-NS like molecules that contain only the dimerization domain to characterize the genes under control of H-NS in Y. enterocolitica using 2D-gel eletrophoresis (Banos et al. 2008). Using this technique they found that H-NS plays a role in regulating the expression of proV, ureG, galU and the ymoA genes similar to what has been observed in other enteric bacteria. Their study most certainly underestimated the genes under control of H-NS in Yersinia as they did not identify several genes previously known to be silenced by H-NS. However their approach may prove useful to determine the complete set of genes under control of H-NS when coupled to microarray analysis.

The phenomenon of downregulation of genes acquired by foreign sources on the basis of their lower GC-content has been termed xenogeneic silencing (i.e. the silencing of sequences derived from foreign sources) (Navarre et al. 2006, 2007). Xenogeneic silencing might explain many perplexing observations regarding bacterial genomes in the context of LGT. It seems likely that H-NS has facilitated the acquisition of AT-rich genes by allowing them to be tolerated better than they would otherwise be if their expression levels were unmitigated. Indeed, hns mutations are associated with fitness defects that range from somewhat mild in E. coli to severe in Yersinia, presumably because of the simultaneous misregulation of dozens to hundreds of xenogeneic genes. The fact that the Yersiniae do not possess a second H-NS paralogue that can partially compensate for a loss of H-NS may account for its essentiality. A similar fitness defect has been observed in Pseudomonas where deletion of mvaT or mvaU, genes encoding two H-NS like proteins, does not result in a strong phenotype while strains with mutations in both genes cannot be constructed (Castang et al. 2008). The degree to which H-NS-like molecules enhance fitness is species specific for reasons that remain unclear; both H-NS paralogues in E. coli, StpA and H-NS, can be deleted with only a moderate decrease in fitness compared to the single hns mutant (Sondén and Uhlin 1996).

Additional support for the model that H-NS plays a primary role in mitigating the untoward effects that can result from high-level expression of xenogeneic seqeuences can be found by examining the compensatory mutations that increase growth rate of hns mutants. Deletion of rpoS and phoP, two genes that positively regulate the expression of many xenogeneic loci, or deletion of SPI-2 in each can lead to a significant enhancement of growth rate in Salmonella hns mutants (Lucchini et al. 2006; Navarre et al. 2006). A similar enhancement in fitness was previously observed when rpoS mutations were introduced into hns mutants in E. coli (Barth et al. 1995). It has been observed that E. coli hns mutants have unstable genomes that can spontaneously undergo large deletions, presumably due to the increase in fitness that results from the loss of certain detrimental H-NS repressed loci (Lejeune and Danchin 1990). Interestingly, during the course of studies on Salmonella hns mutants by our group we noticed that one of our mutant strains spontaneously lost a region of the genome near the strongly H-NS dependent pagC gene (see supplementary data of Navarre et al. (2006)). Together these data support a hypothesis that it is misregulation of specific gene sets, rather than a gross alteration of chromosome structure per se, that causes the majority of the observed fitness defect in hns mutants. This idea, however, remains to be formally tested.

The Hha/YmoA Family of Accessory Regulators

At many loci silencing by H-NS is augmented by the Hha-like proteins, a family of small (∼8 kDa) soluble proteins that, like H-NS, are critical for virulence and cause a number of seemingly disparate phenotypes when mutated (Coombes et al. 2005; Madrid et al. 2007a). The prototypical member of this family, Hha, was originally identified as a negative regulator of the plasmid encoded alpha-haemolysin gene, hlyA, of some pathogenic strains of E. coli (Godessart et al. 1988; Nieto et al. 1991). The Yersinia orthologue of Hha, called YmoA, was simultaneously identified as having a negative regulatory effect on the important virulence regulator VirF in Yersinia and later as a regulator of several other Yersinia virulence factors including invasin (Cornelis et al. 1991; de la Cruz et al. 1992; Ellison et al. 2003). Most isolates of E. coli, Shigella and Salmonella possess at least one additional Hha paralogue, YdgT (sometimes called Cnu), and some strains carry additional paralogues encoded on mobile genetic elements like conjugative plasmids (Forns et al. 2005).

Members of the Hha-like proteins share significant functional redundancy (Nieto et al. 2002). Hha paralogues, like YmoA, YdgT and the ORF182 from the R27 plasmids can complement E. coli hha mutants for downregulation of several loci and, reciprocally, Hha can functionally replace YmoA in Yersinia mutants although the degree of complementation observed depends on copy number (Balsalobre et al. 1996; Forns et al. 2005; Mikulskis and Cornelis 1994; Nieto et al. 2002; Paytubi et al. 2004). Because of their functional redundancy single mutations in either hha or ydgT in E. coli or Salmonella are well tolerated and do not result in an obvious growth defect. At loci that display regulatory perturbation in hha or ydgT single mutants, the effect is almost always more severe for the hha mutation than for the ydgT mutation (Paytubi et al. 2004; Silphaduang et al. 2007). In all cases tested thus far, regulatory perturbation at such loci is exacerbated in the double hha ydgT mutant to a degree that is considerably greater than the additive contributions of both single mutants (Paytubi et al. 2004; Silphaduang et al. 2007). Together these results indicate that the Hha-like molecules are highly redundant with regard to their function and that, in wild-type E. coli and Salmonella, Hha is the dominant functional effector. YdgT apparently plays a secondary, or “backup”, role at several loci that only becomes apparent in the absence of Hha.

Recently microarray analysis has been used to determine the regulon under control of YdgT and Hha in S. Typhimurium (Vivero et al. 2008). Transcriptome analysis of hha and ydgT single mutants were not reported but the ydgT and hha double mutant strain displayed dramatic and genome-wide misregulation of over 1,000 genes with a pattern indicating that Hha and YdgT together play an important role in silencing xenogeneic AT-rich sequences. Further supporting this model is an early study finding that mutations in hha led to enhanced expression of a recombinant highly AT-rich sequence encoding an endoglucanase from Clostridium cellulolyticum (Blanco et al. 1991). The majority of the genes downregulated by Hha and YdgT in the microarray study show evidence of having been acquired via LGT and share significant, but incomplete, overlap with the genes under control of H-NS (Navarre et al. 2006; Vivero et al. 2008). These include genes from SPI-1, 2, 3 and 5 as well as a large number of other small genomic islets. A very large number of genes also displayed lower expression in the hha ydgT double mutant; among those are genes involved in motility, secretion, and the generation of surface structures. The microarray study also revealed that some loci directly silenced by H-NS, including proU, are unaffected by mutations in hha and ydgT (Vivero et al. 2008). Although only one growth condition was examined in this study the findings bring up the question of whether all or only a subset of H-NS-regulated loci require Hha or YdgT as cofactors for silencing. Current data suggest that the levels of Hha/YdgT are much lower than the levels of H-NS under most growth conditions suggesting that they cannot act in a 1:1 (or 1:2, etc) complex at all promoters; rather it suggests that Hha and YdgT may selectively bind H-NS only at certain promoters and not others. Clarification of the role that Hha and YdgT play at H-NS regulated promoters will be greatly facilitated by determining the genome-wide subset of loci that associate with Hha or YdgT using ChIP-on-chip assays.

The mechanism by which Hha-like molecules affect gene expression at H-NS regulated loci remains unclear and there is considerable debate as to whether the Hha-like proteins exert their actions by binding DNA directly or through an interaction with H-NS. It is possible that Hha and YdgT interact both with DNA and with H-NS, helping H-NS to specifically regulate a subset of promoters in a manner analogous to the way in which the extradenticle protein of Drosophila directs the specificity of Hox proteins to certain promoters (Joshi et al. 2007). Experimental support for the model that Hha exerts its regulatory effects as a DNA binding protein is derived from several observations. Hha and YdgT have been found to bind DNA fragments in gel-shift and footprint assays and also in less direct genetic assays for DNA binding (Kim et al. 2005; Olekhnovich and Kadner 2007). Furthermore, mutations in hha can affect gene expression in the absence of H-NS, suggesting that Hha is independently capable of interacting with promoters. The relevance of these findings has been called into question as other studies have found that Hha binds DNA with relatively low affinity and with poor ability to target specific sequences over non-specific competitors including poly(dI-dC) or salmon sperm DNA (Ellison and Miller 2006; Madrid et al. 2002a; Nieto et al. 2000, 2002). Given that Hha and H-NS can co-purify (see below) there is also some concern that Hha preparations used in some in vitro binding studies were not sufficiently free of H-NS. Furthermore, the studies in E. coli finding that Hha can affect gene expression in the absence of H-NS were performed in cells that maintained wild-type expression of the H-NS paralogue StpA, through which Hha could alternatively exert its effects.

A growing body of evidence supports the idea that Hha-like molecules affect gene expression via H-NS, in particular through specific interactions with the H-NS N-terminal dimerization domain. Hha, YdgT and YmoA have each been shown to interact with H-NS in vitro either through pull-down assays or by co-purification (Nieto et al. 2002). Indeed one method to prevent Hha from entering inclusion bodies when overexpressed from recombinant expression vectors in E. coli is through co-expression with recombinant H-NS (Pons et al. 2004). YmoA is also capable of making a complex with H-NS at the inv promoter that is distinct from the complex formed by either molecule alone (Ellison and Miller 2006). The solution structures of Hha, YdgT and YmoA have been determined and each are composed entirely of alpha-helices with similar, but not identical, arrangements. YdgT is composed of three helices while Hha and YdgT have an additional small C-terminal helix (Bae et al. 2008; Garcia et al. 2005; McFeeters et al. 2007; Yee et al. 2002). Spectral peaks corresponding to residues in Hha are altered in ¹H-¹⁵N HSQC-NMR spectra upon addition of H-NS and, in reciprocal experiments, it was found that HSQC spectra of H-NS are altered by the addition of Hha (Garcia et al. 2005, 2006). The structural changes that occur in Hha upon addition of H-NS result from a change in the tertiary fold of the molecule (as opposed to changes in the secondary structure) and mimic, in part, changes in Hha that are caused by an increase in temperature (Garcia et al. 2005). The residues affected by H-NS binding are displayed in Fig. 13.4.

Random mutagenesis has revealed that Hha residues R16, R50, and P64 are critical both for Hha function and for its ability to interact with H-NS (Nieto et al. 2002). The ¹H-¹⁵N HSQC spectra of these three residues were not significantly perturbed by the addition of H-NS although they lie on the same face of the Hha protein as the residues that did display significant alterations in their spectra (Fig. 13.4). Recently another mutation has been identified in Hha (C18I) that abrogates the ability of Hha to downregulate gene expression at the hlyA locus in vivo without significantly affecting its overall structure or its ability to bind H-NS in vitro, in fact binding to H-NS appears to be slightly stronger with the C18I mutant (Cordeiro et al. 2008). This finding suggests that the ability of Hha to bind H-NS per se is insufficient for function. Instead it supports a model whereby Hha has an effect on the higher order structure of nucleoprotein complexes that is perturbed by the C18I mutation. Interestingly, the directed replacement of this cysteine with either alanine or serine did not recapitulate the phenotype of the isoleucine replacement indicating that the chemistry of the cysteine sulfhydryl group is dispensable for Hha function.

The ¹H-¹⁵N HSQC NMR study to determine the H-NS regions responsible for interacting with Hha identified key residues as residing within helices 1 and 2 as well as the intervening loop (Garcia et al. 2006). In particular, ¹H-¹⁵N HSQC spectral peaks corresponding to H-NS residues 7 through 14 were severely broadened upon the addition of Hha. Mutagenesis of residue R12 was shown to dramatically reduce the interaction of H-NS with Hha. A nearby highly conserved arginine, R15, was found to play a role in H-NS dimerization but did not display a strong effect with regard to the ability of H-NS to bind Hha. Both NMR-based studies of the Hha/H-NS interaction support a relative stochiometry of one Hha molecule per two H-NS monomers (or one H-NS dimer) (Garcia et al. 2005, 2006).

The Hha-like molecules share small but significant sequence identity with the N-terminal domain of H-NS with a highly conserved stretch of residues between the beginning of helix 3 and the preceding loop of H-NS and the beginning of helix 2 and the loop preceding it in Hha/YmoA (Garcia et al. 2006; McFeeters et al. 2007; Nieto et al. 2002). It has also been shown that helices 1 and 2 of YmoA and Hha share a similar structural arrangement to helices 2 and 3 in H-NS (Garcia et al. 2006; McFeeters et al. 2007). Furthermore it has been shown that replacement of the N-terminal 64 residues of H-NS with residues 1 through 60 of Hha generates a molecule that can partially compensate for function in an E. coli hns mutant (Rodriguez et al. 2005). These observations led to the hypothesis that Hha-like molecules may function by intercalating into higher-order H-NS complexes on DNA by substituting for an H-NS dimer (McFeeters et al. 2007). This model is also supported by the observation that the N-terminal domain of H-NS can form higher-order oligomers at lower concentrations in the presence of Hha than are needed to form oligomers in the absence of H-NS (Garcia et al. 2005). Although the hypothesis that Hha-like molecules are analogous to H-NS dimerization domains is attractive in many respects it may be somewhat over-simplistic. First, H-NS dimerization domains, when overexpressed, act in a dominant negative fashion to antagonize silencing rather than augment it (Ueguchi et al. 1997). Second, residues of H-NS that are involved in its interaction with Hha are proximal to, but not identical to, the residues within H-NS involved in dimerization and Hha binding does not alter the ¹H-¹⁵N HSQC spectra of residues involved in dimerization (Garcia et al. 2006). Therefore, if the Hha-like molecules do intercalate into higher-order H-NS complexes at promoters, it is clear that they do so in a manner that is distinct from the way in which H-NS monomers interact with one-another to form dimers.

The Hha-like molecules are found only in the Enterobacteriaceae and their conjugative plasmids despite the fact that H-NS-like molecules are found in a large number of Gram-negative proteobacteria outside of the enteric lineage (Madrid et al. 2007b). Species like E. coli/Shigella and Salmonella that encode two H-NS like molecules (H-NS and StpA) generally also encode the two paralogs, Hha and YdgT, while the Yersiniae, which encode only one H-NS only encode one Hha-like molecule (YmoA). Whether this suggests that each paralogue makes specific partnerships, e.g. Hha is the preferred partner for H-NS and YdgT is the preferred partner for StpA, is difficult to determine due to the strong degree of functional redundancy between each of these molecules. Interestingly, the species distribution of Hha parallels the distribution of a specific sequence motif (NNIRTL) that is highly conserved in the H-NS molecules of the Enterobacteriaceae but is absent in all other H-NS homologues sequenced to date. The central arginine residue in the motif corresponds to the R12 of H-NS that is critical for Hha binding, providing further support that this motif is highly likely to be relevant for function (Madrid et al. 2007b).

Despite what we now understand about the Hha-family of molecules it remains unclear what the exact roles of the Hha-like molecules are in the enteric bacteria and why bacterial species that encode H-NS-like molecules, like Vibrio or Psuedomonas, do not encode Hha paralogues. It is possible that Hha-like molecules provide regulatory inputs to control the activity of H-NS-mediated silencing in response to environmental conditions including osmolarity, growth phase or temperature. Indeed, most genes that are Hha/H-NS regulated respond to a change in one of these environmental conditions (Duong et al. 2007; Ellison et al. 2003; Mikulskis et al. 1994; Mourino et al. 1996, 1998; Ono et al. 2005). Also worth mentioning is the role Hha plays in regulating conjugation and transposition. Mutations in hha lead to an increase in conjugation while Hha overexpression leads to a decrease in conjugation frequency, an effect that has been observed in more than one family of plasmids (Forns et al. 2005; Mikulskis and Cornelis 1994; Nieto et al. 1998). Overexpression of Hha leads to an increase in transposition by an undefined mechanism, similar to what has been noted for H-NS (Balsalobre et al. 1996; Mikulskis and Cornelis 1994; Shiga et al. 2001; Swingle et al. 2004). A discussion on the role of H-NS/Hha as an environmental regulator and as a regulator of conjugation and transposition is expanded further below.

Mechanisms of H-NS-Mediated Transcriptional Downregulation

It was recognized early on that H-NS regulates the expression of a large number of genes in both E. coli and Salmonella, and that its effects on gene expression are largely, if not exclusively, inhibitory (Dorman 2004; Higgins et al. 1990). Mechanistic analysis of H-NS-mediated silencing has been analyzed in detail at a number of loci including proU, bgl, dps, hdeAB, the rrn operon, the virF locus of Shigella, and at the hns gene itself. What has emerged from these studies is that H-NS can downregulate gene expression in a number of mechanistically distinct ways that will be outlined in the following sections. Simple categorization of silencing mechanisms is difficult given that several factors including temperature, osmolarity, promoter activity, and other DNA binding proteins coordinate in varied ways to affect expression at each promoter. For all proposed silencing mechanisms, however, the ability of H-NS to bind cooperatively and to generate extended nucleoprotein filaments appears to be important (Dame 2005; Rimsky 2004; Spurio et al. 1997; Ueguchi et al. 1997).

Occlusion

The most obvious way in which H-NS binding could downregulate gene expression is by simply preventing access of RNAP to core promoter elements through steric competition. H-NS binding sites have been shown to overlap core promoter elements at a number of promoters by footprinting analysis, but in such cases it is not necessarily safe to infer that RNAP cannot bind in the presence of H-NS. To date very few promoters have been examined where occlusion of RNAP by H-NS has been formally recapitulated in vitro. H-NS appears to greatly reduce RNAP · σ^D (but not RNAP · σ^S) binding at the dps promoter (Grainger et al. 2008) in vitro. H-NS also partially competes for binding of RNAP · σ^D to the E. coli hlyE promoter (Lithgow et al. 2007). At both the proU and bgl promoters H-NS appears to block transcription by RNAP at a step before open complex formation but binding/competition assays between RNAP and H-NS have not been performed in vitro (Jordi and Higgins 2000; Nagarajavel et al. 2007) and it is possible that RNAP binds to these promoters but cannot initiate open complex formation.

At promoters where occlusion is occurring, one prediction is that H-NS and RNAP would not be observed to co-associate during chromatin immunoprecipitation assays. Three recent high-throughput chromatin immunoprecipitation studies in E. coli and Salmonella have mapped the genome wide co-occupancy of H-NS and RNAP at promoters with conflicting results. In the Salmonella study it was found that the vast majority of H-NS bound promoters did not co-precipitate with RNAP (Lucchini et al. 2006), while approximately half the H-NS-bound promoters in E. coli were shown to co-precipitate with RNAP (Grainger et al. 2006; Oshima et al. 2006). This discrepancy remains to be explained but it is unlikely to be caused by the difference in the species tested given that E. coli and Salmonella are closely related. Chromatin immunoprecipitation is an assay carried out on a large population of cells and given the heterogeneity of expression in individual cells in bacterial populations it is impossible to determine whether H-NS and RNAP appear to co-localize at a given region in these assays due to their simultaneous occupation in most cells or instead merely appear to co-localize due to ensemble averaging of two distinct subpopulations that might exist within the culture, one population with RNAP bound at a given locus and another where H-NS is bound.

Polymerase Trapping

H-NS can also downregulate gene expression at steps after the association of RNAP with the core promoter by preventing open-complex formation or by preventing the subsequent establishment of a productive elongation complex. This is supported both by genome-wide chromatin immunoprecipitation studies finding that RNAP and H-NS colocalize at several promoters, as well as in vitro studies at individual promoters including rrnB and hdeAB (Dame et al. 2002; Schroder and Wagner 2000; Shin et al. 2005). This phenomenon, called “trapping” was first demonstrated at the rrnB P1 promoter where H-NS cooperatively binds three distinct patches within the promoter region to enhance rather than reduce RNAP binding (Schroder and Wagner 2000). H-NS mediated silencing at rrnB P1 is achieved by preventing RNAP escape from the initial open complex into an elongation complex. Importantly, RNAP and H-NS appear to bind cooperatively with each enhancing the binding of the other. This suggests that RNAP may actually be a co-factor that enables H-NS to make a stable complex at the rrnB P1 promoter, perhaps by facilitating bridging as first proposed by Dame et al. (Dame et al. 2002).

The possibility that RNAP plays an active role in making a repressive loop with H-NS is further supported by recent mechanistic studies on the hdeAB promoter. Shin et al. employed both permanganate footprinting and atomic force microscopy to analyze the mechanism by which H-NS selectively downregulates hdeAB when RNAP is associated with the housekeeping sigma factor σ^D (RpoD, σ⁷⁰) but permits transcription when the RNAP core is complexed with the alternative sigma factor σ^S (RpoS, σ³⁸) (Shin et al. 2005). Permanganate footprinting shows that H-NS does not prevent open complex formation by either RNAP · σ^S or RNAP · σ^D. Images of the hdeAB promoter bound to RNAP · σ^S show that the DNA exits at a wide angle, perhaps preventing bridging of the adjacent sequences whereas the promoter bound to RNA RNAP · σ^D is bound more tightly and exits from the polymerase at a very narrow angle, allowing H-NS to effectively bridge both flanking sequences and forming a repressive loop.

Supercoil Trapping

As alluded to above, H-NS has been shown to constrain supercoils both in vitro and in vivo (Hardy and Cozzarelli 2005; Higgins et al. 1988; Hinton et al. 1992; Mojica and Higgins 1997; Tupper et al. 1994; Zhang et al. 1996), and H-NS has been termed a “domainin”, i.e. a protein that can prevent global unwinding of the chromosome following double stranded breaks by acting as a barrier that constrains supercoiling to local domains (Hardy and Cozzarelli 2005). In an elegant study, hns was identified during a genetic screen for mutants capable of modulating reporter genes under the control of the gyrB and lac promoters, known to be sensitive to the degree of supercoiling (Hardy and Cozzarelli 2005). Although the control of these promoters by H-NS could be direct (through occlusion or RNAP trapping) it is more likely that the effect observed was due to alterations in local supercoiling since gyrB is not strongly regulated by H-NS in its native context.

The ability of H-NS to constrain supercoils could enable it to regulate certain promoters that are sensitive to the degree of supercoiling by locking them in either activated or silenced states (Higgins et al. 1990; Mojica and Higgins 1997). Indeed, changes in supercoiling can alter the expression of a few promoters directly regulated by H-NS including the bgl and proU operons (Higgins et al. 1988; Mukerji and Mahadevan 1997; Schnetz and Wang 1996). However, the models that suggest that H-NS mediated activation and/or downregulation occurs via alterations in supercoiling have been generated with data from hns mutants. This fact means we have little clue as to how supercoiling would be altered at specific promoters in the presence of normal cellular levels of H-NS. One model is that a change in supercoiling in response to some environmental condition at certain promoters leads to a reduction in H-NS binding, thereby enabling transcription (i.e. changes in supercoiling occur at a step before silencing is affected). The other model is that alteration of the H-NS-nucleoprotein complex by a specific transcription factor relieves local constraints on supercoiling thereby allowing transcription elongation or initiation by, for example, aiding in melting the promoter region during open complex formation or in promoter clearance (Dorman 2006; Lim et al. 2003).

These models have proven difficult to test experimentally. Activity at the bgl promoter is considerably lower on linear templates than supercoiled templates when assayed by in vitro transcription using RNAP with naked DNA templates, but the same promoter is silenced in vivo regardless of the supercoiling state (Schnetz and Wang 1996). At the proU locus, the supercoil trapping model does not fully explain how H-NS-mediated silencing is relieved under high osmolarity conditions and a significant proportion of the osmotic response at proU remains even in the absence of H-NS, indicating that the contributions made by H-NS and supercoiling can be separated at the proU promoter (Fletcher and Csonka 1995).

The functional significance of H-NS and its ability to trap supercoils may not be limited to transcriptional regulation. H-NS binding appears to provide topological isolation for both the purpose of localizing genomic perturbations in structure and preventing widespread loss of supercoiling after DNA damage. Studies have suggested that the E. coli chromosome is organized into topological domains that vary widely in size but average ≈10 kb (Deng et al. 2005; Postow et al. 2004). A recent analysis has shown that the distribution of H-NS binding sites, as determined by high-resolution chromatin immunoprecipitation analysis, correlates well with these empirical estimates for topological domain size and distribution (Noom et al. 2007). There is also a correlation between H-NS levels and domain sizes, and together these suggest that H-NS may be a major factor in determining topological domain size in vivo. Further studies will be needed to directly address the effects of H-NS on the topology of specific domains along the chromosome. A more detailed treatise of the effects of H-NS on chromatin structure is provided in Chapter 8 of this book entitled “Nucleoid-Associated Proteins: Structural Properties”.

Is H-NS-Mediated Transcriptional Downregulation Really “Silencing”?

The term “xenogeneic silencing” was chosen to extend a previously defined conceptual framework regarding the unique mechanism by which H-NS downregulates transcription and to further distinguish it from the mechanism of repression employed by “classical” site-specific DNA binding proteins (Goransson et al. 1990; Rine 1999; Yarmolinsky 2000). The use of the term “silencing” could mistakenly be taken to suggest that similarity exists between silencing by chromatin in eukaryotes and the mechanism that underlies H-NS-mediated downregulation of recently acquired genes. As generally defined eukaryotic and bacterial silencing refer to the downregulation of gene expression by non-specific DNA binding proteins that can act at a distance from the core promoter (Goransson et al. 1990; Madrid et al. 2002b). Drawing parallels between xenogeneic silencing and chromatin-mediated silencing in eukaryotes is superficially attractive given that the latter phenomenon is mediated by histones and that H-NS has been referred to as the bacterial equivalent to a histone.

It is important, however, to reiterate that H-NS-mediated downregulation shares no mechanistic similarity to eukaryotic silencing of gene expression. Unlike silencing mediated by histones, for example, silencing by H-NS does not involve post-translational modification of H-NS by phosphorylation, acetylation or methylation. The effect of H-NS also varies greatly from promoter to promoter; some H-NS-regulated genes display significant basal levels of expression and therefore are not “silent”, as most eukaryotic genes are. Therefore, as is the case for the term “repression” (the mechanism of which also differs significantly between eukaryotes and bacteria), the silencing terminology only implies a loose functional analogy between bacteria and eukaryotes.

H-NS as a Temperature and Osmolarity Sensor?

H-NS has been described as a global regulator that can alter the expression of a large number of genes in response to certain environmental conditions such as pH, temperature, anaerobiasis, or osmolarity (Amit et al. 2003; Atlung and Ingmer 1997; Atlung et al. 1996; Dorman 2007). Expression of H-NS relative to DNA content appears to be relatively constant under a range of environmental conditions (Atlung and Ingmer 1997; Dorman 2004; Free and Dorman 1995). Since H-NS concentrations do not vary significantly in response to pH, temperature or osmolarity, the H-NS protein has instead been postulated to undergo structural and functional alteration under these environmental conditions, leading to a corresponding increase in expression at certain H-NS silenced loci. While some biochemical evidence for such structural changes has been obtained, the correlation with H-NS dependent gene expression has been less than perfect. For example, the subsets of genes regulated by pH, temperature, oxygen and osmolarity are distinct; e.g., H-NS silenced genes expressed during conditions of increased osmolarity do not generally overlap with those regulated by temperature (Atlung and Ingmer 1997; Hommais et al. 2001).

Much effort has focused on the possibility that H-NS might act as a thermosensor that globally regulates a large subset of genes in response to temperature. There is some evidence to support this notion including the fact that the DNaseI footprint of H-NS at the proU promoter is altered in response to temperature (Badaut et al. 2002). A recent report noted that more than three-quarters of the 531 Salmonella genes exhibiting altered expression when cultures were shifted from 25°C to 37°C are dependent on H-NS (Ono et al. 2005). Among these genes were the Salmonella-specific SPI-1 and cobalamin biosynthetic (cob) genes, as well as genes involved in flagellar biosynthesis and chemotaxis. Both SPI-1 and cob were constitutively expressed at high levels in the absence of H-NS regardless of temperature, whereas motility genes were constitutively repressed. Temperature-induced regulation of SPI-1 was rapid, occurring within minutes. Further work found that the purified H-NS N-terminal domain had altered oligomerization properties in response to temperature, and while full-length H-NS had decreased affinity for the hilC promoter at 37°C no temperature dependence in the affinity of the C-terminal domain for DNA was observed. Based on these data a model was proposed in which the oligomerization properties of H-NS change at 37°C to favor a dimeric conformation, perhaps through temperature-induced changes in the orientation of the dimerization domain. Such changes would reduce or alter the mode of DNA binding and permit a rapid transcriptional response to change in temperature.

However, although most temperature-dependent Salmonella genes were found to be regulated by H-NS, the converse was not the case. More than 200 genes were silenced equally well by H-NS at 25°C and 37°C, including virK, pipB2, mig-14, pagC, yciEFG, and the pathogenicity islands SPI-2, SPI-3, and SPI-5. The H-NS-silenced proU operon was paradoxically more effectively silenced at 37°C than at 25°C. Furthermore the H-NS-silenced invA and rovA genes of Yersinia are active at 30°C and inactive at 37°C under laboratory conditions (Ellison and Miller 2006; Heroven et al. 2004). Several loci in the locus of enterocyte effacement (LEE) carried by pathogenic E. coli are silenced by H-NS at all temperatures (Umanski et al. 2002). H-NS silences eltAB encoding the heat-labile enterotoxin of E. coli both at 22°C and at 37°C (Yang et al. 2005). Thermal regulation of the Shigella virF promoter has been attributed to temperature-induced alterations in the conformation of a bend adjacent to the promoter rather than in the H-NS protein itself (Falconi et al. 1998; Prosseda et al. 2004). Changes in promoter conformation might also account for the persistent silencing of the virB promoter at 37°C when the Shigella virulence plasmid is integrated into the chromosome (Colonna et al. 1995).

Another study analyzing H-NS structure and function in response to temperature concluded that H-NS tetramerization and activity is actually higher at elevated temperatures (Stella et al. 2006). Chimeric molecules were constructed whereby the N-terminal oligomerization and linker domains of H-NS were fused to the DNA-binding domains of phage repressors. Dimerization and oligomerization of these H-NS domains was determined through the use of reporter constructs situated downstream from different combinations of phage operator sequences. This experimental approach allowed the assay of β-galactosidase activity as a measure of DNA binding by the H-NS chimera as a dimer or higher-order oligomer (Stella et al. 2005). This approach, along with gel-filtration studies of purified H-NS protein, demonstrated that the formation of higher-order complexes is inhibited at temperatures below 25°C, providing a possible explanation for the anti-silencing of H-NS-regulated genes at lower temperatures. However, some hns mutant strains have a survival deficit at low temperatures (Dersch et al. 1994), and it is difficult to explain how H-NS could be inactive yet essential for survival under cold-shock. This model would predict the widespread activation of hundreds of H-NS-silenced genes during cold shock, which is in contrast to the approximately 25 genes actually induced under these conditions (La Teana et al. 1991).

H-NS has also been posited to act as a global regulator in response to osmolarity, and hns mutants display altered osmosensitivity (Barth et al. 1995; Hommais et al. 2001; Levinthal and Pownder 1996). H-NS was identified as a silencer of the osmoregulated proU operon and subsequently as a silencer of other osmoregulated genes including osmC, osmY, otsAB and the SPI-1 regulatory locus hilA (Atlung and Ingmer 1997; Olekhnovich and Kadner 2006; Schechter et al. 2003). Force-extension measurements of individual λ DNA molecules complexed with H-NS indicate that H-NS increases the rigidity of DNA at temperatures below 32°C or in the presence of 200 mM KCl, which the authors interpreted to mean that H-NS alone might act as a temperature or osmolarity sensor (Amit et al. 2003). However, these observations must be interpreted with caution as the concentrations of H-NS used in the study were in vast excess to the DNA which may lead to the “non-bridging” mode of DNA binding (Amit et al. 2004; Dame and Wuite 2003). Moreover, the use of KCl to alter osmolarity may have more pronounced effects on protein-DNA interactions than the physiologic salt potassium glutamate, whose cytoplasmic concentrations rise during osmolar stress (Gralla and Vargas 2006). The notion of H-NS as a simple osmosensor appears to be undermined by the same reasoning that questions its role as a thermosensor, namely that the expression of many H-NS silenced genes is unaffected by changes in osmolarity (Atlung and Ingmer 1997; Hulton et al. 1990). The proU promoter maintains much of its osmoregulation in the absence of H-NS (Fletcher and Csonka 1995), presumably due to H-NS independent changes in DNA supercoiling, and many other osmoregulated H-NS-silenced genes are directly activated by factors like OmpR or the alternative sigma factor σ^S. Furthermore many H-NS silenced Shigella virulence genes are inhibited by low osmolarity, even at temperatures normally associated with induction, which contrasts with another silenced locus, hlyA of E. coli, that is induced by low osmolarity (Carmona et al. 1993; Porter and Dorman 1994). Collectively, these observations illustrate the inadequacy of a simple model in which H-NS is unable to bind DNA under certain environmental conditions, but rather support a model in which H-NS and environmental parameters such as temperature and osmolarity have competing or interactive effects on DNA superhelicity and the expression of additional factors like sequence-specific DNA binding proteins that can act in concert to control the expression of individual loci. Specific examples where temperature or osmolarity appear to increase expression from certain promoters without altering the structure or oligomerization state of H-NS per se are discussed at the end of the following section.

Mechanisms of Anti-Silencing

Comparative analysis of several related bacterial genomes has revealed that many genes acquired via LGT are transient (van Passel et al. 2008). Most new sequences appear to be lost relatively quickly, never succeeding in establishing permanent residence in the genome either because they fail to enhance fitness or fail to properly integrate into the proper pre-existing regulatory circuits necessary for them to manifest their beneficial effects. With this in mind it is likely that most H-NS silenced genes, specifically those that are obtained by LGT, are eventually lost without ever having an appreciable effect on their host. This fact is underscored by the observation that despite large amounts of genetic exchange, any given isolate of Salmonella has stably maintained genes from only ∼300 horizontal gene transfer events over the course of the past 100 MYr since the Salmonellae diverged from E. coli - a relatively slow rate of gene acquisition that averages one successful transfer event per 300,000 years (Groisman and Ochman 1997; Lawrence and Ochman 1998; McClelland et al. 2000).

In the rare cases throughout the evolution where H-NS silenced genes do find a useful function and enhance bacterial fitness it is important that the bacterial cell be able to activate such genes in a temporally appropriate manner in response to the correct set of environmental conditions. This poses a challenge given that the genes acquired via LGT do not necessarily encode their own regulatory proteins (although several xenogeneic elements do) nor do they necessarily have the necessary genetic information to properly integrate into the pre-existing regulatory networks of their new host cell. A survey of the literature reveals that many genes regulated by H-NS are also controlled by other global regulators including Lrp, Fis, IHF, CRP-cAMP, ppGpp and σ^S. This may be due in part to the fact that regulatory proteins with relatively degenerate target specificities (e.g. H-NS, HU, IHF, etc.) are more likely than highly-sequence specific transcriptional regulators to recognize newly introduced genetic elements and recruit them into pre-existing regulatory networks.

A comprehensive and well-written review on the various mechanisms by which xenogenic silencing can be overcome has recently been published (Stoebel et al. 2008). The authors note that antagonism of H-NS at various promoters appears to involve ad hoc solutions and that few specific mechanisms are widely employed. Rather, it appears that depending on the specific context a number of mechanisms can suffice to alter the H-NS nucleoprotein complex to enable transcription. This may be due in part to the fact that H-NS is a relatively poor DNA binding protein with fairly high off rates at most sites (Dame et al. 2006), the obvious exception being the recently identified high-affinity consensus site (Bouffartigues et al. 2007). Few anti-silencers act directly on H-NS to abrogate silencing, the notable exceptions being factors that antagonize H-NS by acting in a dominant-negative fashion (e.g. H-NST) and the H-NS antagonists encoded on the T7-family of phages (the 5.5 proteins). In most instances anti-silencing occurs through alteration of local nucleoid structure by protein protein binding or environmental influences, by displacement of H-NS through competition for DNA-binding sites, or a combination of these mechanisms. Several of these mechanisms are outlined in Fig. 13.5.

Anti-Silencing - A Role for Promoter Strength?

The bgl and proU promoters are each regulated by H-NS binding sites found upstream and downstream of the promoter; referred to as the upstream and downstream regulatory elements (URE and DREs) respectively (Dattananda et al. 1991; Overdier and Csonka 1992; Owen-Hughes et al. 1992; Schnetz 1995). At both promoters these elements appear to act cooperatively to silence transcription, perhaps by forming a repressive loop (Bouffartigues et al. 2007; Nagarajavel et al. 2007). In the absence of the URE the DRE elements of both promoters retain residual ability to downregulate transcription in an H-NS dependent manner and it is curious how such repression occurs in the absence of a second H-NS binding site (Nagarajavel et al. 2007). The ability of the bgl DRE to inhibit transcription may be, in part, due to hindering transcription elongation by RNAP, resulting in premature transcript termination by the transcription termination factor Rho (Dole et al. 2004b). However recent data suggests that downstream regulatory elements can block transcription at a step before open complex formation (Nagarajavel et al. 2007) and that this effect is most pronounced in the context of a weak promoter. Transcription from synthetic promoters containing the bgl and proU DRE is inhibited in conjunction with the weak P_lacI promoter but is mostly unaffected when transcription is driven by the relatively strong P_tac promoter. An intermediate strength promoter, P_UV5, displayed moderate inhibition by the proU and bgl DREs. This suggests that promoter strength may play a significant role in whether H-NS mediated silencing is effective for some sequences. This observation seems to be important only for the downregulation mediated by the DRE in the absence of the URE. In combination, the bgl URE and DRE can effectively silence transcription directed by the bgl, lac and lacUV5 promoters (Schnetz 1995). Although the relevance of promoter strength appears to be context dependent, it opens up a new line of inquiry into a previously underappreciated aspect regarding the mechanism of anti-silencing. Many transcription factors increase promoter strength and it is possible that this fact alone could account for their ability to serve as anti-silencers at some loci. Other ways that site-specific transcription factors contribute to anti-silencing, such as directly competing with H-NS for binding sites or altering nucleoid structure, are discussed below.

A Role for RNA Polymerase and Sigma Factors in Silencing and Anti-Silencing

As discussed briefly in Section 13.7.2, recent findings have suggested that RNA polymerase is not a passive player in H-NS-mediated silencing. Several findings have suggested that RNAP can act directly on the architecture of promoters to enhance silencing or anti-silencing by H-NS. In some cases, whether transcription occurs or not can depend on which sigma factor is associated with RNAP. Many loci silenced by H-NS are preferentially transcribed by RNAP in complex with the alternative sigma factor σ^S but cannot be transcribed by RNAP associated with the housekeeping sigma factor σ^D. Examples include dps (Grainger et al. 2008), LEE1 (Ler) (Laaberki et al. 2006), asr (Seputiene et al. 2004), gadBC (De Biase et al. 1999; Waterman and Small 2003), proU (Rajkumari and Gowrishankar 2001), hdeAB (Shin et al. 2005), csgBA (Arnqvist et al. 1994; Olsen et al. 1993), spvR (Robbe-Saule et al. 1997), csiD (Marschall et al. 1998) and yciEFG (Navarre et al. 2006). Although the basal promoter elements recognized by RNAP · σ^S and σ^D are highly similar, recent analyses of several σ^S-dependent promoters have revealed that they are less conserved and more AT-rich than RNAP · σ^D-dependent promoters (Becker and Hengge-Aronis 2001; Typas et al. 2007; Typas and Hengge 2006), features that might explain a greater tendency for RNAP · σ^S to initiate the transcription of newly acquired AT-rich genes. The finding that a stress-activated sigma factor can selectively drive the expression of certain H-NS-silenced genes (or, conversely, that H-NS can selectively silence RNAP · σ^D) provides one pathway by which foreign genes can be rapidly assimilated into global regulatory networks. Anti-silencing by RNAP · σ^S might also account for the relationship between H-NS and regulation of loci in response to certain stresses (e.g., proU in response to osmolarity) without invoking a structural change in the H-NS protein itself.

Genetic experiments to determine the roles of H-NS and RNAP · σ^S at a given promoter are complicated by the fact that H-NS negatively regulates σ^S (Yamashino et al. 1995; Zhou and Gottesman 2006) and by the fact that H-NS and σ^S are inversely regulated by the small RNA DsrA, which enhances σ^S translation and stability while enhancing degradation of hns mRNA (Lease et al. 1998; Majdalani et al. 1998). It should be noted that the effects of the DsrA RNA on H-NS levels were observed with DsrA in multicopy so the physiological relevance of this interaction remains unclear.

Biochemical studies, however, have generated some insight into how H-NS-mediated silencing can be selectively overcome by RNAP · σ^S at the hdeAB and dps promoters (Grainger et al. 2008; Shin et al. 2005). Analysis of the hdeAB promoter revealed that RNAP · σ^S is able to transcribe this H-NS-silenced locus much more efficiently than RNA polymerase associated with the housekeeping sigma subunit σ^D due to the different ways in which the DNA strand associates with the polymerase when complexed with the different sigma factors (Shin et al. 2005). Analysis of the role of RNAP · σ^S at the dps promoter suggests that the picture is slightly more complicated and involves additional factors including the nucleoid-associated protein Fis, as discussed in the following section (Grainger et al. 2008).

Fis, HU and IHF

Several loci have been identified where the abundant nucleoid-associated proteins Fis, IHF, and HU either augment or counter H-NS-mediated silencing. These findings are not particularly surprising given the fact that each of these proteins are highly pleiotropic regulators with >10,000 binding sites for each factor around the E. coli chromosome (Dame 2005; Grainger et al. 2007). The specific role played by these proteins at H-NS regulated promoters varies from promoter to promoter and no general mechanism applies to all situations. A genome wide analysis of binding sites for H-NS, Fis and IHF was recently performed by ChIP-on-chip and it was found that each of these proteins display biased targeting to intergenic regions (Grainger et al. 2007). The binding sites targeted by Fis and IHF were found to be AT-rich, confirming earlier observations. When binding was plotted against the AT-content of the microarray probe the curve was linear for Fis and IHF with increasing intensity at higher AT-values, but significant binding was still observed to probes of moderate GC-content. In contrast, H-NS was found to have a distinct cutoff value for AT-richness below which it fails to bind its target sequence (approximately 55% AT).

Fis is a small homodimeric DNA binding protein that binds to a moderately degenerate sequence motif that has been implicated as a global regulator in response to environmental conditions and growth rate (Finkel and Johnson 1992). Fis can regulate gene expression by binding in close proximity to a promoter but it can also influence gene expression by altering supercoiling or nucleoid structure in the vicinity of the gene (Travers et al. 2001). One mechanism by which Fis can affect local nucleoid structure is by inducing bends into DNA sequences of anywhere between 50° and 90° (Pan et al. 1996; Zhang et al. 2004). Expression of Fis is highly growth rate dependent where Fis levels are abundant during log phase growth and virtually absent in stationary phase in aerated cultures (Finkel and Johnson 1992). Fis however is easily detected in stationary phase under conditions of limited aeration (Ó Cróinín and Dorman 2007). In the case of the bgl, dps and virF promoters Fis plays a negative regulatory role in conjuction with H-NS (Caramel and Schnetz 2000; Grainger et al. 2008; Prosseda et al. 2004), whereas Fis plays an activating role at the H-NS silenced hns and rrnB promoters (Falconi et al. 1996; Tippner et al. 1994).

The abundant nucleoid binding protein HU, like H-NS, is a dimer that binds DNA with highly degenerate sequence specificity. HU-like molecules are found in almost all eubacteria, usually existing as a dimer of two identical subunits. In Salmonella and E. coli HU exists predominantly as a heterodimer of HUα and HUβ (encoded by the hupA and hupB genes, respectively) or sometimes as HUα and HUβ homodimers. Arms of the HU dimer intercalate into the minor groove resulting in a severe bend in the target DNA substrate of up to 160°. Integration host factor (IHF) shares significant homology to HU and binds DNA with considerably more sequence specificity than HU does. Due to the radical changes in local nucleoid structure caused by the binding of HU and IHF it can be envisioned that depending on the particular spatial context of an HU/IHF binding site within a promoter HU/IHF binding could either enhance H-NS mediated silencing by bringing two distant H-NS binding sites in proximity or antagonize H-NS by spreading such sites apart. Scanning force microscopy supports a model where HU can antagonize H-NS through its ability to open up DNA, as opposed to the compacting effect that H-NS has on the nucleoid (Dame and Goosen 2002). Several examples have been cited where IHF exerts positive regulatory effects at H-NS silenced genes (Altuvia et al. 1994; van Ulsen et al. 1996). Accordingly, IHF has also been demonstrated to be a global activator of virulence gene expression in Shigella, Salmonella and Vibrio (Mangan et al. 2006; Porter and Dorman 1997; Stonehouse et al. 2008). Given their abundance and highly pleiotropic regulatory profiles it is not surprising that multiple nucleoid proteins and global regulators can cooperate to regulate certain promoters. For example Fis, IHF and H-NS all cooperate to either positively or negatively regulate transcription from the dps, nir and csgD promoters (Altuvia et al. 1994; Browning et al. 2000; Gerstel et al. 2003; Grainger et al. 2008).

Fis, HU and IHF can act as global regulators in response to environmental conditions in part because each of these proteins are themselves environmentally regulated. Fis, which is abundantly expressed in log phase and virtually absent in stationary phase, positively affects rrnB expression but is a negative regulator of Dps, a protein critical for virulence and oxidative stress (Ó Cróinín and Dorman 2007; Grainger et al. 2008; Tippner et al. 1994). Expression of Fis therefore correlates with the fact that rRNA expression is very high and Dps levels are very low in rapidly growing cultures, while the converse is true in stationary phase (Ali Azam et al. 1999; Grainger et al. 2008; Halsey et al. 2004). Furthermore Dps is critical for resistance to oxidative stress, which parallels the fact that Fis is virtually absent in stationary phase in shaking cultures but is expressed at considerably higher levels under microaerobic conditions where, presumably, the need for Dps is much lower (Halsey et al. 2004; Nair and Finkel 2004).

The dps promoter provides one example of the varied and interesting ways that pleiotropic regulators can cooperate to achieve precise control over gene expression at a specific promoter in response to specific environmental conditions (Grainger et al. 2008). Dps expression is regulated by several pleiotropic factors including OxyR, RNAP · σ^S, IHF, H-NS, and Fis depending on growth phase (Schnetz 2008). An elegant and extensive combination of high-throughput and biochemical assays has revaled that control of dps expression involves the selective repression of RNAP · σ^D by Fis during logarithmic growth and selectively granting access to RNAP · σ^S but not RNAP · σ^D during stationary phase growth (Grainger et al. 2006, 2008). Fis, when bound to a region within the core promoter of dps, can trap RNAP · σ^D at the promoter in a closed complex. Trapping of RNAP · σ^D at the promoter can also serve to exclude RNAP · σ^S, although the physiological relevance of this blockage is unclear given that RNAP · σ^S is not the dominant form of polymerase during rapid growth. The Fis-directed block of RNAP · σ^D-mediated transcription can be overridden by the transcriptional activator OxyR in bacteria experiencing oxidative stress (Altuvia et al. 1994). In stationary-phase aerated cultures, when Fis is absent from the cell, H-NS can block access of RNAP · σ^D while enabling transcription from RNAP · σ^S perhaps by binding an element near the transcription start point or by a mechanism similar to that observed for the hdeAB promoter (Grainger et al. 2008). Stationary phase induction of dps is further enhanced by the action of IHF, although the exact role of IHF remains unclear (Altuvia et al. 1994).

Sequence Specific DNA Binding Proteins

A common way by which H-NS is antagonized at specific promoters is through the action of sequence-specific DNA binding proteins as was first shown for CfaD, an AraC-family transcription factor required for full expression of the CFA/I fimbrial operon in enterotoxigenic E. coli (Jordi et al. 1992). The mechanisms by which such “classical” transcriptional activators antagonize H-NS are unclear but are unlikely to involve direct interactions with H-NS. Evidence instead suggests that anti-silencing occurs either by displacing H-NS through competition for a common binding site or by invoking structural alterations upon DNA binding. Synthetic promoters have been constructed that allow anti-silencing even by non-native DNA-binding proteins such as TyrR or the Lac and λ repressors (Caramel and Schnetz 1998; Gowrishankar and Pittard 1998), arguing that any DNA-binding protein with sufficient affinity might be able to increase expression from an H-NS regulated promoter in the correct context. The recognition sites for VirB (Turner and Dorman 2007), ToxT (Hulbert and Taylor 2002) and SlyA/RovA (Stapleton et al. 2002) are very AT-rich, and the critical recognition motif for PapB is a run of three adjacent T/A bases (Xia et al. 1998), which may in part explain why these proteins were selectively co-opted to act as anti-silencers.

The most obvious and direct way that a sequence-specific transcription factor could antagonize H-NS-mediated silencing is through direct competition for a critical binding site resulting in H-NS displacement. Indeed the binding sites of many transcription factors overlap demonstrated H-NS binding sites including, SlyA/RovA at the hlyE, rovA, pagC, ugtL, inv, and capsule V gene cluster promoters (Corbett et al. 2007; Ellison and Miller 2006; Heroven et al. 2004; Perez et al. 2008; Wyborn et al. 2004), ToxT at the ctx and tcpA promoters (Hulbert and Taylor 2002; Yu and DiRita 2002), HilC, HilD and RtsA at the rtsA promoter (Olekhnovich and Kadner 2007), and VirB at the icsB promoter (Turner and Dorman 2007). Results from few cases where H-NS displacement has been tested directly in vitro have not been consistent and support the notion that different mechanisms are at play at different promoters. VirB binding to the icsB promoter does not significantly alter the amount of H-NS from the promoter (Turner and Dorman 2007) nor does SlyA displace H-NS from the Salmonella pagC or ugtL promoters (Perez et al. 2008). SlyA does, however, displace H-NS from the hlyE promoter (Lithgow et al. 2007) and its close homolog RovA can effectively compete with H-NS for binding at the inv promoter (Ellison and Miller 2006).

At the promoters where H-NS is not significantly displaced by site-specific transcription factors it is inferred that subtle changes in the structure of the nucleoprotein complex must occur that enable RNAP to bind or form productive elongation complexes. At several promoters the binding of SlyA and RovA appear to alter the H-NS-DNA complex to allow other transcription factors to bind and subsequently interact with RNAP (Heroven and Dersch 2006; Navarre et al. 2005; Perez et al. 2008). The need for two separate functions has been demonstrated for many genes under the control of SlyA in Salmonella (Navarre et al. 2005; Norte et al. 2003; Shi et al. 2004). Microarray analysis revealed that the vast majority of SlyA-activated genes in Salmonella also require the PhoP/PhoQ two-component regulatory system for expression (Navarre et al. 2005). A recent analysis of the functional roles of PhoP and SlyA at the Salmonella ugtL and pagC promoters revealed that in the absence of H-NS, SlyA is dispensable and PhoP is capable of interacting with RNAP to activate transcription. In the presence of H-NS, however, PhoP is unable to exert a significant positive regulatory effect without SlyA (Perez et al. 2008). That some promoters have a regulatory hierarchy, where one factor is an H-NS antagonist while the other factor interacts with RNAP directly, may allow finer control in regulation either through the use of feed forward loops or by enabling multiple inputs to regulate activity.

Another anti-silencing mechanism has been invoked to explain the mechanism by which LeuO counters H-NS-mediated silencing at its own promoter (Chen and Wu 2005). In this model LeuO acts as a molecular boundary marker that blocks the spread of an H-NS-DNA filament that would otherwise encroach upon the leuO promoter. This model is supported by the observation that LeuO-mediated anti-silencing of a synthetic promoter containing a strong H-NS binding site is most apparent if the LeuO binding site lies between the H-NS nucleation site and the core promoter elements. The observed LeuO dependent activation was enhanced when two such promoters were placed on the same plasmid, suggesting a bridging (looping) mechanism was critical to establishing the boundary. This idea is further supported by experiments demonstrating that the LeuO binding sites can be functionally replaced with binding sites for LacI, another protein capable of looping DNA duplexes. It is important to note that the observations used to form this roadblock model are inferential and no direct demonstration of an H-NS filament being blocked from a promoter was performed (e.g. footprint analysis of H-NS-DNA complexes in the presence and/or absence of LeuO). Also, there are some aspects of the roadblock model that disagree with other aspects of what is known about H-NS. Recent data suggest that H-NS dimers each bind independently to DNA and the observed cooperative behavior is due to proximity of DNA strands, as opposed to filament formation due to direct lateral protein-protein interactions (Dame 2008; Dame et al. 2006). If true, then any molecule, such as LacI, that can bring two adjacent strands of DNA together might be expected to enhance H-NS binding and promote filament extension, rather than block it.

At some promoters the role of site-specific DNA binding proteins is limited to antagonizing H-NS and they appear to be completely dispensable for upregulating gene expression in the absence of H-NS (Perez et al. 2008; Westermark et al. 2000; Wyborn et al. 2004). Other site-specific H-NS antagonists can activate transcription even in the absence of H-NS (i.e., a positive effect of the transcription factor is observed in hns mutants) (Jordi et al. 1992; Murphree et al. 1997; Tran et al. 2005; Walthers et al. 2007; Yu and DiRita 2002). This suggests that they may not only alter the local nucleoid structure to disrupt H-NS mediated silencing but may also play a role in recruiting RNAP to the promoter. RNAP binding affects nucleoid structure however, and promoter strength can also play a role in overcoming H-NS mediated antagonism. For this reason it remains unclear whether transcription factors that recruit RNAP antagonize H-NS independently of their ability to recruit RNAP or whether their ability to bind to and enhance the activity of RNAP is a requisite step for their apparent anti-H-NS function. To address the relative contributions of binding vs. interaction with H-NS it may be useful to employ mutant activator proteins that retain their DNA binding ability but lack the ability to interact with RNAP (or vice versa with mutant RNAP). These types of experiments have been performed to analyze the roles RovA and RNAP each play at the invA promoter as well as the roles of IHF and RNAP at the phage Mu Pe promoter (Tran et al. 2005; van Ulsen et al. 1997a,b).

Ler

Ler, the LEE encoded r egulator, is an unusual example of an H-NS antagonist because it is itself an H-NS family member - the only one described thus far to have the ability to activate transcription. Among the H-NS like molecules Ler has most similarity to the Bordetella BpH3 molecule (Elliott et al. 2000). Ler is encoded on the locus of enterocyte effacement pathogenicity island (LEE) of enteropathogenic and enterohemmoragic E. coli (EPEC and EHEC, respectively) and is responsible for activation of genes contained within the island in response to certain environmental conditions. The LEE island encodes a type-III secretion system (T3SS) that is largely responsible for the attaching and effacing (AE) intestinal lesions caused by EPEC and EHEC (Caron et al. 2006; Kaper et al. 2004; Nougayrede et al. 2003). It is composed of several operons designated as LEE1 to LEE5, espG, and grlRA, as well as the EPEC specific genes map and escD (Mellies et al. 2007).

The regulation of the entire LEE island centers on control of the LEE1 operon, which encodes Ler. LEE1 is negatively regulated by H-NS as well as by Ler itself, presumably in a negative feedback loop to control its own expression levels (Berdichevsky et al. 2005). H-NS-mediated silencing of LEE1 occurs at 27°C and is anti-silenced at 37°C (Umanski et al. 2002). In addition to temperature, a large number of other environmental inputs play a role in the regulation of LEE, including quorum sensing, pH, calcium, iron, and ammonium. Accordingly, a similarly large number of proteins including Fis, IHF, GadX, BipA, GrlRA, PerC, and two phage-encoded proteins called Pch also play a role in controlling LEE expression, primarily through their effects on LEE1 (Abe et al. 2008).

H-NS also negatively regulates several other LEE operons including LEE2, LEE3 and LEE5 and grl and it is at these operons where Ler plays a positive role in gene expression by antagonizing H-NS mediated silencing (Barba et al. 2005; Bustamante et al. 2001; Haack et al. 2003; Sperandio et al. 2000; Umanski et al. 2002). Ler also positively regulates gene expression by antagonizing H-NS at chromosomal loci encoded outside LEE including the long polar fimbrial (lpf) locus (Torres et al. 2007). A recent ChIP-on-chip study of Ler binding sites in E. coli O157:H7 strain Sakai found 59 binding sites throughout the E. coli chromosome that distributed largely to the Sakai-specific genomic islands (S-loops) (Abe et al. 2008). The mechanism by which Ler antagonizes H-NS mediated silencing remains unclear as do the specific factors that play a role in determining whether Ler acts positively (e.g. LEE2, LEE3, LEE5 or negatively (e.g. at LEE1) on gene expression.

Recently, the group of Mellies has examined the functional domains of Ler that are necessary for transcriptional activation of the LEE5 promoter (Mellies et al. 2009). Ler has a significantly truncated N-terminal domain compared to H-NS that is predicted to lack the first two alpha helices and has an 11 amino acid extension at the C-terminal DNA binding domain. Mutagenesis and domain swap experiments where the N-terminal, C-terminal, and central domains were exchanged between Ler and H-NS were performed to determine if any of these structural differences are responsible for the phenotypic differences between the two molecules. Surprisingly, the 11 residue C-terminal extension was dispensable for Ler function and the N-terminal domain of Ler could be exchanged with its H-NS counterpart without significantly altering the ability of the molecule to activate expression at LEE5. The N-terminal domain of Ler is not dispensable, however, as mutations in this domain that abolish the ability of Ler to form dimers also abolish its activity to activate gene expression (Sperandio et al. 2000). Swapping either the C-terminal or linker domain with that of H-NS led to a strong reduction in the ability of the hybrid molecule to stimulate LEE5 expression. Further mutagenesis of the Ler linker and DNA-binding domains found these regions were essential for Ler activity (Mellies et al. 2008).

Together these studies indicate that Ler activity requires dimerization but that the exact sequence of the N-terminal dimerization domain is of lesser importance. The DNA binding properties of Ler are probably sequence-specific and differ from that of H-NS since its C-terminal domain cannot be swapped with that of H-NS. The domain swapping study did not test whether the Ler constructs with mutations in the linker domain retained their DNA-binding activity and footprinting and competition assays have yet to be carried out with these chimeras, leaving the exact role of the C-terminal and linker domains unclear. If mutations in Ler can be identified that retain DNA binding activity but fail to antagonize H-NS it may point to a novel mechanism by which H-NS can be antagonized.

H-NST and Dominant Negative H-NS molecules

H-NS N-terminal domains, when expressed alone without a C-terminal DNA-binding domain, have been shown to act in a dominant negative fashion, inhibiting H-NS mediated silencing presumably by interfering with the ability of H-NS to dimerize or form higher-order complexes (Banos et al. 2008; Ueguchi et al. 1996; Williams et al. 1996). It was therefore interesting when ORFs encoding proteins with similarity to H-NS N-terminal domains were identified in pathogenicity islands of some pathogenic E. coli strains (Williamson and Free 2005). These molecules have been designated H-NST, for H-NS “truncated”. The H-NST molecule encoded on the serU island of EPEC (H-NST_EPEC) could co-purify with endogenous H-NS and its expression led to significant upregulation of the proU and bgl operons, indicating that H-NST_EPEC is a bone fide H-NS antagonist. A similar H-NST from UPEC (H-NST_UPEC) was found to have much weaker activity and this was traced to a change in a single residue that diminished the ability of the protein to interact with H-NS. A recent study has found that H-NST_EPEC has the ability to also antagonize H-NS when expressed in Yersinia (Banos et al. 2008).

The existence of the H-NST like molecules as stable components of pathogenicity islands is somewhat surprising since their expression would be predicted to cause genome-wide dysregulation at several loci that would presumably lead to a fitness defect akin to what is observed in an H-NS mutant. Nevertheless, the fact that these proteins are expressed during log phase growth under laboratory conditions and the fact that H-NST molecules have persisted on more than one island over what appears to be a relatively long span of evolutionary time suggests that they indeed play a functional role in regulation.

Phage T7 5.5 Protein

In 1993, Liu and Richardson serendipitously found that 5.5, a small 11 kDa protein from coliphage T7 strongly associated with H-NS during their attempts to purify the phage protein (Liu and Richardson 1993). Expression of the 5.5 protein in E. coli leads to increased transcription at the proU locus and although no mechanism has been formally described for its activating function it appears to be necessary for full phage virulence. A mutant in 5.5 that abrogated the ability of T7 to grow on lambda lysogens abolished its interaction with H-NS, suggesting that the rbl (restricted by lambda) phenotype in this mutant may have something to do with its ability to antagonize H-NS. The genome of T7 is AT-rich, particularly in the promoters of the late genes that encode the head and tail proteins. It is tempting to speculate that a primary role of H-NS is to block phage replication via xenogeneic silencing and that the phage employs 5.5 to counteract this ability of H-NS. It is equally likely, however, that the phage simply uses H-NS for its own ends, perhaps to regulate its late promoters in order to coordinate timing of late protein synthesis to prevent premature synthesis of phage capsid proteins. This hypothesis is consistent with the fact that 5.5 is encoded in the “middle” (as opposed to early) operon and the fact that the phage “late” promoters are very AT-rich. Homologues of the 5.5 protein are found in the subset of T3/T7 phages that infect enteric bacteria but have been identified in no other phage groups sequenced thus far leaving it an open question whether other AT-rich phages employ mechanisms to counteract silencing by H-NS.

Temperature, Osmolarity and Their Effects on Promoter Activity and H-NS-Mediated Downregulation

Previously it was argued that H-NS does not respond in a simple and universal manner to environmental factors such as osmolarity and temperature. It is clear, however, that changes in these conditions play a direct and important role in counteracting or augmenting H-NS-mediated silencing at specific promoters. It has long been known that the geometric structure of DNA can be altered in response to conditions such as hydration, supercoiling, temperature, and osmolarity and that the specific changes that occur are sequence dependent. Given the apparent sensitivity of H-NS to changes in nucleoid structure that are induced by protein binding it may also be expected that changes in nucleoid structure in response to environmental conditions may also alter H-NS function at some promoters.

For many loci it remains unclear whether changes in gene expression are due to direct environmentally-induced perturbations in promoter structure or whether the response is due to upstream regulators that themselves respond to the specific environmental condition. Studies on the regulation of the H-NS regulated invasin (invA) gene of Yersinia revealed that under laboratory conditions invasin expression is maximal at 25°C and downregulated at 37°C. The cause of this thermoregulation was determined to be independent of temperature-mediated effects at the invA promoter, but rather due to the increased expression of the H-NS antagonist RovA at room temperature (Heroven et al. 2004). Expression of RovA is itself H-NS regulated which may indicate that temperature induced changes in H-NS-mediated silencing at the rovA promoter are involved in controlling a regulatory cascade for virulence gene expression (Heroven and Dersch 2006; Heroven et al. 2004). A similar regulatory cascade could be in place at the Salmonella ssrB gene, which controls the expression of numerous H-NS regulated virulence genes including the SPI-2 type-III secretion system. SsrB, like RovA, is an activator of H-NS silenced genes that is itself negatively regulated by H-NS (Walthers et al. 2007). Recent work has shown that SsrB expression is temperature dependent and is downregulated at room temperature in a manner that requires H-NS although the mechanism by which this occurs remains unexplored (Duong et al. 2007).

One case where temperature has been implicated as playing a direct role in altering H-NS-mediated silencing is at the virF locus encoded on the Shigella virulence plasmid (Prosseda et al. 1998, 2004). VirF positively regulates the structural gene icsA as well as another major plasmid-encoded virulence regulator in Shigella, VirB, each of which are themselves silenced by H-NS (Beloin and Dorman 2003). VirF is the first positive activator in the regulatory hierarchy that controls virulence gene expression in Shigella. The virF promoter is antagonized by Fis and H-NS through cooperative interactions with an intrinsically curved segment of DNA (Falconi et al. 2001; Prosseda et al. 2004). At room temperature the intrinsic bend and Fis cooperate to align two H-NS binding sites in an orientation that facilitates the formation of a repressive nucleoprotein complex. At elevated temperature the bend center shifts dramatically such that the two H-NS binding sites are mis-aligned and a repressive complex cannot be maintained.

The fact that temperature can directly affect the expression of a single H-NS-regulated gene product (e.g. RovA, VirF, and possibly SsrB), which in turn can antagonize H-NS at dozens of other genes, points out that it is important not to over-interpret the findings that many H-NS regulated genes are responsive to temperature. The response of any given H-NS-silenced locus to changes in temperature (e.g. invA, virB, SPI-2) is just as likely to be indirect. Unfortunately, determining if a given promoter is directly responsive to temperature is difficult and requires an intimate knowledge of the promoter structure and the complete set of regulatory factors to recapitulate temperature mediated regulation in vitro. A plausible model for temperature dependent regulation of the virF promoter came about only through extensive genetic and biochemical analysis. Even in cases where a change in H-NS affinity due to temperature can be demonstrated in vitro does not necessarily mean that the specific promoter will be temperature dependent in vivo (Badaut et al. 2002; Bouffartigues et al. 2007; Stoebel et al. 2008).

In summary, the above examples serve to highlight the fact that it is currently impossible to infer the mechanism by which any given H-NS antagonist works at one promoter given what is known about its function at another promoter. The degree and diversity of mechanisms by which H-NS-mediated silencing is antagonized argues against the existence of any “universal mechanism” for either silencing or anti-silencing. Further, the fact that no two promoters appear to be regulated in the same way underscores the ad hoc nature by which H-NS regulated genes integrate into their appropriate cellular regulatory networks during the evolutionary process (Stoebel et al. 2008).

Other Effects of H-NS on Lateral Gene Transfer and Mobile DNA

H-NS can also regulate mobile and xenogeneic DNA in contexts beyond its ability to silence expression of AT-rich genes. In numerous studies H-NS has been demonstrated to play a role in conjugation, recombination and transposition but there are no simple rules regarding its exact function in each process and H-NS-dependent phenotypes can differ dramatically even between seemingly closely related systems. This will be illustrated by the examples discussed below.

H-NS and Conjugation

Given its predilection to regulate genes obtained via LGT it may not be surprising that H-NS has been observed to play a role in regulating conjugal transfer of episomes. The transfer apparatus of the E. coli F-plasmid is under the control of at least three plasmid-encoded regulatory proteins: TraM, TraJ and TraY. In wild-type cells F-plasmid conjugation is strongly inhibited in stationary phase, in part due to H-NS. The promoters of traJ, traM and traY are all bound and silenced by H-NS and the regions bound by H-NS at the traJ promoter have been determined to be both curved and very AT-rich by DNAase I footprinting analysis (Will and Frost 2006; Will et al. 2004). Accordingly, F-plasmid transfer can occur well into stationary phase in hns mutants.

Another study on the F-like plasmid, pRK100 came to strikingly opposite conclusions about the role of H-NS and conjugal transfer (Starcic-Erjavec et al. 2003). H-NS binds the traJ promoter but, surprisingly, traJ expression is lower and plasmid transfer is decreased over 500-fold in hns mutants. This data indicates that H-NS plays a positive regulatory role in conjugal transfer of pRK100 but the mechanism by which it does is entirely unclear. It should be noted that mutations in Lrp also decreased expression of the traJ gene but did not similarly affect the level of conjugation, suggesting that the reduction of traJ synthesis in hns mutants does not entirely account for the observed defect in transfer. The data regarding H-NS and its role in pRK100 conjugation are unusual in many regards including a rare example of positive regulation. The findings also indicate that the role H-NS plays with regard to the F-plasmid cannot necessarily be extended to other closely related similar plasmids.

The conjugative IncH1 plasmid, R27, encodes proteins that are homologous to H-NS (ORF164) and Hha (ORF182) (Forns et al. 2005). Deletion of either one or both of these plasmid-encoded genes leads to an increase in conjugation frequency indicating that the plasmid encoded molecules are functional and play a negative regulatory role. Additional mutations in the chromosomal copies of either H-NS or Hha further increased conjugation suggesting significant functional redundancy. This redundancy is further supported by the fact that the H-NS and Hha-like proteins encoded on R27 could partially complement mutations in the chromosomal copies of hns and hha (Forns et al. 2005).

Positive and Negative Effects of H-NS on Transposition

H-NS has been found to be a host-factor that alters the activity or specificity of a number of transposable elements and insertion sequences. In the case of phage Mu H-NS appears to silence transposition whereas in other cases (IS1 and Tn10) it appears to be a necessary co-factor for the transposition reaction. A positive role for Hha in transposition has also been observed but not extensively characterized (Balsalobre et al. 1996; Mikulskis and Cornelis 1994). The mechanisms by which H-NS alters transposition differ with each specific example, suggesting that no simple rule can be applied when discussing the role of H-NS and its relationship to transposons.

Positive Effects of H-NS on Transposition

H-NS can facilitate transposition for at least four transposable elements: IS1, Tn5, Tn10, IS903 and Tn552 (Shiga et al. 2001; Swingle et al. 2004; Whitfield et al. 2009). The mechanistic details by which H-NS can facilitate transposition have been worked out in the most detail by David Haniford and colleagues studying the role of H-NS in Tn10 transposition. Over-expression of H-NS increases transposition approximately three-fold in papillation assays while transposition is severely impaired by overexpression of a P116S mutant derivative of H-NS or in hns mutants (Ward et al. 2007). Transposase binding to the terminal inverted repeats during formation of the initial transpososome leads to distortions in flanking donor DNA that may provide a high affinity site for H-NS binding. Subsequent interactions with transposase enzyme enable H-NS to bind DNA within the core of the transpososome (Ward et al. 2007). When bound in this way H-NS appears to play a role in maintaining the transpososome in an unfolded state, a conformation that promotes inter-molecular transposition reactions as opposed to self-destructive intramolecular transposition events (Singh et al. 2008; Wardle et al. 2005). H-NS has also recently been demonstrated to play a role in the correct folding and assembly of the Tn5 transpososome in vitro and is necessary for efficient transposition in vivo (Whitfield et al. 2009)

Tn5 and Tn10 serve as interesting examples of how a “selfish” mobile genetic element can co-opt a host molecule for its own ends. Perhaps H-NS was selected for this function due to its ability to bind certain structural features in DNA, notably the distortions that may occur at the transposon ends. It is also possible that its role in transposition is not only structural but also regulatory. Some transposons may gain the ability to sense certain conditions that are favorable for transposition by integrating into H-NS-dependent regulatory circuits (Haniford 2006). Given that most stresses that increase transposition are thought to decrease binding of H-NS (i.e. lead to activation of H-NS silenced genes) it is not exactly clear how such regulation would occur. Nevertheless, either hypothesis is intriguing and merits further exploration.

Another transposable element where the role of H-NS has been examined in some detail is IS1. Overexpression of the multisubunit IS1 transposase in wild-type E. coli leads to induction of the SOS response (Lane et al. 1994), a phenotype that is abolished in hns mutants (Rouquette et al. 2004; Shiga et al. 2001). Mutations in hns also lead to a 100-fold decrease in IS1 transposition. The defect appears to be primarily due to instability of the IS1 transposase in H-NS deficient cells as opposed to H-NS binding the transposon directly (Rouquette et al. 2004). Neither the C-terminal nor N-terminal domains of H-NS are necessary for IS1 transposition, which implicates the central flexible linker as playing a critical role for IS1 transposase stabilization (Shiga et al. 2001). The observed IS1 transposase instability, and the effects of an hns mutation, can be reversed in cells lacking the Lon protease and partially reversed in cells lacking the ssrA gene, encoding a factor that degrades mistranslated proteins (not to be confused with the SPI-2 encoded virulence regulator in Salmonella of the same name) (Rouquette et al. 2004).

Countering Transposition - Bacteriophage Mu

Bacteriophage Mu behaves like a transposon both when it integrates into the host genome and during the replicative (lytic) stage of its lifecycle. Mutations in hns were observed to lead to an increase in transposition of a Mu prophage defective for DNA packaging and lysis but still competent for transposition and replication (Falconi et al. 1991). The repressive effect H-NS has on Mu transposition may be due to its ability to repress the Mu early promoter (Pe) as observed both in vivo and in vitro (Kano et al. 1993; van Ulsen et al. 1996). H-NS binds a large segment of the Pe promoter and H-NS mediated repression is, in part, antagonized by IHF (van Ulsen et al. 1996). Therefore, in the case of bacteriophage Mu H-NS represses the lytic cycle not by acting on transposition directly, as it does for Tn10, but rather by silencing the expression of a set of genes required for the early stage of the Mu lytic cycle.

A Role for H-NS in Transposon Target Site Selection?

There is some compelling evidence that H-NS can play an important role in biasing the sites that transposons are targeted to. A recent genome-wide analysis of IS903 targeting revealed that mutations in hns not only decreased the total amount of transposition, but also dramatically altered the locations into which IS903 was targeted (Swingle et al. 2004). IS903 had an increased preference for intergenic regions on the chromosome in hns mutants, indicating that perhaps H-NS was altering the nucleoid structure of these regions in wild-type cells to make them less permissive for transposition. This study also produced some indirect evidence that target site selection for Tn10 was also altered in hns mutants. Interestingly Mu and IS1 each have separate well-defined insertion hot-spots immediately upstream of the bgl operon that disrupt a strong H-NS binding site and lead to the activation of the cryptic bgl locus, suggesting that H-NS dependent effects on nucleoid structure at this locus may create this hotspot (Manna et al. 2001).

H-NS and Site-Specific Recombination: Phase Variable Switching of the Type I Fimbriae

The type I fimbriae (pili) are an important virulence factor of many pathogenic strains of E. coli (Connell et al. 1996). Fimbrial expression is phase variable due to its control by a promoter region (fimS) that can switch between “on” and “off” orientations. This switching process involves a site-specific recombination reaction mediated by any one of a few different integrase family recombinases (Bryan et al. 2006; Klemm 1986). The two primary fim recombinases, FimB and FimE have different effects on fimS. FimB mediates either the “on-to-off” or “off-to-on” switching of fimS whereas FimE shows a strong bias toward switching fimS from “on-to-off”, but not the reverse (Klemm 1986). Under normal laboratory growth conditions in wild-type cells the activity of the FimE recombinase is dominant but the degree of bias can change in response to environmental factors including temperature (Gally et al. 1993).

It has long been known that H-NS plays a role in regulating the inversion of fimS, along with the nucleoid-binding proteins IHF and Lrp (Gally et al. 1993). Null mutant hns strains display elevated levels of switching, up to 100-fold higher than that observed for wild-type cells, rapidly reaching a steady state population that is almost equally balanced between cells in the “off” state and cells in the “on” state (Higgins et al. 1988; Kawula and Orndorff 1991; Spears et al. 1986). The effect of H-NS on fimS switching appears to be due to multiple factors including the fact that FimB expression is silenced by H-NS (Donato and Kawula 1999; Donato et al. 1997). Furthermore H-NS may make a nucleoprotein complex at fimS that biases switching toward the “off” state and the effects of this switch (O’Gara and Dorman 2000). Evidence suggests that the ability of H-NS to affect fimS directly depends in part on active transcription within and adjacent to the fimS locus, implying that local nucleoid structure (i.e. transient changes in accessibility or supercoiling due to transcription) mediates H-NS binding or function at this locus.

In the enteric bacteria the expression of fimbriae and flagella almost never occur simultaneously as the role of each are mutually incompatible (“stick vs. swim”). In that regard it is notable that H-NS is a primary negative regulator of fimbrial expression but acts in a positive fashion on the expression of flagella. At least part of the H-NS-dependent reciprocal regulation of flagella and fimbriae is due to the fact that a fimbrial gene product PapX represses the flagellar genes by antagonizing the flhDC promoter (Lane et al. 2007). Derepression of fimbrial papX like genes may explain why hns mutants are deficient for motility.

What We Can Learn from H-NS Phylogeny

Unlike the HU proteins and the SMC complex proteins (eg. MukBEF in E. coli), which are widespread in the eubacteria, the H-NS like molecules are not widely distributed among bacterial species and identifiable homologues are found only in certain members of the α-, β- and γ-proteobacteria (Tendeng and Bertin 2003). Furthermore the diversity in primary sequence among the various H-NS family members can be unusually high when compared to the relatedness of the species. For example the two H-NS-like molecules of Pseudomonas aeruginosa, MvaT and MvaU, share only ∼18% identity with E. coli H-NS despite the fact that both bacteria are γ-proteobacteria (Tendeng et al. 2003b). In contrast, Fis, HU, DNA gyrase, RNAP subunits, and TCA enzymes of Pseudomonas aeruginosa PAO1 and E. coli strain K12 all share approximately 60% identity between the two species (Blattner et al. 1997; Riley et al. 2006; Stover et al. 2000). The reasons underlying the relatively radical divergence between H-NS and MvaT/MvaU are unclear but these findings suggest that the H-NS like molecules may be under strong selective pressure to change. Interestingly the highest level of conservation is found in the C-terminal DNA binding domain, presumably because this region is constrained to maintain its DNA binding function while, in comparison, multimerization domains have considerably greater ability to alter sequence without disrupting function.

It is likely, although unproven, that H-NS plays a role in defense against phages and transposons and this may place a strong selective pressure on this family of molecules to diverge in their primary sequence. Most phage genomes are relatively AT-rich compared to their respective hosts and, as discussed in an earlier section, several T7 phages encode “5.5 proteins” that serve as H-NS antagonists (Liu and Richardson 1993; Rocha and Danchin 2002). Examination of the T7-like phages reveals no 5.5 close homologue is present in any of the T7 phages that infect Pseudomonas. It is unclear if these phages have modified their antagonist to counteract silencing by MvaT/MvaU to such a degree that it cannot be identified through homology, or if they simply have no functional equivalent to this protein.

In addition to the relatively high sequence variability found among H-NS family members, the number of H-NS-like molecules harbored by different proteobacterial species can vary widely from 1 for Yersinia sp. and Haemophilus sp. to eighteen for Burkholderia vietnamiensis strain G4 (Tendeng and Bertin 2003). The reasons why some species harbor an abundance of H-NS like molecules are unclear. However most species only harbor one to three H-NS paralogues that are common to all members (e.g. H-NS and StpA for E. coli) with the remainder encoded on or near mobile genetic elements and pathogenicity islands (e.g. Sfh, Ler, H-NST). B. vietnamiensis strain G4, harbors three chromosomes and five smaller plasmids. Two of the chromosomes (1 and 2) are highly homlogous to the chromosomes of all Burkholderia sp. while the third chromosome is considered a “mega-plasmid” with a highly mosaic structure that shares almost no homology to any other chromosome found in bacteria, including other members of Burkholderia. Chromosomes 1 and 2 encode three H-NS molecules that are highly conserved and universally present in all Burkholderia. In contrast, the third chromosome encodes nine H-NS-like proteins while the remaining six are distributed among the smaller plasmids. Given their high degree of conservation it is likely that the three H-NS-like proteins encoded on chromosomes 1 and 2 serve a central role in gene regulation or chromosomal compaction. The functions of the other fifteen H-NS homologs, which may be only transient residents of the strain G4 genome, can only be speculated at this point.

Although much can be learned through the analysis of species that encode many H-NS homologs it is also informative to note which species have lost H-NS. The only members of the enteric bacterial species that do not encode an H-NS like molecule are the endosymbionts Buchnera aphidicola and Blochmania floridanus species that diverged from their common ancestor with E. coli approximately 50-100 MYr ago by establishing residence in the cells of aphids and carpenter ants, respectively (Gil et al. 2003; Tamas et al. 2002). These endosymbionts diverged from a common ancestor to the enteric lineage at approximately the same time as E. coli, Yersinia and Salmonella each arose (approximately 50-150 MYr ago). Because of their restricted niche Buchnera and Blochmania have small genomes that, like the genomes of all endosymbionts, are also markedly AT-rich (∼25% GC). Due to their long-term sequestration inside of a eukaryotic host cell Buchnera and Blochmania have lost all contact with the outside microbial world. One possible interpretation of these combined observations is that in the absence of a “social” lifestyle, H-NS can become dispensible. Furthermore it suggests that maintaining an elevated genomic GC-content, like many free-living bacteria do, may be an investment that is made to facilitate the recognition of foreign sequences (Navarre et al. 2006).

Functions of H-NS-Like Proteins

With the exception of StpA there is very little known about the function of other H-NS-family members. The few paralogs that have been examined to date have been shown to functionally complement phenotypes such as motility, serine sensitivity, or salicin utilization when ectopically expressed in E. coli hns mutants but virtually nothing is known about the role of most of these proteins in their natural context (Tendeng et al. 2000, 2003a,b; Tendeng and Bertin 2003). Such screens are informative and have provided important information however some phenotypes of hns mutants can be complemented with proteins that likely have nothing to with nucleoid structuring or xenogeneic silencing including the kin17/btcd, a zinc finger DNA-binding protein in mammals that has no significant primary amino acid homology to H-NS yet can complement an hns mutation in E. coli (Timchenko et al. 1996; Tissier et al. 1996). The kin17 protein is stress-activated and appears to be involved in DNA replication in mammalian cells (Masson et al. 2003). Whether kin17 has any functional equivalence to H-NS in its native context has not been addressed.

Progress has been made in our understanding of the functions of a handful of H-NS family members in their natural context and a few important examples are highlighted below (with the exception of Ler, which was discussed in Section 13.9.5).

StpA - An H-NS Paralogue with a Unique Function?

The genomes of several enteric bacteria including Salmonella, Escherichia and Shigella (but not Yersinia) encode a second H-NS paralogue, StpA, with ∼58% identity to H-NS and very similar domain structure (Cusick and Belfort 1998; Williams et al. 1996; Zhang and Belfort 1992). Like H-NS, StpA is capable of constraining supercoils and bridging DNA with a preference for AT-rich sequences with planar curvature (Ali Azam et al. 1999; Dame et al. 2000, 2005; Zhang et al. 1996). StpA is a competent DNA binding protein that has four- to six-fold greater DNA binding affinity than H-NS for at least one prototypical H-NS target (Sonnenfield et al. 2001). Structural similarity between StpA and H-NS is supported by the fact that antibodies against StpA can also bind H-NS (Ali Azam et al. 1999; Sonnenfield et al. 2001) and the fact that StpA is capable of interacting with H-NS through its N-terminal dimerization domain (Cusick and Belfort 1998; Deighan et al. 2003; Johansson et al. 2001; Williams et al. 1996). StpA is stable in wild-type cells but is rapidly degraded by lon protease in the absence of H-NS, an effect that is exacerbated further in the absence of YdgT or Hha (Johansson and Uhlin 1999; Paytubi et al. 2004). Its stability can be greatly enhanced by a specific mutation within the StpA N-terminal domain (F21C) (Johansson et al. 2001). StpA is also stabilized in hns mutants when co-expressed with the N-terminal dimerization domain of H-NS containing residues 39-60. Together these facts suggest that the ability of StpA to form heterodimers with H-NS is physiologically relevant and occurs in the cell under normal conditions (Johansson et al. 2001; Johansson and Uhlin 1999).

ChIP-chip analysis of StpA binding throughout the E. coli chromosome has been performed both in the presence or absence of H-NS (Uyar et al. 2009). In wild type E. coli cells the binding profiles of epitope-tagged H-NS and StpA were virtually superimposable and deletion of stpA resulted in no significant change in the binding profile of H-NS. However, deletion of hns resulted in a severe reduction in the number of regions bound by StpA, with approximately two-thirds of the StpA-bound regions requiring H-NS for binding. It remains unclear why StpA binding was altered at specific locations in the absence of H-NS, however heterodimer recruitment is one possibility (i.e. that StpA association with certain regions only occurs with H-NS/StpA heterodimers). Another possibility is that local nucleoid changes induced by the absence of H-NS caused a decrease in the affinity of StpA for certain regions of the chromosome. The observed binding differences, however, do not appear to be due to StpA stability as the loss of binding for specific sites in hns mutants was observed even for the more stable F21C StpA mutant.

The function of StpA remains unclear since few, if any, phenotypes have been attributable to stpA mutants that contain a wild-type copy of hns (Bertin et al. 2001; Zhang et al. 1996). This is due in part to the fact that expression of StpA mRNA is fairly low in wild-type cells under most conditions, but its expression is enhanced approximately 20-fold in H-NS mutants (Sonnenfield et al. 2001). As might be expected given the similar binding profiles of H-NS and StpA, StpA overexpression from plasmid vectors can complement several phenotypes of hns mutants including silencing arginine decarboxylase, proU, bgl, the synthetic 5A6A galP1 promoter, and hns (Johansson et al. 2001; Shi and Bennett 1994; Williams et al. 1996; Zhang et al. 1996), but under the control of its native promoter it is only capable of compensating for a subset of H-NS dependent phenotypes (Free and Dorman 1997; Wolf et al. 2006). Because of its instability in the absence of H-NS, StpA protein does not accumulate in hns mutants beyond 10% of the levels observed for H-NS in wild-type cells, which may partly account for the mild effects observed in stpA mutants (Sonnenfield et al. 2001). Due to its negative regulation by H-NS and the fact it can complement hns mutant phenotypes it has been proposed that StpA may serve as a molecular “backup” for H-NS (Sonnenfield et al. 2001). Since H-NS expression is more or less constitutive it remains unclear what the necessity for such a backup system would be (Free and Dorman 1995).

There is some evidence that points to a function for StpA outside of being an H-NS backup. Although phenotypes for stpA mutants can be observed in the absence of H-NS (Deighan et al. 2000; Johansson and Uhlin 1999) it is apparent that stpA hns double mutant phenotypes are not always a simple exacerbation of hns phenotypes (Bertin et al. 2001). Further complicating matters, the effect of StpA on certain hns mutant phenotypes, like an effect on bgl expression, greatly depend on the particular mutant allele of hns being studied and this relates to the ability of StpA to interact with the mutant H-NS protein (Dersch et al. 1994; Free et al. 1998, 2001; Johansson et al. 2001; Ohta et al. 1999; Wolf et al. 2006). As outlined in Table 13.1, several H-NS mutants have been isolated that upregulate expression at the proU locus but only a have minimal effect on the bgl locus (Dersch et al. 1994; Ueguchi et al. 1996, 1997). Similar allele dependent effects have been observed for cold-sensitivity, mucoidy, and the regulation of various promoters (Free et al. 2001). The specific class of hns mutants that retain partial function lack DNA binding ability but retain a functional N-terminal domain capable of interacting with StpA. Studies have revealed that the truncated H-NS N-terminal domain interacts with StpA to silence the bgl operon with the StpA protein acting as the module that supplies the missing DNA-binding function (Free et al. 2001; Wolf et al. 2006). However, when the N-terminal domain of H-NS is expressed at very high-levels some repressive effects can be oberserved even in the absence of StpA by an unknown mechanism perhaps involving σ^S and Crl (Free et al. 2001; Ohta et al. 1999; Schnetz 2002). The role of the H-NS N-terminal domain in coordinating bgl silencing with StpA remains unclear but experiments suggest that the effect is not entirely by enhancing the stability of StpA (Wolf et al. 2006). Instead it appears that the N-terminal H-NS domain may alter StpA-nucleoprotein complex in a manner that facilitates silencing at the bgl operon. This result is somewhat surprising given that overexpression of H-NS N-terminal domains usually leads to anti-silencing at H-NS regulated promoters and also StpA-mediated silencing at some promoters (Williams et al. 1996). The effect that H-NS interaction has on StpA gene regulation is specific for a subset of promoters and does not seem to be required for silencing of the stpA promoter, for example (Wolf et al. 2006).

Table 13.1 Mutations in hns and some of their reported phenotypes

Full size table

Experiments using mutants that generate truncated H-NS molecules are highly artificial and give very little information as to the possible role of StpA in wild-type cells. StpA expression is enhanced during the SOS response and is also affected by growth phase, supercoiling, temperature, osmolarity, and Lrp, suggesting it may play a role in regulating adaptation or stress resistance but the pathway by which it would do so is unclear (Deighan et al. 2003; Sonnenfield et al. 2001). StpA was originally isolated as a protein that, when overexpressed, could suppress a splicing-defective phage T4 td intron mutant in vivo. In vitro analysis revealed that it can act as an RNA chaperone that enhances td intron splicing by preventing RNA misfolding and promoting formation of the active self-splicing intron through interactions via its C-terminal domain (Cusick and Belfort 1998; Zhang and Belfort 1992; Zhang et al. 1995, 1996). Both H-NS and StpA have been shown to bind RNA in vitro although StpA has a markedly higher affinity for RNA and is a much better chaperone for the td intron than H-NS (Brescia et al. 2004; Cusick and Belfort 1998; Zhang et al. 1996).

Although there is little evidence that StpA facilitates T4 td intron splicing during phage infection of wild-type cells, some evidence points to a potential role for StpA as an effector of RNA stability in another context. H-NS and StpA have each been implicated as playing a role in modulating RNA stability to control the expression of genes involved both in adaptation and stress resistance (Brescia et al. 2004; Deighan et al. 2000; Graeme-Cook et al. 1989; Suzuki et al. 1996). H-NS has been shown to also have RNA chaperone activity and may be directly involved in altering the stability of the rpoS message (Brescia et al. 2004). StpA can destabilize the small micF RNA involved in preventing the expression of the ompF transcript, although this effect was not observed in the presence of wild-type H-NS (Deighan et al. 2000). Transcription of MicF RNA expression is silenced by H-NS but activated by several regulators in response to a variety of stresses including antimicrobial peptides, oxidative stress, weak acids and changes in osmolarity (Delihas and Forst 2001). A role for StpA as a chaperone of small RNAs may explain the finding that silencing of the arginine decarboxylase gene in hns mutants can be restored by overexpression of either StpA or the small RNA binding protein Hfq (Shi and Bennett 1994). Studies attempting to delinate StpA function may be confounded by the fact they were generally carried out in hns mutants or using purified StpA protein, neither of which may be biologically relevant given the data that suggests StpA exists as an H-NS/StpA heterodimer in vivo.

Sfh - A Protein That Aids Transmission of Mobile Genetic Elements

As alluded to in earlier sections, several conjugative plasmids have been identified that encode H-NS and/or Hha homologues including the IncM plasmid R446, the IncN plasmid R46/pKM101, and members of the IncHI1 family of R27-like plasmids (Tietze and Tschäpe 1994). The most well studied plasmid-encoded H-NS homologues are the Sfh (S higella f lexneri H-NS-like protein) of plasmid pSF-R27 from Shigella flexneri 2a strain 2457T and the nearly identical ORF162 from the R27 plasmid of Salmonella enterica serovar Typhi (S. typhi) (Beloin et al. 2003; Forns et al. 2005). In terms of primary sequence these proteins actually bear a closer resemblance to StpA than to H-NS (Beloin et al. 2003). Like StpA, Sfh is capable of restoring wild-type expression of proU and fliC and complementing Bgl, mucoidy, and porin protein expression phenotypes when expressed in E. coli hns mutants. A similar backup function has been observed for ORF162 encoded on the R27 plasmid for S. typhi (Forns et al. 2005). The functional equivalence of Sfh has further been demonstrated by the fact that the Sfh N-terminal domain can form heterodimers with StpA or H-NS in yeast two-hybrid assays (Deighan et al. 2003). StpA can both transcriptionally regulate and be regulated by other H-NS family members although in wild-type cells it appears to have little effect on expression of endogenous H-NS. Regulation of Sfh is highly unusual in that transcript levels are highest during logarithmic growth but protein does not accumulate at appreciable levels until early stationary phase (Deighan et al. 2003). The underlying mechanism behind the reciprocal regulation of Sfh expression is unclear but it seems to involve a blockade of Sfh translation during log phase growth that is relieved during Shigella entry into stationary phase (Doyle and Dorman 2006).

Given that plasmid-encoded H-NS-like molecules are frequently associated with conjugative plasmids, and the fact that H-NS can regulate conjugation in many systems (see Section 13.10.1), it is possible that one role of Sfh is to regulate the conjugative apparatus of pSF-R27. The plasmid-encoded homologs may enable proper regulation if the plasmid transfers to a cell that lacks H-NS or they may respond to certain environmental conditions that the endogenous H-NS molecules do not. This idea is supported by the finding that deletion of either ORF162, the R27 encoded H-NS homologue of S. typhi, or ORF181 (an R27 plasmid encoded Hha homologue) greatly increases conjugation frequency at elevated temperatures (Forns et al. 2005). The effects of deleting ORF162 and ORF181 are insignificant at 25°C, where conjugation frequencies are already elevated. However, the finding that plasmid encoded H-NS homologues have a function that cannot necessarily be replaced by H-NS suggests that there may be subtle differences between H-NS and the plasmid encoded H-NS-like molecules.

A different hypothesis has recently been advanced to explain why mobile genetic elements encode H-NS-like molecules. Doyle et al. observed that transfer of pSF-R27 lacking sfh to S. typhimurium strain 14028s had a profound effect on the Salmonella transcriptome, altering the expression of over 400 genes while transcription of fewer than 100 Salmonella genes were affected by transfer of the wild-type plasmid (Doyle et al. 2007). The affected genes covered a broad range of physiological categories and a surprisingly large number were involved in adaptation and stress resistance. Accordingly, the Salmonella strain harboring the Δsfh plasmid demonstrated enhanced UV resistance and an increased ability to survive in cultured J774 macrophages. Salmonella harboring the Δsfh plasmid displayed a significant fitness defect during growth in liquid media compared to wild-type strains. A small number of H-NS silenced genes were misregulated in the presence of the Δsfh plasmid and bacterial motility was severely reduced. Importantly, all of these phenotypes could be relieved by providing sfh or hns or by augmenting expression of H-NS. In another experiment it was found that a very high copy number plasmid harboring the ssrA promoter also caused a fitness defect compared to wild type and this fitness defect could be relieved by augmented expression of either Sfh or H-NS as well.

These findings led to the hypothesis that the fitness and motility defects observed in the Salmonella strain harboring the mutant plasmid were due to a titration of the endogenous cellular pools of H-NS (Doyle et al. 2007). Further experimentation is necessary to address several potential issues with the titration model. First, the majority of the Salmonella genes whose expression was altered upon introduction of the Δsfh plasmid were not identified as H-NS-regulated in other studies and many known H-NS regulated genes were unaffected. Many of the genes found to be altered were involved in stress resistance suggesting that Δsfh plasmid may have more to do with an adverse alteration of cell physiology than on titration of H-NS per se (Doyle et al. 2007). A possible role for Sfh in preventing stress during conjugal transfer is consistent with findings that conjugative plasmids have been shown to induce transient stress responses including the SOS response, particularly in the recipient cell (Althorpe et al. 1999; Bailone et al. 1988; Golub et al. 1988). Second, expression of H-NS is autoregulated and it is unlikely, though possible, that H-NS cannot increase its production to compensate for the relatively small amount of AT-rich sequence carried by the low-copy pSF-R27 plasmid (Dersch et al. 1993; Falconi et al. 1991; Free and Dorman 1995; Ueguchi et al. 1993). Third, many naturally occurring plasmids that lack H-NS homologues have no apparent fitness defect on the cell, although no detailed analysis has been performed to correlate the amount of AT-rich sequence present on a plasmid to the likelihood that it encodes an H-NS-like protein. Finally, although the Δsfh plasmid had strong effects on the transcriptome when transferred to Salmonella, the Δsfh mutation has little, if any effect on virulence gene expression in Shigella, suggesting that the observed fitness defect may be species/strain specific or due to the altered expression of another factor present on the plasmid (Beloin et al. 2003; Deighan et al. 2003). A complete transcriptional profile has not been performed for the Δsfh strain of Shigella, however, and it is possible that changes in the expression of many genes were not detected. Regardless of the specific mechanism, it is clear the Sfh protein can buffer fitness defect due to the presence of pSF-R27 and therefore plasmid-encoded H-NS like molecules likely have profound consequences in enabling conjugative plasmids to propagate themselves among varied bacterial populations.

Pseudomonas MvaT/MvaU

MvaT and MvaU (MvaT2) are paralogous DNA-bridging proteins in Pseudomonas species that have both structural and functional similarity to H-NS despite sharing less than 20% identity with H-NS in primary sequence (Dame et al. 2005; Tendeng et al. 2003b). MvaT expression in E. coli hns mutants restores motility and growth on minimal media supplemented with serine and blocks the ability of hns mutants to utilize salicin as a sole carbon source (Tendeng et al. 2003b). MvaT has been shown to be a negative regulator of the chaperone usher pathway (cup) clusters that encode pili essential for the formation of biofilms (Vallet et al. 2004), genes involved in quorum sensing and virulence including rpoS and lecA (Diggle et al. 2002, 2003), as well as the mexAB-oprN operon encoding a drug pump involved in resistance to chloramphenicol, imipenim and norfloxacin (Westfall et al. 2006).

The diversity of mvaT phenotypes and its involvement in quorum sensing led to the speculation that MvaT was a global regulator of gene expression (Diggle et al. 2002). However, in contrast to what has been observed with H-NS, microarray analysis of Pseudomonas aeruginosa mvaT mutants found that the number of genes under control of MvaT is relatively small; approximately 100 genes very few of which demonstrate greater than 5-fold downreglation by MvaT (Vallet et al. 2004). Recent findings have determined that a primary reason that Pseudomonas mvaT mutants are not as phenotypically remarkable as hns mutants in the enteric bacteria is that MvaT and MvaU share very strong functional redundancy. While mutations in either mvaT or mvaU are tolerated relatively well by P. aeruginosa, they are lethal for the bacteria when combined (Castang et al. 2008). ChIP-on-chip experiments to determine the genome-wide binding sites for MvaT and MvaU have revealed nearly complete overlap in their respective binding profiles including a strong preference for AT-rich patches in the genome that is highly reminiscent of what has been determined for H-NS. These findings suggest that MvaT and MvaU play a role in the silencing of xenogeneic genes in Pseudomonas sp. although this has yet to be formally demonstrated.

Bordetella BpH3

BpH3, the first H-NS-like molecule discovered outside of the Enterobacteriaceae, was originally isolated from Bordetella pertussis as a 16 kDa DNA-binding protein through southwestern blotting analysis (Goyard 1996). BpH3 is approximately 30% identical to H-NS with the strongest homology occurring within the C-terminal domain (Goyard and Bertin 1997). Expression of BpH3 in an E. coli strain lacking H-NS restores motility and high-level expression of the flhDC and bgl operons (Goyard and Bertin 1997). Competetive gel retardation assays show that, like H-NS, BpH3 displays higher binding affinity for the bla and flhDC promoter fragments compared to other sequences contained within expression plasmids (Goyard and Bertin 1997). Homologues of BpH3 are present in B. bronchiseptica (BbH3) and B. parapertussis but the function of these proteins in their native context has not been explored.

Mycobacterial Lsr2

Lsr2 is a small and basic DNA-binding protein conserved among the Mycobacteria and Actinomycetes. Although it bears no sequence similarity to H-NS, recent evidence suggests that Lsr2 is a pleiotropic regulator that shares several properties in common with H-NS. Mycobacterium smegmatis lsr2 mutants display a smooth colony morphology, enhanced sliding motility, incrased phage resistance, and an altered ability to form biofilms (Arora et al. 2008; Chen et al. 2006; Colangeli et al. 2007; Kocincova et al. 2008). These defects may be due, in part, to an alteration in surface lipids including a loss of mycolyl-diacylglycerols (Chen et al. 2006), an increase in glycopeptidolipids (Kocincova et al. 2008), or an increase in another unidentified polar lipid (Colangeli et al. 2007), although these findings have been somewhat controversial and may be strain specific (Arora et al. 2008). Lsr2 has further been implicated as a repressor of the iniBAC genes involved in mycobacterial drug resistance and, indeed, loss of Lsr2 leads to increased resistance to ethambutol (Colangeli et al. 2007) and kanamycin (Arora et al. 2008).

Lsr2 exists as a homodimer that can bridge DNA in a manner that suggests cooperativity and appears to share a basic domain structure similar to that of H-NS (Chen et al. 2008). In vitro binding studies indicate that supercoiled DNA is a preferred target over linear templates, but that curved DNA is not preferentially bound over non-curved sequences (Chen et al. 2008; Colangeli et al. 2007). Microarray analysis suggests that Lsr2 acts primarily as a negative regulator and that most targeted genes have distinctly AT-rich 5′ untranslated sequences (Colangeli et al. 2007). Highlighting the fact that H-NS and Lsr2 may be functionally equivalent it has recently been shown that expression of H-NS can restore wild-type colony morphology in M. smegmatis lsr2 mutants and that Lsr2 expression in E. coli hns mutants restores motility and represses hemolysis and expression of the bgl operon (Gordon et al. 2008). Chromatin immunoprecipitation analysis of Lsr2 binding in E. coli hns mutants reveals that AT-rich genes are specifically targeted and that overexpression of SlyA, which antagonizes H-NS at the hlyE promoter, is also able to counteract Lsr2-mediated repression at the hlyE locus.

The fact that Lsr2 bears considerable functional correspondence to H-NS without sharing any similarity in the primary sequence is exciting on many levels. It suggests that the universe of “H-NS like” molecules may be significantly larger than has been revealed through phylogenetic analysis based on sequence similarity. It remains to be determined if the common functionality of Lsr2 and H-NS is the result of convergent evolution and whether species other than the high-GC Gram-positive bacteria and the subset of α-, β- and γ-proteobacteria have DNA-bridging proteins that can target AT-rich sequences in a non-sequence specific manner.

Directions for the Future/Unanswered Questions

For all that we now understand about H-NS, how it binds to DNA, and the genes under its control it is striking how many aspects of the basic features of this molecule remain controversial or completely unknown. This is not due to a lack of effort on the part of many groups, but rather it reflects the fact that the data obtained from different methods have been at times completely contradictory. Although the recent availability of both high-throughput and single molecule studies have greatly improved our understanding of H-NS the molecule has stubbornly resisted all attempts to clarify many of its important features. I list a few of the remaining unresolved areas below:

Orientation of the dimerization domain: The H-NS dimerization domain has been reported to be arranged in either a parallel or anti-parallel (handshake) fashion depending on the particular study. This discrepancy is remarkable given that the basic structures of the H-NS monomers are similar in both reported structures. Is it possible that both interpretations are correct? One study has proposed that the functional unit is a tetramer with the four molecules arranged in a combination of anti-parallel and parallel orientations (Stella et al. 2005). This hybrid model seems unlikely since critical residues involved in dimerization in the parallel structure are also critical for formation of the anti-parallel structure. Furthermore the dimer surfaces in the two proposed arrangements are predicted to be negatively charged which also would appear to refute the idea that a tetramer of this nature is possible.

Mechanism of cooperativity: We still have no clear mechanistic understanding of the mechanism by which cooperativity is achieved. Most reports using traditional biochemical techniques suggested H-NS dimers interact with one another to make higher order complexes such as tetramers or longer filaments. Recent experiments with the Q-trap suggest that the functional unit is solely a dimer and that apparent cooperativity may be merely a function of the fact that the first binding event brings the strands closer together, thereby lowering the entropic barrier to subsequent binding events (Dame et al. 2006). This model is also supported by the structural study of the dimerization domain performed by Bloch et. al., which suggested that the higher-order H-NS complexes observed in solution are merely non-specific aggregates (Bloch et al. 2003). A combined use of Q-trap and previously defined mutants in the oligomerization domain may be informative in determining whether higher-order H-NS complexes actually form through protein-protein interaction when bound to DNA.

Mechanism of binding and silencing: It remains unclear what sequence elements are specifically recognized by H-NS. Does H-NS specifically target a limited set of conseunsus sequences such as the consensus recently derived from proU or does it recognize more general features including curvature or AT-richness? Some studies have suggested that H-NS has the ability to bind DNA in both a specific and non-specific manner, but is the “non-specific” mechanism truly relevant in vivo? There are also indirect observations that suggest bridging itself may not be the universal mechanism by which H-NS binds DNA and some evidence suggests there may be a second mode whereby H-NS binds without bridging adjacent strands. Would this non-bridging mode of binding differ in resulting regulation or ability to constrain supercoils?

The origins and functions of H-NS homologues: H-NS-like molecules have a bizarre distribution among Gram-negative bacterial species and they are often located on mobile genetic elements or conjugative plasmids. Does H-NS act as a silencer in most cases or, as in the case of Ler, do many of these molecules have the ability to bind specific sequences to carry out specific functions at a limited set of genes? Is it safe to assume that H-NS paralogues have functions other than acting as a “backup” for H-NS and, if so, what are the biological functions of StpA and H-NS-like molecules that are plasmid encoded? Does the high degree of sequence diversity between H-NS homologues indicate there has been an evolutionary arms race between mobile genetic elements and phages against H-NS?

The role of Hha-like molecules: In the Enterobacteriaceae it is clear that the Hha-like molecules play an important role as a co-factor that allows H-NS to effectively silence expression from large numbers of genes. We currently lack any understanding of the underlying mechanism behind this phenomenon and do not know which loci are directly Hha-regulated and which effects are indirect. Chromatin immunoprecipitation studies should help in this regard but will likely leave unresolved the question of how and why Hha-like molecules facilitate silencing, why they share so much functional redundancy, and why their distribution is limited to the Enterobacteriaceae.

It is clear that the answers to many of these questions will not be uncovered without the development of new tools or through the application of significantly new approaches. Just the few examples explored in detail thus far, such as the bgl and proU operons, reveal that higher-order promoter geometry plays an important role in determining whether H-NS/Hha will be effective in silencing. Significant understanding of the silencing mechanism will not occur without the ability to visualize promoter geometry directly and under conditions that effectively mimic those found in vivo. Recent advances in single (or dual) molecule manipulation in conjuction with the use of the well-defined promoter and protein mutations that were uncovered with more traditional approaches will hopefully shed some light on these important biological issues.

References

Abe H, Miyahara A, Oshima T, Tashiro K, Ogura Y, Kuhara S, Ogasawara N, Hayashi T, Tobe T (2008) Global regulation by horizontally transferred regulators establishes the pathogenicity of Escherichia coli. DNA Res 15:25-38
CAS PubMed Google Scholar
Ali Azam T, Iwata A, Nishimura A, Ueda S, Ishihama A (1999) Growth phase-dependent variation in protein composition of the Escherichia coli nucleoid. J Bacteriol 181:6361-6370
CAS PubMed Google Scholar
Althorpe NJ, Chilley PM, Thomas AT, Brammar WJ, Wilkins BM (1999) Transient transcriptional activation of the Incl1 plasmid anti-restriction gene (ardA) and SOS inhibition gene (psiB) early in conjugating recipient bacteria. Mol Microbiol 31:133-142
CAS PubMed Google Scholar
Altuvia S, Almiron M, Huisman G, Kolter R, Storz G (1994) The dps promoter is activated by OxyR during growth and by IHF and sigma S in stationary phase. Mol Microbiol 13:265-272
CAS PubMed Google Scholar
Amit R, Oppenheim AB, Stavans J (2003) Increased bending rigidity of single DNA molecules by H-NS, a temperature and osmolarity sensor. Biophys J 84:2467-2473
CAS PubMed Google Scholar
Amit R, Oppenheim AB, Stavans J (2004) Single molecule elasticity measurements: a biophysical approach to bacterial nucleoid organization. Biophys J 87:1392-1393
CAS PubMed Google Scholar
Arnqvist A, Olsen A, Normark S (1994) Sigma S-dependent growth-phase induction of the csgBA promoter in Escherichia coli can be achieved in vivo by sigma 70 in the absence of the nucleoid-associated protein H-NS. Mol Microbiol 13:1021-1032
CAS PubMed Google Scholar
Arora K, Whiteford DC, Lau-Bonilla D, Davitt CM, Dahl JL (2008) Inactivation of lsr2 results in a hypermotile phenotype in Mycobacterium smegmatis. J Bacteriol 190:4291-4300
CAS PubMed Google Scholar
Atlung T, Hansen FG (2002) Effect of different concentrations of H-NS protein on chromosome replication and the cell cycle in Escherichia coli. J Bacteriol 184:1843-1850
CAS PubMed Google Scholar
Atlung T, Ingmer H (1997) H-NS: a modulator of environmentally regulated gene expression. Mol Microbiol 24:7-17
CAS PubMed Google Scholar
Atlung T, Sund S, Olesen K, Brondsted L (1996) The histone-like protein H-NS acts as a transcriptional repressor for expression of the anaerobic and growth phase activator AppY of Escherichia coli. J Bacteriol 178:3418-3425
CAS PubMed Google Scholar
Badaut C, Williams R, Arluison V, Bouffartigues E, Robert B, Buc H, Rimsky S (2002) The degree of oligomerization of the H-NS nucleoid structuring protein is related to specific binding to DNA. J Biol Chem 277:41657-41666
CAS PubMed Google Scholar
Bae SH, Liu D, Lim HM, Lee Y, Choi BS (2008) Structure of the nucleoid-associated protein cnu reveals common binding sites for H-NS in cnu and hha. Biochemistry 47:1993-2001
CAS PubMed Google Scholar
Bailone A, Backman A, Sommer S, Celerier J, Bagdasarian MM, Bagdasarian M, Devoret R (1988) PsiB polypeptide prevents activation of RecA protein in Escherichia coli. Mol Gen Genet 214:389-395
CAS PubMed Google Scholar
Bakaev VV (1981) Structure of chromosomal deoxyribonucleoproteins. XI. Organization of deoxyribonucleoprotein complex in bacterial cells. Mol Biol (Mosk) 15:1350-1363
Google Scholar
Balsalobre C, Juarez A, Madrid C, Mourino M, Prenafeta A, Munoa FJ (1996) Complementation of the hha mutation in Escherichia coli by the ymoA gene from Yersinia enterocolitica: dependence on the gene dosage. Microbiology 142:1841-1846
CAS PubMed Google Scholar
Banos RC, Pons JI, Madrid C, Juarez A (2008) A global modulatory role for the Yersinia enterocolitica H-NS protein. Microbiology 154:1281-1289
CAS PubMed Google Scholar
Barba J, Bustamante VH, Flores-Valdez MA, Deng W, Finlay BB, Puente JL (2005) A positive regulatory loop controls expression of the locus of enterocyte effacement-encoded regulators Ler and GrlA. J Bacteriol 187:7918-7930
CAS PubMed Google Scholar
Barth M, Marschall C, Muffler A, Fischer D, Hengge-Aronis R (1995) Role for the histone-like protein H-NS in growth phase-dependent and osmotic regulation of sigma S and many sigma S-dependent genes in Escherichia coli. J Bacteriol 177:3455-3464
CAS PubMed Google Scholar
Becker G, Hengge-Aronis R (2001) What makes an Escherichia coli promoter sigma(S) dependent? Role of the −13/−14 nucleotide promoter positions and region 2.5 of sigma(S). Mol Microbiol 39:1153-1165
CAS PubMed Google Scholar
Beloin C, Dorman CJ (2003) An extended role for the nucleoid structuring protein H-NS in the virulence gene regulatory cascade of Shigella flexneri. Mol Microbiol 47:825-838
CAS PubMed Google Scholar
Beloin C, Deighan P, Doyle M, Dorman CJ (2003) Shigella flexneri 2a strain 2457T expresses three members of the H-NS-like protein family: characterization of the Sfh protein. Mol Genet Genom 270:66-77
CAS Google Scholar
Berdichevsky T, Friedberg D, Nadler C, Rokney A, Oppenheim A, Rosenshine I (2005) Ler is a negative autoregulator of the LEE1 operon in enteropathogenic Escherichia coli. J Bacteriol 187:349-357
CAS PubMed Google Scholar
Bertin P, Hommais F, Krin E, Soutourina O, Tendeng C, Derzelle S, Danchin A (2001) H-NS and H-NS-like proteins in Gram-negative bacteria and their multiple role in the regulation of bacterial metabolism. Biochimie 83:235-241
CAS PubMed Google Scholar
Blanco A, Juarez A, Pastor FI (1991) Overproduction of a Clostridium cellulolyticum endoglucanase by mutant strains of Escherichia coli. FEMS Microbiol Lett 65:221-226
CAS PubMed Google Scholar
Blattner FR, Plunkett G 3rd, Bloch CA, Perna NT, Burland V, Riley M, Collado-Vides J, Glasner JD, Rode CK, Mayhew GF, Gregor J, Davis NW, Kirkpatrick HA, Goeden MA, Rose DJ, Mau B, Shao Y (1997) The complete genome sequence of Escherichia coli K-12. Science 277:1453-1474
CAS PubMed Google Scholar
Bloch V, Yang Y, Margeat E, Chavanieu A, Auge MT, Robert B, Arold S, Rimsky S, Kochoyan M (2003) The H-NS dimerization domain defines a new fold contributing to DNA recognition. Nat Struct Biol 10:212-218
CAS PubMed Google Scholar
Bouffartigues E, Buckle M, Badaut C, Travers A, Rimsky S (2007) H-NS cooperative binding to high-affinity sites in a regulatory element results in transcriptional silencing. Nat Struct Mol Biol 14:441-448
CAS PubMed Google Scholar
Bracco L, Kotlarz D, Kolb A, Diekmann S, Buc H (1989) Synthetic curved DNA sequences can act as transcriptional activators in Escherichia coli. EMBO J 8:4289-4296
CAS PubMed Google Scholar
Brescia CC, Kaw MK, Sledjeski DD (2004) The DNA binding protein H-NS binds to and alters the stability of RNA in vitro and in vivo. J Mol Biol 339:505-514
CAS PubMed Google Scholar
Browning DF, Cole JA, Busby SJ (2000) Suppression of FNR-dependent transcription activation at the Escherichia coli nir promoter by Fis, IHF and H-NS: modulation of transcription initiation by a complex nucleo-protein assembly. Mol Microbiol 37:1258-1269
CAS PubMed Google Scholar
Bryan A, Roesch P, Davis L, Moritz R, Pellett S, Welch RA (2006) Regulation of type 1 fimbriae by unlinked FimB- and FimE-like recombinases in uropathogenic Escherichia coli strain CFT073. Infect Immun 74:1072-1083
CAS PubMed Google Scholar
Bustamante VH, Santana FJ, Calva E, Puente JL (2001) Transcriptional regulation of type III secretion genes in enteropathogenic Escherichia coli: Ler antagonizes H-NS-dependent repression. Mol Microbiol 39:664-678
CAS PubMed Google Scholar
Caramel A, Schnetz K (1998) Lac and lambda repressors relieve silencing of the Escherichia coli bgl promoter. Activation by alteration of a repressing nucleoprotein complex. J Mol Biol 284:875-883
CAS PubMed Google Scholar
Caramel A, Schnetz K (2000) Antagonistic control of the Escherichia coli bgl promoter by FIS and CAP in vitro. Mol Microbiol 36:85-92
CAS PubMed Google Scholar
Carmona M, Balsalobre C, Munoa F, Mourino M, Jubete Y, De la Cruz F, Juarez A (1993) Escherichia coli hha mutants, DNA supercoiling and expression of the haemolysin genes from the recombinant plasmid pANN202-312. Mol Microbiol 9:1011-1018
CAS PubMed Google Scholar
Caron E, Crepin VF, Simpson N, Knutton S, Garmendia J, Frankel G (2006) Subversion of actin dynamics by EPEC and EHEC. Curr Opin Microbiol 9:40-45
CAS PubMed Google Scholar
Castang S, McManus HR, Turner KH, Dove SL (2008) H-NS family members function coordinately in an opportunistic pathogen. Proc Natl Acad Sci USA 105:18947-18952
CAS PubMed Google Scholar
Cerdan R, Bloch V, Yang Y, Bertin P, Dumas C, Rimsky S, Kochoyan M, Arold ST (2003) Crystal structure of the N-terminal dimerisation domain of VicH, the H-NS-like protein of Vibrio cholerae. J Mol Biol 334:179-185
CAS PubMed Google Scholar
Ceschini S, Lupidi G, Coletta M, Pon CL, Fioretti E, Angeletti M (2000) Multimeric self-assembly equilibria involving the histone-like protein H-NS. A thermodynamic study. J Biol Chem 275:729-734
CAS PubMed Google Scholar
Chen CC, Wu HY (2005) LeuO protein delimits the transcriptionally active and repressive domains on the bacterial chromosome. J Biol Chem 280:15111-15121
CAS PubMed Google Scholar
Chen CC, Chou MY, Huang CH, Majumder A, Wu HY (2005) A cis-spreading nucleoprotein filament is responsible for the gene silencing activity found in the promoter relay mechanism. J Biol Chem 280:5101-5112
CAS PubMed Google Scholar
Chen JM, German GJ, Alexander DC, Ren H, Tan T, Liu J (2006) Roles of Lsr2 in colony morphology and biofilm formation of Mycobacterium smegmatis. J Bacteriol 188:633-641
CAS PubMed Google Scholar
Chen JM, Ren H, Shaw JE, Wang YJ, Li M, Leung AS, Tran V, Berbenetz NM, Kocincova D, Yip CM, Reyrat JM, Liu J (2008) Lsr2 of Mycobacterium tuberculosis is a DNA-bridging protein. Nucleic Acids Res 36:2123-2135
CAS PubMed Google Scholar
Colangeli R, Helb D, Vilcheze C, Hazbon MH, Lee CG, Safi H, Sayers B, Sardone I, Jones MB, Fleischmann RD, Peterson SN, Jacobs WR, Jr., Alland D (2007) Transcriptional regulation of multi-drug tolerance and antibiotic-induced responses by the histone-like protein Lsr2 in M. tuberculosis. PLoS Pathog 3:e87
Google Scholar
Colonna B, Casalino M, Fradiani PA, Zagaglia C, Naitza S, Leoni L, Prosseda G, Coppo A, Ghelardini P, Nicoletti M (1995) H-NS regulation of virulence gene expression in enteroinvasive Escherichia coli harboring the virulence plasmid integrated into the host chromosome. J Bacteriol 177:4703-4712
CAS PubMed Google Scholar
Connell I, Agace W, Klemm P, Schembri M, Marild S, Svanborg C (1996) Type 1 fimbrial expression enhances Escherichia coli virulence for the urinary tract. Proc Natl Acad Sci USA 93:9827-9832
CAS PubMed Google Scholar
Coombes BK, Wickham ME, Lowden MJ, Brown NF, Finlay BB (2005) Negative regulation of Salmonella pathogenicity island 2 is required for contextual control of virulence during typhoid. Proc Natl Acad Sci USA 102:17460-17465
CAS PubMed Google Scholar
Corbett D, Bennett HJ, Askar H, Green J, Roberts IS (2007) SlyA and H-NS regulate transcription of the Escherichia coli K5 capsule gene cluster, and expression of slyA in Escherichia coli is temperature-dependent, positively autoregulated, and independent of H-NS. J Biol Chem 282:33326-33335
CAS PubMed Google Scholar
Cordeiro TN, Garci AJ, Pons JI, Aznar S, Juarez A, Pons M (2008) A single residue mutation in Hha preserving structure and binding to H-NS results in loss of H-NS mediated gene repression properties. FEBS Lett 582:3139-3144
CAS PubMed Google Scholar
Cornelis GR, Sluiters C, Delor I, Geib D, Kaniga K, Lambert de Rouvroit C, Sory MP, Vanooteghem JC, Michiels T (1991) ymoA, a Yersinia enterocolitica chromosomal gene modulating the expression of virulence functions. Mol Microbiol 5:1023-1034
CAS PubMed Google Scholar
Cukier-Kahn R, Jacquet M, Gros F (1972) Two heat-resistant, low molecular weight proteins from Escherichia coli that stimulate DNA-directed RNA synthesis. Proc Natl Acad Sci USA 69:3643-3647
CAS PubMed Google Scholar
Cusick ME, Belfort M (1998) Domain structure and RNA annealing activity of the Escherichia coli regulatory protein StpA. Mol Microbiol 28:847-857
CAS PubMed Google Scholar
Dame RT (2005) The role of nucleoid-associated proteins in the organization and compaction of bacterial chromatin. Mol Microbiol 56:858-870
CAS PubMed Google Scholar
Dame RT (2008) Single-molecule micromanipulation studies of DNA and architectural proteins. Biochem Soc Trans 36:732-737
CAS PubMed Google Scholar
Dame RT, Goosen N (2002) HU: promoting or counteracting DNA compaction? FEBS Lett 529:151-156
CAS PubMed Google Scholar
Dame RT, Wuite GJ (2003) On the role of H-NS in the organization of bacterial chromatin: from bulk to single molecules and back. Biophys J 85:4146-4148
CAS PubMed Google Scholar
Dame RT, Wyman C, Goosen N (2000) H-NS mediated compaction of DNA visualised by atomic force microscopy. Nucleic Acids Res 28:3504-3510
CAS PubMed Google Scholar
Dame RT, Wyman C, Goosen N (2001) Structural basis for preferential binding of H-NS to curved DNA. Biochimie 83:231-234
CAS PubMed Google Scholar
Dame RT, Wyman C, Wurm R, Wagner R, Goosen N (2002) Structural basis for H-NS-mediated trapping of RNA polymerase in the open initiation complex at the rrnB P1. J Biol Chem 277:2146-2150
CAS PubMed Google Scholar
Dame RT, Luijsterburg MS, Krin E, Bertin PN, Wagner R, Wuite GJ (2005) DNA bridging: a property shared among H-NS-like proteins. J Bacteriol 187:1845-1848
CAS PubMed Google Scholar
Dame RT, Noom MC, Wuite GJ (2006) Bacterial chromatin organization by H-NS protein unravelled using dual DNA manipulation. Nature 444:387-390
CAS PubMed Google Scholar
Dattananda CS, Rajkumari K, Gowrishankar J (1991) Multiple mechanisms contribute to osmotic inducibility of proU operon expression in Escherichia coli: demonstration of two osmoresponsive promoters and of a negative regulatory element within the first structural gene. J Bacteriol 173:7481-7490
CAS PubMed Google Scholar
Daubin V, Lerat E, Perriere G (2003a) The source of laterally transferred genes in bacterial genomes. Genome Biol 4:R57
PubMed Google Scholar
Daubin V, Moran NA, Ochman H (2003b) Phylogenetics and the cohesion of bacterial genomes. Science 301:829-832
CAS PubMed Google Scholar
De Biase D, Tramonti A, Bossa F, Visca P (1999) The response to stationary-phase stress conditions in Escherichia coli: role and regulation of the glutamic acid decarboxylase system. Mol Microbiol 32:1198-1211
PubMed Google Scholar
de la Cruz F, Carmona M, Juarez A (1992) The Hha protein from Escherichia coli is highly homologous to the YmoA protein from Yersinia enterocolitica. Mol Microbiol 6:3451-3452
PubMed Google Scholar
Defez R, De Felice M (1981) Cryptic operon for beta-glucoside metabolism in Escherichia coli K12: genetic evidence for a regulatory protein. Genetics 97:11-25
CAS PubMed Google Scholar
Deighan P, Free A, Dorman CJ (2000) A role for the Escherichia coli H-NS-like protein StpA in OmpF porin expression through modulation of micF RNA stability. Mol Microbiol 38:126-139
CAS PubMed Google Scholar
Deighan P, Beloin C, Dorman CJ (2003) Three-way interactions among the Sfh, StpA and H-NS nucleoid-structuring proteins of Shigella flexneri 2a strain 2457T. Mol Microbiol 48:1401-1416
CAS PubMed Google Scholar
Delihas N, Forst S (2001) MicF: an antisense RNA gene involved in response of Escherichia coli to global stress factors. J Mol Biol 313:1-12
CAS PubMed Google Scholar
Deng S, Stein RA, Higgins NP (2005) Organization of supercoil domains and their reorganization by transcription. Mol Microbiol 57:1511-1521
CAS PubMed Google Scholar
Dersch P, Schmidt K, Bremer E (1993) Synthesis of the Escherichia coli K-12 nucleoid-associated DNA-binding protein H-NS is subjected to growth-phase control and autoregulation. Mol Microbiol 8:875-889
CAS PubMed Google Scholar
Dersch P, Kneip S, Bremer E (1994) The nucleoid-associated DNA-binding protein H-NS is required for the efficient adaptation of Escherichia coli K-12 to a cold environment. Mol Gen Genet 245:255-259
CAS PubMed Google Scholar
Diderichsen B (1980) cur-1, a mutation affecting a phenotype of sup+ strains of Escherichia coli. Mol Gen Genet 180:425-428
CAS PubMed Google Scholar
Diggle SP, Winzer K, Lazdunski A, Williams P, Camara M (2002) Advancing the quorum in Pseudomonas aeruginosa: MvaT and the regulation of N-acylhomoserine lactone production and virulence gene expression. J Bacteriol 184:2576-2586
CAS PubMed Google Scholar
Diggle SP, Winzer K, Chhabra SR, Worrall KE, Camara M, Williams P (2003) The Pseudomonas aeruginosa quinolone signal molecule overcomes the cell density-dependency of the quorum sensing hierarchy, regulates rhl-dependent genes at the onset of stationary phase and can be produced in the absence of LasR. Mol Microbiol 50:29-43
CAS PubMed Google Scholar
Dole S, Klingen Y, Nagarajavel V, Schnetz K (2004a) The protease Lon and the RNA-binding protein Hfq reduce silencing of the Escherichia coli bgl operon by H-NS. J Bacteriol 186:2708-2716
CAS PubMed Google Scholar
Dole S, Nagarajavel V, Schnetz K (2004b) The histone-like nucleoid structuring protein H-NS represses the Escherichia coli bgl operon downstream of the promoter. Mol Microbiol 52:589-600
CAS PubMed Google Scholar
Donato GM, Kawula TH (1999) Phenotypic analysis of random hns mutations differentiate DNA-binding activity from properties of fimA promoter inversion modulation and bacterial motility. J Bacteriol 181:941-948
CAS PubMed Google Scholar
Donato GM, Lelivelt MJ, Kawula TH (1997) Promoter-specific repression of fimB expression by the Escherichia coli nucleoid-associated protein H-NS. J Bacteriol 179:6618-6625
CAS PubMed Google Scholar
Dorman CJ (2004) H-NS: a universal regulator for a dynamic genome. Nat Rev Microbiol 2:391-400
CAS PubMed Google Scholar
Dorman CJ (2006) DNA supercoiling and bacterial gene expression. Sci Prog 89:151-166
CAS PubMed Google Scholar
Dorman CJ (2007) H-NS, the genome sentinel. Nat Rev Microbiol 5:157-161
CAS PubMed Google Scholar
Doyle M, Dorman CJ (2006) Reciprocal transcriptional and posttranscriptional growth-phase-dependent expression of sfh, a gene that encodes a paralogue of the nucleoid-associated protein H-NS. J Bacteriol 188:7581-7591
CAS PubMed Google Scholar
Doyle M, Fookes M, Ivens A, Mangan MW, Wain J, Dorman CJ (2007) An H-NS-like stealth protein aids horizontal DNA transmission in bacteria. Science 315:251-252
CAS PubMed Google Scholar
Duong N, Osborne S, Bustamante VH, Tomljenovic AM, Puente JL, Coombes BK (2007) Thermosensing coordinates a cis-regulatory module for transcriptional activation of the intracellular virulence system in Salmonella enterica serovar Typhimurium. J Biol Chem 282:34077-34084
CAS PubMed Google Scholar
Elliott SJ, Sperandio V, Giron JA, Shin S, Mellies JL, Wainwright L, Hutcheson SW, McDaniel TK, Kaper JB (2000) The locus of enterocyte effacement (LEE)-encoded regulator controls expression of both LEE- and non-LEE-encoded virulence factors in enteropathogenic and enterohemorrhagic Escherichia coli. Infect Immun 68:6115-6126
CAS PubMed Google Scholar
Ellison DW, Miller VL (2006) H-NS Represses inv transcription in Yersinia enterocolitica through competition with RovA and interaction with YmoA. J Bacteriol 188:5101-5112
CAS PubMed Google Scholar
Ellison DW, Young B, Nelson K, Miller VL (2003) YmoA negatively regulates expression of invasin from Yersinia enterocolitica. J Bacteriol 185:7153-7159
CAS PubMed Google Scholar
Esposito D, Petrovic A, Harris R, Ono S, Eccleston JF, Mbabaali A, Haq I, Higgins CF, Hinton JC, Driscoll PC, Ladbury JE (2002) H-NS oligomerization domain structure reveals the mechanism for high order self-association of the intact protein. J Mol Biol 324:841-850
CAS PubMed Google Scholar
Falconi M, Gualtieri MT, La Teana A, Losso MA, Pon CL (1988) Proteins from the prokaryotic nucleoid: primary and quaternary structure of the 15-kD Escherichia coli DNA binding protein H-NS. Mol Microbiol 2:323-329
CAS PubMed Google Scholar
Falconi M, McGovern V, Gualerzi C, Hillyard D, Higgins NP (1991) Mutations altering chromosomal protein H-NS induce mini-Mu transposition. New Biol 3:615-625
CAS PubMed Google Scholar
Falconi M, Brandi A, La Teana A, Gualerzi CO, Pon CL (1996) Antagonistic involvement of FIS and H-NS proteins in the transcriptional control of hns expression. Mol Microbiol 19:965-975
CAS PubMed Google Scholar
Falconi M, Colonna B, Prosseda G, Micheli G, Gualerzi CO (1998) Thermoregulation of Shigella and Escherichia coli EIEC pathogenicity. A temperature-dependent structural transition of DNA modulates accessibility of virF promoter to transcriptional repressor H-NS. EMBO J 17:7033-7043
CAS PubMed Google Scholar
Falconi M, Prosseda G, Giangrossi M, Beghetto E, Colonna B (2001) Involvement of FIS in the H-NS-mediated regulation of virF gene of Shigella and enteroinvasive Escherichia coli. Mol Microbiol 42:439-452
CAS PubMed Google Scholar
Finkel SE, Johnson RC (1992) The Fis protein: it’s not just for DNA inversion anymore. Mol Microbiol 6:3257-3265
CAS PubMed Google Scholar
Fletcher SA, Csonka LN (1995) Fine-structure deletion analysis of the transcriptional silencer of the proU operon of Salmonella typhimurium. J Bacteriol 177:4508-4513
CAS PubMed Google Scholar
Forns N, Banos RC, Balsalobre C, Juarez A, Madrid C (2005) Temperature-dependent conjugative transfer of R27: role of chromosome- and plasmid-encoded Hha and H-NS proteins. J Bacteriol 187:3950-3959
CAS PubMed Google Scholar
Free A, Dorman CJ (1995) Coupling of Escherichia coli hns mRNA levels to DNA synthesis by autoregulation: implications for growth phase control. Mol Microbiol 18:101-113
CAS PubMed Google Scholar
Free A, Dorman CJ (1997) The Escherichia coli stpA gene is transiently expressed during growth in rich medium and is induced in minimal medium and by stress conditions. J Bacteriol 179:909-918
CAS PubMed Google Scholar
Free A, Williams RM, Dorman CJ (1998) The StpA protein functions as a molecular adapter to mediate repression of the bgl operon by truncated H-NS in Escherichia coli. J Bacteriol 180:994-997
CAS PubMed Google Scholar
Free A, Porter ME, Deighan P, Dorman CJ (2001) Requirement for the molecular adapter function of StpA at the Escherichia coli bgl promoter depends upon the level of truncated H-NS protein. Mol Microbiol 42:903-917
CAS PubMed Google Scholar
Friedrich K, Gualerzi CO, Lammi M, Losso MA, Pon CL (1988) Proteins from the prokaryotic nucleoid. Interaction of nucleic acids with the 15 kDa Escherichia coli histone-like protein H-NS. FEBS Lett 229:197-202
CAS PubMed Google Scholar
Gally DL, Bogan JA, Eisenstein BI, Blomfield IC (1993) Environmental regulation of the fim switch controlling type 1 fimbrial phase variation in Escherichia coli K-12: effects of temperature and media. J Bacteriol 175:6186-6193
CAS PubMed Google Scholar
Garcia J, Cordeiro TN, Nieto JM, Pons I, Juarez A, Pons M (2005) Interaction between the bacterial nucleoid associated proteins Hha and H-NS involves a conformational change of Hha. Biochem J 388:755-762
CAS PubMed Google Scholar
Garcia J, Madrid C, Juarez A, Pons M (2006) New roles for key residues in helices H1 and H2 of the Escherichia coli H-NS N-terminal domain: H-NS dimer stabilization and Hha binding. J Mol Biol 359:679-689
CAS PubMed Google Scholar
Gerstel U, Park C, Romling U (2003) Complex regulation of csgD promoter activity by global regulatory proteins. Mol Microbiol 49:639-654
CAS PubMed Google Scholar
Gil R, Silva FJ, Zientz E, Delmotte F, Gonzalez-Candelas F, Latorre A, Rausell C, Kamerbeek J, Gadau J, Holldobler B, van Ham RC, Gross R, Moya A (2003) The genome sequence of Blochmannia floridanus: comparative analysis of reduced genomes. Proc Natl Acad Sci USA 100:9388-9393
CAS PubMed Google Scholar
Godessart N, Munoa FJ, Regue M, Juarez A (1988) Chromosomal mutations that increase the production of a plasmid-encoded haemolysin in Escherichia coli. J Gen Microbiol 134:2779-2787
CAS PubMed Google Scholar
Golub E, Bailone A, Devoret R (1988) A gene encoding an SOS inhibitor is present in different conjugative plasmids. J Bacteriol 170:4392-4394
CAS PubMed Google Scholar
Goransson M, Sonden B, Nilsson P, Dagberg B, Forsman K, Emanuelsson K, Uhlin BE (1990) Transcriptional silencing and thermoregulation of gene expression in Escherichia coli. Nature 344:682-685
CAS PubMed Google Scholar
Gordon BR, Imperial R, Wang L, Navarre WW, Liu J (2008) Lsr2 of Mycobacterium represents a novel class of H-NS-like proteins. J Bacteriol 190:7052-7059
CAS PubMed Google Scholar
Gowrishankar J, Pittard AJ (1998) Superimposition of tyrR protein-mediated regulation on osmoresponsive transcription of Escherichia coli proU in vivo. J Bacteriol 180:6743-6748
CAS PubMed Google Scholar
Goyard S (1996) Identification and characterization of BpH2, a novel histone H1 homolog in Bordetella pertussis. J Bacteriol 178:3066-3071
CAS PubMed Google Scholar
Goyard S, Bertin P (1997) Characterization of BpH3, an H-NS-like protein in Bordetella pertussis. Mol Microbiol 24:815-823
CAS PubMed Google Scholar
Graeme-Cook KA, May G, Bremer E, Higgins CF (1989) Osmotic regulation of porin expression: a role for DNA supercoiling. Mol Microbiol 3:1287-1294
CAS PubMed Google Scholar
Grainger DC, Hurd D, Goldberg MD, Busby SJ (2006) Association of nucleoid proteins with coding and non-coding segments of the Escherichia coli genome. Nucleic Acids Res 34:4642-4652
CAS PubMed Google Scholar
Grainger DC, Aiba H, Hurd D, Browning DF, Busby SJ (2007) Transcription factor distribution in Escherichia coli: studies with FNR protein. Nucleic Acids Res 35:269-278
CAS PubMed Google Scholar
Grainger DC, Goldberg MD, Lee DJ, Busby SJ (2008) Selective repression by Fis and H-NS at the Escherichia coli dps promoter. Mol Microbiol 68:1366-1377
CAS PubMed Google Scholar
Gralla JD, Vargas DR (2006) Potassium glutamate as a transcriptional inhibitor during bacterial osmoregulation. EMBO J 25:1515-1521
CAS PubMed Google Scholar
Groisman EA, Ochman H (1997) How Salmonella became a pathogen. Trends Microbiol 5:343-349
CAS PubMed Google Scholar
Gualerzi CO, Losso MA, Lammi M, Friedrich K, Pawlik RT, Canonaco MA, Gianfranceschi GL, Pingoud A, Pon CL (1986) Proteins from the Prokaryotic Nucleoid. Structural and Functional Characterization of the Escherichia coli DNA-Binding Proteins NS (HU) and H-NS. In: Gualerzi CO, Pon CL (eds) Bacterial chromatin. Springer-Verlag, Berlin, pp 101-134
Google Scholar
Haack KR, Robinson CL, Miller KJ, Fowlkes JW, Mellies JL (2003) Interaction of Ler at the LEE5 (tir) operon of enteropathogenic Escherichia coli. Infect Immun 71:384-392
CAS PubMed Google Scholar
Halsey TA, Vazquez-Torres A, Gravdahl DJ, Fang FC, Libby SJ (2004) The ferritin-like Dps protein is required for Salmonella enterica serovar Typhimurium oxidative stress resistance and virulence. Infect Immun 72:1155-1158
CAS PubMed Google Scholar
Haniford DB (2006) Transpososome dynamics and regulation in Tn10 transposition. Crit Rev Biochem Mol Biol 41:407-424
CAS PubMed Google Scholar
Hardy CD, Cozzarelli NR (2005) A genetic selection for supercoiling mutants of Escherichia coli reveals proteins implicated in chromosome structure. Mol Microbiol 57:1636-1652
CAS PubMed Google Scholar
Harrison JA, Pickard D, Higgins CF, Khan A, Chatfield SN, Ali T, Dorman CJ, Hormaeche CE, Dougan G (1994) Role of hns in the virulence phenotype of pathogenic salmonellae. Mol Microbiol 13:133-140
CAS PubMed Google Scholar
Heroven AK, Dersch P (2006) RovM, a novel LysR-type regulator of the virulence activator gene rovA, controls cell invasion, virulence and motility of Yersinia pseudotuberculosis. Mol Microbiol 62:1469-1483
CAS PubMed Google Scholar
Heroven AK, Nagel G, Tran HJ, Parr S, Dersch P (2004) RovA is autoregulated and antagonizes H-NS-mediated silencing of invasin and rovA expression in Yersinia pseudotuberculosis. Mol Microbiol 53:871-888
CAS PubMed Google Scholar
Higgins CF, Dorman CJ, Stirling DA, Waddell L, Booth IR, May G, Bremer E (1988) A physiological role for DNA supercoiling in the osmotic regulation of gene expression in S. typhimurium and E. coli. Cell 52:569-584
CAS PubMed Google Scholar
Higgins CF, Hinton JC, Hulton CS, Owen-Hughes T, Pavitt GD, Seirafi A (1990) Protein H1: a role for chromatin structure in the regulation of bacterial gene expression and virulence? Mol Microbiol 4:2007-2012
CAS PubMed Google Scholar
Hinton JC, Santos DS, Seirafi A, Hulton CS, Pavitt GD, Higgins CF (1992) Expression and mutational analysis of the nucleoid-associated protein H-NS of Salmonella typhimurium. Mol Microbiol 6:2327-2337
CAS PubMed Google Scholar
Hommais F, Krin E, Laurent-Winter C, Soutourina O, Malpertuy A, Le Caer JP, Danchin A, Bertin P (2001) Large-scale monitoring of pleiotropic regulation of gene expression by the prokaryotic nucleoid-associated protein, H-NS. Mol Microbiol 40:20-36
CAS PubMed Google Scholar
Hromockyj AE, Tucker SC, Maurelli AT (1992) Temperature regulation of Shigella virulence: identification of the repressor gene virR, an analogue of hns, and partial complementation by tyrosyl transfer RNA (tRNA₁(Tyr)). Mol Microbiol 6:2113-2124
CAS PubMed Google Scholar
Hulbert RR, Taylor RK (2002) Mechanism of ToxT-dependent transcriptional activation at the Vibrio cholerae tcpA promoter. J Bacteriol 184:5533-5544
CAS PubMed Google Scholar
Hulton CS, Seirafi A, Hinton JC, Sidebotham JM, Waddell L, Pavitt GD, Owen-Hughes T, Spassky A, Buc H, Higgins CF (1990) Histone-like protein H1 (H-NS), DNA supercoiling, and gene expression in bacteria. Cell 63:631-642
CAS PubMed Google Scholar
Jacquet M, Cukier-Kahn R, Pla J, Gros F (1971) A thermostable protein factor acting on in vitro DNA transcription. Biochem Biophys Res Commun 45:1597-1607
CAS PubMed Google Scholar
Johansson J, Uhlin BE (1999) Differential protease-mediated turnover of H-NS and StpA revealed by a mutation altering protein stability and stationary-phase survival of Escherichia coli. Proc Natl Acad Sci USA 96:10776-10781
CAS PubMed Google Scholar
Johansson J, Eriksson S, Sonden B, Wai SN, Uhlin BE (2001) Heteromeric interactions among nucleoid-associated bacterial proteins: localization of StpA-stabilizing regions in H-NS of Escherichia coli. J Bacteriol 183:2343-2347
CAS PubMed Google Scholar
Jordi BJ, Higgins CF (2000) The downstream regulatory element of the proU operon of Salmonella typhimurium inhibits open complex formation by RNA polymerase at a distance. J Biol Chem 275:12123-12128
CAS PubMed Google Scholar
Jordi BJ, Dagberg B, de Haan LA, Hamers AM, van der Zeijst BA, Gaastra W, Uhlin BE (1992) The positive regulator CfaD overcomes the repression mediated by histone-like protein H-NS (H1) in the CFA/I fimbrial operon of Escherichia coli. EMBO J 11:2627-2632
CAS PubMed Google Scholar
Jordi BJ, Fielder AE, Burns CM, Hinton JC, Dover N, Ussery DW, Higgins CF (1997) DNA binding is not sufficient for H-NS-mediated repression of proU expression. J Biol Chem 272:12083-12090
CAS PubMed Google Scholar
Joshi R, Passner JM, Rohs R, Jain R, Sosinsky A, Crickmore MA, Jacob V, Aggarwal AK, Honig B, Mann RS (2007) Functional specificity of a Hox protein mediated by the recognition of minor groove structure. Cell 131:530-543
CAS PubMed Google Scholar
Kano Y, Yasuzawa K, Tanaka H, Imamoto F (1993) Propagation of phage Mu in IHF-deficient Escherichia coli in the absence of the H-NS histone-like protein. Gene 126:93-97
CAS PubMed Google Scholar
Kaper JB, Nataro JP, Mobley HL (2004) Pathogenic Escherichia coli. Nat Rev Microbiol 2:123-140
CAS PubMed Google Scholar
Kawula TH, Orndorff PE (1991) Rapid site-specific DNA inversion in Escherichia coli mutants lacking the histone like protein H-NS. J Bacteriol 173:4116-4123
CAS PubMed Google Scholar
Kim MS, Bae SH, Yun SH, Lee HJ, Ji SC, Lee JH, Srivastava P, Lee SH, Chae H, Lee Y, Choi BS, Chattoraj DK, Lim HM (2005) Cnu, a novel oriC-binding protein of Escherichia coli. J Bacteriol 187:6998-7008
CAS PubMed Google Scholar
Klemm P (1986) Two regulatory fim genes, fimB and fimE, control the phase variation of type 1 fimbriae in Escherichia coli. EMBO J 5:1389-1393
CAS PubMed Google Scholar
Kocincova D, Singh AK, Beretti JL, Ren H, Euphrasie D, Liu J, Daffe M, Etienne G, Reyrat JM (2008) Spontaneous transposition of IS1096 or ISMsm3 leads to glycopeptidolipid overproduction and affects surface properties in Mycobacterium smegmatis. Tuberculosis (Edinb) 88:390-398
CAS Google Scholar
La Teana A, Brandi A, Falconi M, Spurio R, Pon CL, Gualerzi CO (1991) Identification of a cold shock transcriptional enhancer of the Escherichia coli gene encoding nucleoid protein H-NS. Proc Natl Acad Sci USA 88:10907-10911
PubMed Google Scholar
Laaberki MH, Janabi N, Oswald E, Repoila F (2006) Concert of regulators to switch on LEE expression in enterohemorrhagic Escherichia coli O157:H7: interplay between Ler, GrlA, H-NS and RpoS. Int J Med Microbiol 296:197-210
CAS PubMed Google Scholar
Laine B, Sautiere P, Spassky A, Rimsky S (1984) A DNA-binding protein from E. coli isolation, characterization and its relationship with proteins H1 and B1. Biochem Biophys Res Commun 119:1147-1153
CAS PubMed Google Scholar
Lammi M, Paci M, Pon CL, Losso MA, Miano A, Pawlik RT, Gianfranceschi GL, Gualerzi CO (1984) Proteins from the prokaryotic nucleoid: biochemical and 1H NMR studies on three bacterial histone-like proteins. In: Hubscher U, Spadari S (eds) Proteins involved in DNA replication, vol 179. Plenum, New York, pp 467-477
Google Scholar
Lane D, Cavaille J, Chandler M (1994) Induction of the SOS response by IS1 transposase. J Mol Biol 242:339-350
CAS PubMed Google Scholar
Lane MC, Simms AN, Mobley HL (2007) Complex interplay between type 1 fimbrial expression and flagellum-mediated motility of uropathogenic Escherichia coli. J Bacteriol 189:5523-5533
CAS PubMed Google Scholar
Lang B, Blot N, Bouffartigues E, Buckle M, Geertz M, Gualerzi CO, Mavathur R, Muskhelishvili G, Pon CL, Rimsky S, Stella S, Babu MM, Travers A (2007) High-affinity DNA binding sites for H-NS provide a molecular basis for selective silencing within proteobacterial genomes. Nucleic Acids Res 35:6330-6337
CAS PubMed Google Scholar
Lawrence JG, Ochman H (1997) Amelioration of bacterial genomes: rates of change and exchange. J Mol Evol 44:383-397
CAS PubMed Google Scholar
Lawrence JG, Ochman H (1998) Molecular archaeology of the Escherichia coli genome. Proc Natl Acad Sci USA 95:9413-9417
CAS PubMed Google Scholar
Lease RA, Cusick ME, Belfort M (1998) Riboregulation in Escherichia coli: DsrA RNA acts by RNA:RNA interactions at multiple loci. Proc Natl Acad Sci USA 95:12456-12461
CAS PubMed Google Scholar
Lejeune P, Danchin A (1990) Mutations in the bglY gene increase the frequency of spontaneous deletions in Escherichia coli K-12. Proc Natl Acad Sci USA 87:360-363
CAS PubMed Google Scholar
Levinthal M, Pownder T (1996) hns, rpoS and lrp mutations affect stationary-phase survival at high osmolarity. Res Microbiol 147:333-342
CAS PubMed Google Scholar
Lim HM, Lewis DE, Lee HJ, Liu M, Adhya S (2003) Effect of varying the supercoiling of DNA on transcription and its regulation. Biochemistry 42:10718-10725
CAS PubMed Google Scholar
Lithgow JK, Haider F, Roberts IS, Green J (2007) Alternate SlyA and H-NS nucleoprotein complexes control hlyE expression in Escherichia coli K-12. Mol Microbiol 66:685-698
CAS PubMed Google Scholar
Liu Q, Richardson CC (1993) Gene 5.5 protein of bacteriophage T7 inhibits the nucleoid protein H-NS of Escherichia coli. Proc Natl Acad Sci USA 90:1761-1765
CAS PubMed Google Scholar
Lucchini S, Rowley G, Goldberg MD, Hurd D, Harrison M, Hinton JC (2006) H-NS mediates the silencing of laterally acquired genes in bacteria. PLoS Pathog 2:e81
PubMed Google Scholar
Lucht JM, Dersch P, Kempf B, Bremer E (1994) Interactions of the nucleoid-associated DNA-binding protein H-NS with the regulatory region of the osmotically controlled proU operon of Escherichia coli. J Biol Chem 269:6578-6586
CAS PubMed Google Scholar
Madhusudan S, Paukner A, Klingen Y, Schnetz K (2005) Independent regulation of H-NS-mediated silencing of the bgl operon at two levels: upstream by BglJ and LeuO and downstream by DnaKJ. Microbiology 151:3349-3359
CAS PubMed Google Scholar
Madrid C, Nieto JM, Juarez A (2002a) Role of the Hha/YmoA family of proteins in the thermoregulation of the expression of virulence factors. Int J Med Microbiol 291:425-432
CAS PubMed Google Scholar
Madrid C, Nieto JM, Paytubi S, Falconi M, Gualerzi CO, Juarez A (2002b) Temperature- and H-NS-dependent regulation of a plasmid-encoded virulence operon expressing Escherichia coli hemolysin. J Bacteriol 184:5058-5066
CAS PubMed Google Scholar
Madrid C, Balsalobre C, Garcia J, Juarez A (2007a) The novel Hha/YmoA family of nucleoid-associated proteins: use of structural mimicry to modulate the activity of the H-NS family of proteins. Mol Microbiol 63:7-14
CAS PubMed Google Scholar
Madrid C, Garcia J, Pons M, Juarez A (2007b) Molecular evolution of the H-NS protein: interaction with Hha-like proteins is restricted to enterobacteriaceae. J Bacteriol 189:265-268
CAS PubMed Google Scholar
Majdalani N, Cunning C, Sledjeski D, Elliott T, Gottesman S (1998) DsrA RNA regulates translation of RpoS message by an anti-antisense mechanism, independent of its action as an antisilencer of transcription. Proc Natl Acad Sci USA 95:12462-12467
CAS PubMed Google Scholar
Mangan MW, Lucchini S, Danino V, Croinin TO, Hinton JC, Dorman CJ (2006) The integration host factor (IHF) integrates stationary-phase and virulence gene expression in Salmonella enterica serovar Typhimurium. Mol Microbiol 59:1831-1847
CAS PubMed Google Scholar
Manna D, Wang X, Higgins NP (2001) Mu and IS1 transpositions exhibit strong orientation bias at the Escherichia coli bgl locus. J Bacteriol 183:3328-3335
CAS PubMed Google Scholar
Marschall C, Labrousse V, Kreimer M, Weichart D, Kolb A, Hengge-Aronis R (1998) Molecular analysis of the regulation of csiD, a carbon starvation-inducible gene in Escherichia coli that is exclusively dependent on sigma s and requires activation by cAMP-CRP. J Mol Biol 276:339-353
CAS PubMed Google Scholar
Masi M, Pages JM, Villard C, Pradel E (2005) The eefABC multidrug efflux pump operon is repressed by H-NS in Enterobacter aerogenes. J Bacteriol 187:3894-3897
CAS PubMed Google Scholar
Masson C, Menaa F, Pinon-Lataillade G, Frobert Y, Chevillard S, Radicella JP, Sarasin A, Angulo JF (2003) Global genome repair is required to activate KIN17, a UVC-responsive gene involved in DNA replication. Proc Natl Acad Sci USA 100:616-621
CAS PubMed Google Scholar
May G, Dersch P, Haardt M, Middendorf A, Bremer E (1990) The osmZ (bglY) gene encodes the DNA-binding protein H-NS (H1a), a component of the Escherichia coli K12 nucleoid. Mol Gen Genet 224:81-90
CAS PubMed Google Scholar
McClelland M, Florea L, Sanderson K, Clifton SW, Parkhill J, Churcher C, Dougan G, Wilson RK, Miller W (2000) Comparison of the Escherichia coli K-12 genome with sampled genomes of a Klebsiella pneumoniae and three Salmonella enterica serovars, Typhimurium, Typhi and Paratyphi. Nucleic Acids Res 28:4974-4986
CAS PubMed Google Scholar
McClelland M, Sanderson KE, Spieth J, Clifton SW, Latreille P, Courtney L, Porwollik S, Ali J, Dante M, Du F, Hou S, Layman D, Leonard S, Nguyen C, Scott K, Holmes A, Grewal N, Mulvaney E, Ryan E, Sun H, Florea L, Miller W, Stoneking T, Nhan M, Waterston R, Wilson RK (2001) Complete genome sequence of Salmonella enterica serovar Typhimurium LT2. Nature 413:852-856
Google Scholar
McFeeters RL, Altieri AS, Cherry S, Tropea JE, Waugh DS, Byrd RA (2007) The high-precision solution structure of Yersinia modulating protein YmoA provides insight into interaction with H-NS. Biochemistry 46:13975-13982
CAS PubMed Google Scholar
Mellies JL, Barron AM, Carmona AM (2007) Enteropathogenic and enterohemorrhagic Escherichia coli virulence gene regulation. Infect Immun 75:4199-4210
CAS PubMed Google Scholar
Mellies JL, Larabee FJ, Zarr MA, Horback KL, Lorenzen E, Mavor D (2008) Ler interdomain linker is essential for anti-silencing in enteropathogenic Escherichia coli. Microbiology 154:3624-3638
CAS PubMed Google Scholar
Mikulskis AV, Cornelis GR (1994) A new class of proteins regulating gene expression in enterobacteria. Mol Microbiol 11:77-86
CAS PubMed Google Scholar
Mikulskis AV, Delor I, Thi VH, Cornelis GR (1994) Regulation of the Yersinia enterocolitica enterotoxin Yst gene. Influence of growth phase, temperature, osmolarity, pH and bacterial host factors. Mol Microbiol 14:905-915
CAS PubMed Google Scholar
Mojica FJ, Higgins CF (1997) In vivo supercoiling of plasmid and chromosomal DNA in an Escherichia coli hns mutant. J Bacteriol 179:3528-3533
CAS PubMed Google Scholar
Mourino M, Madrid C, Balsalobre C, Prenafeta A, Munoa F, Blanco J, Blanco M, Blanco JE, Juarez A (1996) The Hha protein as a modulator of expression of virulence factors in Escherichia coli. Infect Immun 64:2881-2884
CAS PubMed Google Scholar
Mourino M, Balsalobre C, Madrid C, Nieto JM, Prenafeta A, Munoa FJ, Juarez A (1998) Osmolarity modulates the expression of the Hha protein from Escherichia coli. FEMS Microbiol Lett 160:225-229
CAS PubMed Google Scholar
Mukerji M, Mahadevan S (1997) Characterization of the negative elements involved in silencing the bgl operon of Escherichia coli: possible roles for DNA gyrase, H-NS, and CRP-cAMP in regulation. Mol Microbiol 24:617-627
CAS PubMed Google Scholar
Müller CM, Dobrindt U, Nagy G, Emody L, Uhlin BE, Hacker J (2006) Role of histone-like proteins H-NS and StpA in expression of virulence determinants of uropathogenic Escherichia coli. J Bacteriol 188:5428-5438
PubMed Google Scholar
Murphree D, Froehlich B, Scott JR (1997) Transcriptional control of genes encoding CS1 pili: negative regulation by a silencer and positive regulation by Rns. J Bacteriol 179:5736-5743
CAS PubMed Google Scholar
Nagarajavel V, Madhusudan S, Dole S, Rahmouni AR, Schnetz K (2007) Repression by binding of H-NS within the transcription unit. J Biol Chem 282:23622-23630
CAS PubMed Google Scholar
Nair S, Finkel SE (2004) Dps protects cells against multiple stresses during stationary phase. J Bacteriol 186:4192-4198
CAS PubMed Google Scholar
Navarre WW, Halsey TA, Walthers D, Frye J, McClelland M, Potter JL, Kenney LJ, Gunn JS, Fang FC, Libby SJ (2005) Co-regulation of Salmonella enterica genes required for virulence and resistance to antimicrobial peptides by SlyA and PhoP/PhoQ. Mol Microbiol 56:492-508
CAS PubMed Google Scholar
Navarre WW, Porwollik S, Wang Y, McClelland M, Rosen H, Libby SJ, Fang FC (2006) Selective silencing of foreign DNA with low GC content by the H-NS protein in Salmonella. Science 313:236-238
CAS PubMed Google Scholar
Navarre WW, McClelland M, Libby SJ, Fang FC (2007) Silencing of xenogeneic DNA by H-NS-facilitation of lateral gene transfer in bacteria by a defense system that recognizes foreign DNA. Genes Dev 21:1456-1471
CAS PubMed Google Scholar
Nieto JM, Carmona M, Bolland S, Jubete Y, de la Cruz F, Juarez A (1991) The hha gene modulates haemolysin expression in Escherichia coli. Mol Microbiol 5:1285-1293
CAS PubMed Google Scholar
Nieto JM, Prenafeta A, Miquelay E, Torrades S, Juarez A (1998) Sequence, identification and effect on conjugation of the rmoA gene of plasmid R100-1. FEMS Microbiol Lett 169:59-66
CAS PubMed Google Scholar
Nieto JM, Madrid C, Prenafeta A, Miquelay E, Balsalobre C, Carrascal M, Juarez A (2000) Expression of the hemolysin operon in Escherichia coli is modulated by a nucleoid-protein complex that includes the proteins Hha and H-NS. Mol Gen Genet 263:349-358
CAS PubMed Google Scholar
Nieto JM, Madrid C, Miquelay E, Parra JL, Rodriguez S, Juarez A (2002) Evidence for direct protein-protein interaction between members of the enterobacterial Hha/YmoA and H-NS families of proteins. J Bacteriol 184:629-635
CAS PubMed Google Scholar
Nishino K, Yamaguchi A (2004) Role of histone-like protein H-NS in multidrug resistance of Escherichia coli. J Bacteriol 186:1423-1429
CAS PubMed Google Scholar
Noom MC, Navarre WW, Oshima T, Wuite GJ, Dame RT (2007) H-NS promotes looped domain formation in the bacterial chromosome. Curr Biol 17:R913-R914
CAS PubMed Google Scholar
Normand P, Lapierre P, Tisa LS, Gogarten JP, Alloisio N, Bagnarol E, Bassi CA, Berry AM, Bickhart DM, Choisne N, Couloux A, Cournoyer B, Cruveiller S, Daubin V, Demange N, Francino MP, Goltsman E, Huang Y, Kopp OR, Labarre L, Lapidus A, Lavire C, Marechal J, Martinez M, Mastronunzio JE, Mullin BC, Niemann J, Pujic P, Rawnsley T, Rouy Z, Schenowitz C, Sellstedt A, Tavares F, Tomkins JP, Vallenet D, Valverde C, Wall LG, Wang Y, Medigue C, Benson DR (2007) Genome characteristics of facultatively symbiotic Frankia sp. strains reflect host range and host plant biogeography. Genome Res 17:7-15
PubMed Google Scholar
Norte VA, Stapleton MR, Green J (2003) PhoP-responsive expression of the Salmonella enterica serovar Typhimurium slyA gene. J Bacteriol 185:3508-3514
CAS PubMed Google Scholar
Nougayrede JP, Fernandes PJ, Donnenberg MS (2003) Adhesion of enteropathogenic Escherichia coli to host cells. Cell Microbiol 5:359-372
CAS PubMed Google Scholar
Nye MB, Taylor RK (2003) Vibrio cholerae H-NS domain structure and function with respect to transcriptional repression of ToxR regulon genes reveals differences among H-NS family members. Mol Microbiol 50:427-444
CAS PubMed Google Scholar
Ó Cróinín T, Dorman CJ (2007) Expression of the Fis protein is sustained in late-exponential- and stationary-phase cultures of Salmonella enterica serovar Typhimurium grown in the absence of aeration. Mol Microbiol 66:237-251
Google Scholar
O’Gara JP, Dorman CJ (2000) Effects of local transcription and H-NS on inversion of the fim switch of Escherichia coli. Mol Microbiol 36:457-466
PubMed Google Scholar
Ochman H, Davalos LM (2006) The nature and dynamics of bacterial genomes. Science 311:1730-1733
CAS PubMed Google Scholar
Oh TJ, Jung IL, Kim IG (2001) The Escherichia coli SOS gene sbmC is regulated by H-NS and RpoS during the SOS induction and stationary growth phase. Biochem Biophys Res Commun 288:1052-1058
CAS PubMed Google Scholar
Ohta T, Ueguchi C, Mizuno T (1999) rpoS function is essential for bgl silencing caused by C-terminally truncated H-NS in Escherichia coli. J Bacteriol 181:6278-6283
CAS PubMed Google Scholar
Olekhnovich IN, Kadner RJ (2006) Crucial roles of both flanking sequences in silencing of the hilA promoter in Salmonella enterica. J Mol Biol 357:373-386
CAS PubMed Google Scholar
Olekhnovich IN, Kadner RJ (2007) Role of nucleoid-associated proteins Hha and H-NS in expression of Salmonella enterica activators HilD, HilC, and RtsA required for cell invasion. J Bacteriol 189:6882-6890
CAS PubMed Google Scholar
Olsen A, Arnqvist A, Hammar M, Sukupolvi S, Normark S (1993) The RpoS sigma factor relieves H-NS-mediated transcriptional repression of csgA, the subunit gene of fibronectin-binding curli in Escherichia coli. Mol Microbiol 7:523-536
CAS PubMed Google Scholar
Ono S, Goldberg MD, Olsson T, Esposito D, Hinton JC, Ladbury JE (2005) H-NS is a part of a thermally controlled mechanism for bacterial gene regulation. Biochem J 391:203-213
CAS PubMed Google Scholar
Oshima T, Ishikawa S, Kurokawa K, Aiba H, Ogasawara N (2006) Escherichia coli histone-like protein H-NS preferentially binds to horizontally acquired DNA in association with RNA polymerase. DNA Res 13:141-153
CAS PubMed Google Scholar
Overdier DG, Csonka LN (1992) A transcriptional silencer downstream of the promoter in the osmotically controlled proU operon of Salmonella typhimurium. Proc Natl Acad Sci USA 89:3140-3144
CAS PubMed Google Scholar
Owen-Hughes TA, Pavitt GD, Santos DS, Sidebotham JM, Hulton CS, Hinton JC, Higgins CF (1992) The chromatin-associated protein H-NS interacts with curved DNA to influence DNA topology and gene expression. Cell 71:255-265
CAS PubMed Google Scholar
Paci M, Pon CL, Canonaco MA, Gualerzi CO (1986) Proteins from the prokaryotic nucleoid. [1H]-NMR studies on Escherichia coli histone-like proteins NS and H-NS and their interactions with DNA. In: Gualerzi CO, Pon CL (eds) Bacterial chromatin. Springer-Verlag, Berlin, pp 135-154
Google Scholar
Pan CQ, Finkel SE, Cramton SE, Feng JA, Sigman DS, Johnson RC (1996) Variable structures of Fis-DNA complexes determined by flanking DNA-protein contacts. J Mol Biol 264:675-695
CAS PubMed Google Scholar
Paytubi S, Madrid C, Forns N, Nieto JM, Balsalobre C, Uhlin BE, Juarez A (2004) YdgT, the Hha paralogue in Escherichia coli, forms heteromeric complexes with H-NS and StpA. Mol Microbiol 54:251-263
CAS PubMed Google Scholar
Perez JC, Latifi T, Groisman EA (2008) Overcoming H-NS-mediated transcriptional silencing of horizontally acquired genes by the PhoP and SlyA proteins in Salmonella enterica. J Biol Chem 283:10773-10783
CAS PubMed Google Scholar
Pons JI, Rodriguez S, Madrid C, Juarez A, Nieto JM (2004) In vivo increase of solubility of overexpressed Hha protein by tandem expression with interacting protein H-NS. Protein Exp Purif 35:293-297
CAS Google Scholar
Porter ME, Dorman CJ (1994) A role for H-NS in the thermo-osmotic regulation of virulence gene expression in Shigella flexneri. J Bacteriol 176:4187-4191
CAS PubMed Google Scholar
Porter ME, Dorman CJ (1997) Positive regulation of Shigella flexneri virulence genes by integration host factor. J Bacteriol 179:6537-6550
CAS PubMed Google Scholar
Postow L, Hardy CD, Arsuaga J, Cozzarelli NR (2004) Topological domain structure of the Escherichia coli chromosome. Genes Dev 18:1766-1779
CAS PubMed Google Scholar
Prosseda G, Fradiani PA, Di Lorenzo M, Falconi M, Micheli G, Casalino M, Nicoletti M, Colonna B (1998) A role for H-NS in the regulation of the virF gene of Shigella and enteroinvasive Escherichia coli. Res Microbiol 149:15-25
CAS PubMed Google Scholar
Prosseda G, Falconi M, Giangrossi M, Gualerzi CO, Micheli G, Colonna B (2004) The virF promoter in Shigella: more than just a curved DNA stretch. Mol Microbiol 51:523-537
CAS PubMed Google Scholar
Pul U, Lux B, Wurm R, Wagner R (2008) Effect of upstream curvature and transcription factors H-NS and LRP on the efficiency of Escherichia coli rRNA promoters P1 and P2 - a phasing analysis. Microbiology 154:2546-2558
CAS PubMed Google Scholar
Rajkumari K, Gowrishankar J (2001) In vivo expression from the RpoS-dependent P1 promoter of the osmotically regulated proU operon in Escherichia coli and Salmonella enterica serovar Typhimurium: activation by rho and hns mutations and by cold stress. J Bacteriol 183:6543-6550
CAS PubMed Google Scholar
Renzoni D, Esposito D, Pfuhl M, Hinton JC, Higgins CF, Driscoll PC, Ladbury JE (2001) Structural characterization of the N-terminal oligomerization domain of the bacterial chromatin-structuring protein, H-NS. J Mol Biol 306:1127-1137
CAS PubMed Google Scholar
Riley M, Abe T, Arnaud MB, Berlyn MK, Blattner FR, Chaudhuri RR, Glasner JD, Horiuchi T, Keseler IM, Kosuge T, Mori H, Perna NT, Plunkett G 3rd, Rudd KE, Serres MH, Thomas GH, Thomson NR, Wishart D, Wanner BL (2006) Escherichia coli K-12: a cooperatively developed annotation snapshot - 2005. Nucleic Acids Res 34:1-9
CAS PubMed Google Scholar
Rimsky S (2004) Structure of the histone-like protein H-NS and its role in regulation and genome superstructure. Curr Opin Microbiol 7:109-114
CAS PubMed Google Scholar
Rimsky S, Spassky A (1990) Sequence determinants for H1 binding on Escherichia coli lac and gal promoters. Biochemistry 29:3765-3771
CAS PubMed Google Scholar
Rine J (1999) On the mechanism of silencing in Escherichia coli. Proc Natl Acad Sci USA 96:8309-8311
CAS PubMed Google Scholar
Robbe-Saule V, Schaeffer F, Kowarz L, Norel F (1997) Relationships between H-NS, sigma S, SpvR and growth phase in the control of spvR, the regulatory gene of the Salmonella plasmid virulence operon. Mol Gen Genet 256:333-347
CAS PubMed Google Scholar
Rocha EP, Danchin A (2002) Base composition bias might result from competition for metabolic resources. Trends Genet 18:291-294
CAS PubMed Google Scholar
Rodriguez S, Nieto JM, Madrid C, Juarez A (2005) Functional replacement of the oligomerization domain of H-NS by the Hha protein of Escherichia coli. J Bacteriol 187:5452-5459
CAS PubMed Google Scholar
Rouquette C, Serre MC, Lane D (2004) Protective role for H-NS protein in IS1 transposition. J Bacteriol 186:2091-2098
CAS PubMed Google Scholar
Schechter LM, Jain S, Akbar S, Lee CA (2003) The small nucleoid-binding proteins H-NS, HU, and Fis affect hilA expression in Salmonella enterica serovar Typhimurium. Infect Immun 71:5432-5435
CAS PubMed Google Scholar
Schneider R, Lurz R, Luder G, Tolksdorf C, Travers A, Muskhelishvili G (2001) An architectural role of the Escherichia coli chromatin protein FIS in organising DNA. Nucleic Acids Res 29:5107-5114
CAS PubMed Google Scholar
Schnetz K (1995) Silencing of Escherichia coli bgl promoter by flanking sequence elements. EMBO J 14:2545-2550
CAS PubMed Google Scholar
Schnetz K (2002) Silencing of the Escherichia coli bgl operon by RpoS requires Crl. Microbiology 148:2573-2578
CAS PubMed Google Scholar
Schnetz K (2008) Fine-tuned growth phase control of dps, encoding a DNA protection protein, by FIS and H-NS. Mol Microbiol 68:1345-1347
CAS PubMed Google Scholar
Schnetz K, Wang JC (1996) Silencing of the Escherichia coli bgl promoter: effects of template supercoiling and cell extracts on promoter activity in vitro. Nucleic Acids Res 24:2422-2428
CAS PubMed Google Scholar
Schroder O, Wagner R (2000) The bacterial DNA-binding protein H-NS represses ribosomal RNA transcription by trapping RNA polymerase in the initiation complex. J Mol Biol 298:737-748
CAS PubMed Google Scholar
Seputiene V, Suziedelis K, Normark S, Melefors O, Suziedeliene E (2004) Transcriptional analysis of the acid-inducible asr gene in enterobacteria. Res Microbiol 155:535-542
CAS PubMed Google Scholar
Shi X, Bennett GN (1994) Plasmids bearing hfq and the hns-like gene stpA complement hns mutants in modulating arginine decarboxylase gene expression in Escherichia coli. J Bacteriol 176:6769-6775
CAS PubMed Google Scholar
Shi Y, Latifi T, Cromie MJ, Groisman EA (2004) Transcriptional control of the antimicrobial peptide resistance ugtL gene by the Salmonella PhoP and SlyA regulatory proteins. J Biol Chem 279:38618-38625
CAS PubMed Google Scholar
Shiga Y, Sekine Y, Kano Y, Ohtsubo E (2001) Involvement of H-NS in transpositional recombination mediated by IS1. J Bacteriol 183:2476-2484
CAS PubMed Google Scholar
Shin M, Song M, Rhee JH, Hong Y, Kim YJ, Seok YJ, Ha KS, Jung SH, Choy HE (2005) DNA looping-mediated repression by histone-like protein H-NS: specific requirement of Esigma70 as a cofactor for looping. Genes Dev 19:2388-2398
CAS PubMed Google Scholar
Shindo H, Iwaki T, Ieda R, Kurumizaka H, Ueguchi C, Mizuno T, Morikawa S, Nakamura H, Kuboniwa H (1995) Solution structure of the DNA binding domain of a nucleoid-associated protein, H-NS, from Escherichia coli. FEBS Lett 360:125-131
CAS PubMed Google Scholar
Shindo H, Ohnuki A, Ginba H, Katoh E, Ueguchi C, Mizuno T, Yamazaki T (1999) Identification of the DNA binding surface of H-NS protein from Escherichia coli by heteronuclear NMR spectroscopy. FEBS Lett 455:63-69
CAS PubMed Google Scholar
Silphaduang U, Mascarenhas M, Karmali M, Coombes BK (2007) Repression of intracellular virulence factors in Salmonella by the Hha and YdgT nucleoid-associated proteins. J Bacteriol 189:3669-3673
CAS PubMed Google Scholar
Singh RK, Liburd J, Wardle SJ, Haniford DB (2008) The nucleoid binding protein H-NS acts as an anti-channeling factor to favor intermolecular Tn10 transposition and dissemination. J Mol Biol 376:950-962
CAS PubMed Google Scholar
Sledjeski D, Gottesman S (1995) A small RNA acts as an antisilencer of the H-NS-silenced rcsA gene of Escherichia coli. Proc Natl Acad Sci USA 92:2003-2007
CAS PubMed Google Scholar
Smyth CP, Lundback T, Renzoni D, Siligardi G, Beavil R, Layton M, Sidebotham JM, Hinton JC, Driscoll PC, Higgins CF, Ladbury JE (2000) Oligomerization of the chromatin-structuring protein H-NS. Mol Microbiol 36:962-972
CAS PubMed Google Scholar
Sondén B, Uhlin BE (1996) Coordinated and differential expression of histone-like proteins in Escherichia coli: regulation and function of the H-NS analog StpA. EMBO J 15:4970-4980
PubMed Google Scholar
Sonnenfield JM, Burns CM, Higgins CF, Hinton JC (2001) The nucleoid-associated protein StpA binds curved DNA, has a greater DNA-binding affinity than H-NS and is present in significant levels in hns mutants. Biochimie 83:243-249
CAS PubMed Google Scholar
Spassky A, Rimsky S, Garreau H, Buc H (1984) H1a, an E. coli DNA-binding protein which accumulates in stationary phase, strongly compacts DNA in vitro. Nucleic Acids Res 12:5321-5340
CAS PubMed Google Scholar
Spears PA, Schauer D, Orndorff PE (1986) Metastable regulation of type 1 piliation in Escherichia coli and isolation and characterization of a phenotypically stable mutant. J Bacteriol 168:179-185
CAS PubMed Google Scholar
Sperandio V, Mellies JL, Delahay RM, Frankel G, Crawford JA, Nguyen W, Kaper JB (2000) Activation of enteropathogenic Escherichia coli (EPEC) LEE2 and LEE3 operons by Ler. Mol Microbiol 38:781-793
CAS PubMed Google Scholar
Spurio R, Durrenberger M, Falconi M, La Teana A, Pon CL, Gualerzi CO (1992) Lethal overproduction of the Escherichia coli nucleoid protein H-NS: ultramicroscopic and molecular autopsy. Mol Gen Genet 231:201-211
CAS PubMed Google Scholar
Spurio R, Falconi M, Brandi A, Pon CL, Gualerzi CO (1997) The oligomeric structure of nucleoid protein H-NS is necessary for recognition of intrinsically curved DNA and for DNA bending. EMBO J 16:1795-1805
CAS PubMed Google Scholar
Stapleton MR, Norte VA, Read RC, Green J (2002) Interaction of the Salmonella typhimurium transcription and virulence factor SlyA with target DNA and identification of members of the SlyA regulon. J Biol Chem 277:17630-17637
CAS PubMed Google Scholar
Starcic-Erjavec M, van Putten JP, Gaastra W, Jordi BJ, Grabnar M, Zgur-Bertok D (2003) H-NS and Lrp serve as positive modulators of traJ expression from the Escherichia coli plasmid pRK100. Mol Genet Genom 270:94-102
CAS Google Scholar
Stella S, Spurio R, Falconi M, Pon CL, Gualerzi CO (2005) Nature and mechanism of the in vivo oligomerization of nucleoid protein H-NS. EMBO J 24:2896-2905
CAS PubMed Google Scholar
Stella S, Falconi M, Lammi M, Gualerzi CO, Pon CL (2006) Environmental control of the in vivo oligomerization of nucleoid protein H-NS. J Mol Biol 355:169-174
CAS PubMed Google Scholar
Stoebel DM, Free A, Dorman CJ (2008) Anti-silencing: overcoming H-NS-mediated repression of transcription in Gram-negative enteric bacteria. Microbiology 154:2533-2545
CAS PubMed Google Scholar
Stonehouse E, Kovacikova G, Taylor RK, Skorupski K (2008) Integration host factor positively regulates virulence gene expression in Vibrio cholerae. J Bacteriol 190:4736-4748
CAS PubMed Google Scholar
Stover CK, Pham XQ, Erwin AL, Mizoguchi SD, Warrener P, Hickey MJ, Brinkman FS, Hufnagle WO, Kowalik DJ, Lagrou M, Garber RL, Goltry L, Tolentino E, Westbrock-Wadman S, Yuan Y, Brody LL, Coulter SN, Folger KR, Kas A, Larbig K, Lim R, Smith K, Spencer D, Wong GK, Wu Z, Paulsen IT, Reizer J, Saier MH, Hancock RE, Lory S, Olson MV (2000) Complete genome sequence of Pseudomonas aeruginosa PA01, an opportunistic pathogen. Nature 406:959-964
CAS PubMed Google Scholar
Suzuki T, Ueguchi C, Mizuno T (1996) H-NS regulates OmpF expression through micF antisense RNA in Escherichia coli. J Bacteriol 178:3650-3653
CAS PubMed Google Scholar
Swingle B, O’Carroll M, Haniford D, Derbyshire KM (2004) The effect of host-encoded nucleoid proteins on transposition: H-NS influences targeting of both IS903 and Tn10. Mol Microbiol 52:1055-1067
CAS PubMed Google Scholar
Tamas I, Klasson L, Canback B, Naslund AK, Eriksson AS, Wernegreen JJ, Sandstrom JP, Moran NA, Andersson SG (2002) 50 million years of genomic stasis in endosymbiotic bacteria. Science 296:2376-2379
CAS PubMed Google Scholar
Tendeng C, Bertin PN (2003) H-NS in Gram-negative bacteria: a family of multifaceted proteins. Trends Microbiol 11:511-518
CAS PubMed Google Scholar
Tendeng C, Badaut C, Krin E, Gounon P, Ngo S, Danchin A, Rimsky S, Bertin P (2000) Isolation and characterization of vicH, encoding a new pleiotropic regulator in Vibrio cholerae. J Bacteriol 182:2026-2032
CAS PubMed Google Scholar
Tendeng C, Krin E, Soutourina OA, Marin A, Danchin A, Bertin PN (2003a) A novel H-NS-like protein from an antarctic psychrophilic bacterium reveals a crucial role for the N-terminal domain in thermal stability. J Biol Chem 278:18754-18760
CAS PubMed Google Scholar
Tendeng C, Soutourina OA, Danchin A, Bertin PN (2003b) MvaT proteins in Pseudomonas spp.: a novel class of H-NS-like proteins. Microbiology 149:3047-3050
CAS PubMed Google Scholar
Tietze E, Tschäpe H (1994) Temperature-dependent expression of conjugation pili by IncM plasmid-harbouring bacteria: identification of plasmid-encoded regulatory functions. J Basic Microbiol 34:105-116
CAS PubMed Google Scholar
Timchenko T, Bailone A, Devoret R (1996) Btcd, a mouse protein that binds to curved DNA, can substitute in Escherichia coli for H-NS, a bacterial nucleoid protein. EMBO J 15:3986-3992
CAS PubMed Google Scholar
Tippner D, Wagner R (1995) Fluorescence analysis of the Escherichia coli transcription regulator H-NS reveals two distinguishable complexes dependent on binding to specific or nonspecific DNA sites. J Biol Chem 270:22243-22247
CAS PubMed Google Scholar
Tippner D, Afflerbach H, Bradaczek C, Wagner R (1994) Evidence for a regulatory function of the histone-like Escherichia coli protein H-NS in ribosomal RNA synthesis. Mol Microbiol 11:589-604
CAS PubMed Google Scholar
Tissier A, Kannouche P, Mauffrey P, Allemand I, Frelat G, Devoret R, Angulo JF (1996) Molecular cloning and characterization of the mouse Kin17 gene coding for a Zn-finger protein that preferentially recognizes bent DNA. Genomics 38:238-242
CAS PubMed Google Scholar
Torres AG, Lopez-Sanchez GN, Milflores-Flores L, Patel SD, Rojas-Lopez M, Martinez de la Pena CF, Arenas-Hernandez MM, Martinez-Laguna Y (2007) Ler and H-NS, regulators controlling expression of the long polar fimbriae of Escherichia coli O157:H7. J Bacteriol 189:5916-5928
CAS PubMed Google Scholar
Tran HJ, Heroven AK, Winkler L, Spreter T, Beatrix B, Dersch P (2005) Analysis of RovA, a transcriptional regulator of Yersinia pseudotuberculosis virulence that acts through antirepression and direct transcriptional activation. J Biol Chem 280:42423-42432
CAS PubMed Google Scholar
Travers A, Schneider R, Muskhelishvili G (2001) DNA supercoiling and transcription in Escherichia coli: the FIS connection. Biochimie 83:213-217
CAS PubMed Google Scholar
Tupper AE, Owen-Hughes TA, Ussery DW, Santos DS, Ferguson DJ, Sidebotham JM, Hinton JC, Higgins CF (1994) The chromatin-associated protein H-NS alters DNA topology in vitro. EMBO J 13:258-268
CAS PubMed Google Scholar
Turner EC, Dorman CJ (2007) H-NS antagonism in Shigella flexneri by VirB, a virulence gene transcription regulator that is closely related to plasmid partition factors. J Bacteriol 189:3403-3413
CAS PubMed Google Scholar
Typas A, Hengge R (2006) Role of the spacer between the -35 and -10 regions in sigmaS promoter selectivity in Escherichia coli. Mol Microbiol 59:1037-1051
CAS PubMed Google Scholar
Typas A, Becker G, Hengge R (2007) The molecular basis of selective promoter activation by the sigmaS subunit of RNA polymerase. Mol Microbiol 63:1296-1306
CAS PubMed Google Scholar
Ueguchi C, Kakeda M, Mizuno T (1993) Autoregulatory expression of the Escherichia coli hns gene encoding a nucleoid protein: H-NS functions as a repressor of its own transcription. Mol Gen Genet 236:171-178
CAS PubMed Google Scholar
Ueguchi C, Suzuki T, Yoshida T, Tanaka K, Mizuno T (1996) Systematic mutational analysis revealing the functional domain organization of Escherichia coli nucleoid protein H-NS. J Mol Biol 263:149-162
CAS PubMed Google Scholar
Ueguchi C, Seto C, Suzuki T, Mizuno T (1997) Clarification of the dimerization domain and its functional significance for the Escherichia coli nucleoid protein H-NS. J Mol Biol 274:145-151
CAS PubMed Google Scholar
Ulanovsky L, Bodner M, Trifonov EN, Choder M (1986) Curved DNA: design, synthesis, and circularization. Proc Natl Acad Sci USA 83:862-866
CAS PubMed Google Scholar
Umanski T, Rosenshine I, Friedberg D (2002) Thermoregulated expression of virulence genes in enteropathogenic Escherichia coli. Microbiology 148:2735-2744
CAS PubMed Google Scholar
Uyar E, Kurokawa K, Yoshimura M, Ishikawa S, Ogasawara N, Oshima T (2009) Differential binding profiles of StpA in wild-type and hns mutant cells: a comparative analysis of cooperative partners by chromatin immunoprecipitation-microarray analysis. J Bacteriol 191:2388-2391
CAS PubMed Google Scholar
Vallet I, Diggle SP, Stacey RE, Camara M, Ventre I, Lory S, Lazdunski A, Williams P, Filloux A (2004) Biofilm formation in Pseudomonas aeruginosa: fimbrial cup gene clusters are controlled by the transcriptional regulator MvaT. J Bacteriol 186:2880-2890
CAS PubMed Google Scholar
van Passel MW, Marri PR, Ochman H (2008) The emergence and fate of horizontally acquired genes in Escherichia coli. PLoS Comput Biol 4:e1000059
PubMed Google Scholar
van Ulsen P, Hillebrand M, Zulianello L, van de Putte P, Goosen N (1996) Integration host factor alleviates the H-NS-mediated repression of the early promoter of bacteriophage Mu. Mol Microbiol 21:567-578
PubMed Google Scholar
van Ulsen P, Hillebrand M, Kainz M, Collard R, Zulianello L, van de Putte P, Gourse RL, Goosen N (1997a) Function of the C-terminal domain of the alpha subunit of Escherichia coli RNA polymerase in basal expression and integration host factor-mediated activation of the early promoter of bacteriophage Mu. J Bacteriol 179:530-537
PubMed Google Scholar
van Ulsen P, Hillebrand M, Zulianello L, van de Putte P, Goosen N (1997b) The integration host factor-DNA complex upstream of the early promoter of bacteriophage Mu is functionally symmetric. J Bacteriol 179:3073-3075
PubMed Google Scholar
Varshavsky AJ, Nedospasov SA, Bakayev VV, Bakayeva TG, Georgiev GP (1977) Histone-like proteins in the purified Escherichia coli deoxyribonucleoprotein. Nucleic Acids Res 4:2725-2745
CAS PubMed Google Scholar
Vivero A, Banos RC, Mariscotti JF, Oliveros JC, Garcia-del Portillo F, Juarez A, Madrid C (2008) Modulation of horizontally acquired genes by the Hha-YdgT proteins in Salmonella enterica serovar Typhimurium. J Bacteriol 190:1152-1156
CAS PubMed Google Scholar
Walthers D, Carroll RK, Navarre WW, Libby SJ, Fang FC, Kenney LJ (2007) The response regulator SsrB activates expression of diverse Salmonella pathogenicity island 2 promoters and counters silencing by the nucleoid-associated protein H-NS. Mol Microbiol 65:477-493
CAS PubMed Google Scholar
Wang MD, Schnitzer MJ, Yin H, Landick R, Gelles J, Block SM (1998) Force and velocity measured for single molecules of RNA polymerase. Science 282:902-907
CAS PubMed Google Scholar
Ward CM, Wardle SJ, Singh RK, Haniford DB (2007) The global regulator H-NS binds to two distinct classes of sites within the Tn10 transpososome to promote transposition. Mol Microbiol 64:1000-1013
CAS PubMed Google Scholar
Wardle SJ, O’Carroll M, Derbyshire KM, Haniford DB (2005) The global regulator H-NS acts directly on the transpososome to promote Tn10 transposition. Genes Dev 19:2224-2235
CAS PubMed Google Scholar
Waterman SR, Small PL (2003) Transcriptional expression of Escherichia coli glutamate-dependent acid resistance genes gadA and gadBC in an hns rpoS mutant. J Bacteriol 185:4644-4647
CAS PubMed Google Scholar
Westermark M, Oscarsson J, Mizunoe Y, Urbonaviciene J, Uhlin BE (2000) Silencing and activation of ClyA cytotoxin expression in Escherichia coli. J Bacteriol 182:6347-6357
CAS PubMed Google Scholar
Westfall LW, Carty NL, Layland N, Kuan P, Colmer-Hamood JA, Hamood AN (2006) mvaT mutation modifies the expression of the Pseudomonas aeruginosa multidrug efflux operon mexEF-oprN. FEMS Microbiol Lett 255:247-254
CAS PubMed Google Scholar
Whitfield CR, Wardle SJ, Haniford DB (2009) The global bacterial regulator H-NS promotes transpososome formation and transposition in the Tn5 system. Nucleic Acids Res 37:309-321
CAS PubMed Google Scholar
Will WR, Frost LS (2006) Characterization of the opposing roles of H-NS and TraJ in transcriptional regulation of the F-plasmid tra operon. J Bacteriol 188:507-514
CAS PubMed Google Scholar
Will WR, Lu J, Frost LS (2004) The role of H-NS in silencing F transfer gene expression during entry into stationary phase. Mol Microbiol 54:769-782
CAS PubMed Google Scholar
Williams RM, Rimsky S, Buc H (1996) Probing the structure, function, and interactions of the Escherichia coli H-NS and StpA proteins by using dominant negative derivatives. J Bacteriol 178:4335-4343
CAS PubMed Google Scholar
Williamson HS, Free A (2005) A truncated H-NS-like protein from enteropathogenic Escherichia coli acts as an H-NS antagonist. Mol Microbiol 55:808-827
CAS PubMed Google Scholar
Wolf T, Janzen W, Blum C, Schnetz K (2006) Differential dependence of StpA on H-NS in autoregulation of stpA and in regulation of bgl. J Bacteriol 188:6728-6738
CAS PubMed Google Scholar
Wyborn NR, Stapleton MR, Norte VA, Roberts RE, Grafton J, Green J (2004) Regulation of Escherichia coli hemolysin E expression by H-NS and Salmonella SlyA. J Bacteriol 186:1620-1628
CAS PubMed Google Scholar
Xia Y, Forsman K, Jass J, Uhlin BE (1998) Oligomeric interaction of the PapB transcriptional regulator with the upstream activating region of pili adhesin gene promoters in Escherichia coli. Mol Microbiol 30:513-523
CAS PubMed Google Scholar
Yamada H, Muramatsu S, Mizuno T (1990) An Escherichia coli protein that preferentially binds to sharply curved DNA. J Biochem (Tokyo) 108:420-425
CAS Google Scholar
Yamashino T, Ueguchi C, Mizuno T (1995) Quantitative control of the stationary phase-specific sigma factor, sigma S, in Escherichia coli: involvement of the nucleoid protein H-NS. EMBO J 14:594-602
CAS PubMed Google Scholar
Yang J, Tauschek M, Strugnell R, Robins-Browne RM (2005) The H-NS protein represses transcription of the eltAB operon, which encodes heat-labile enterotoxin in enterotoxigenic Escherichia coli, by binding to regions downstream of the promoter. Microbiology 151:1199-1208
CAS PubMed Google Scholar
Yarmolinsky M (2000) Transcriptional silencing in bacteria. Curr Opin Microbiol 3:138-143
CAS PubMed Google Scholar
Yee A, Chang X, Pineda-Lucena A, Wu B, Semesi A, Le B, Ramelot T, Lee GM, Bhattacharyya S, Gutierrez P, Denisov A, Lee CH, Cort JR, Kozlov G, Liao J, Finak G, Chen L, Wishart D, Lee W, McIntosh LP, Gehring K, Kennedy MA, Edwards AM, Arrowsmith CH (2002) An NMR approach to structural proteomics. Proc Natl Acad Sci USA 99:1825-1830
CAS PubMed Google Scholar
Yu RR, DiRita VJ (2002) Regulation of gene expression in Vibrio cholerae by ToxT involves both antirepression and RNA polymerase stimulation. Mol Microbiol 43:119-134
CAS PubMed Google Scholar
Zhang A, Belfort M (1992) Nucleotide sequence of a newly-identified Escherichia coli gene, stpA, encoding an H-NS-like protein. Nucleic Acids Res 20:6735
CAS PubMed Google Scholar
Zhang A, Derbyshire V, Salvo JL, Belfort M (1995) Escherichia coli protein StpA stimulates self-splicing by promoting RNA assembly in vitro. RNA 1:783-793
CAS PubMed Google Scholar
Zhang A, Rimsky S, Reaban ME, Buc H, Belfort M (1996) Escherichia coli protein analogs StpA and H-NS: regulatory loops, similar and disparate effects on nucleic acid dynamics. EMBO J 15:1340-1349
CAS PubMed Google Scholar
Zhang J, Zeuner Y, Kleefeld A, Unden G, Janshoff A (2004) Multiple site-specific binding of Fis protein to Escherichia coli nuoA-N promoter DNA and its impact on DNA topology visualised by means of scanning force microscopy. Chembiochem 5:1286-1289
CAS PubMed Google Scholar
Zhou Y, Gottesman S (2006) Modes of regulation of RpoS by H-NS. J Bacteriol 188:7022-7025
CAS PubMed Google Scholar
Zuber F, Kotlarz D, Rimsky S, Buc H (1994) Modulated expression of promoters containing upstream curved DNA sequences by the Escherichia coli nucleoid protein H-NS. Mol Microbiol 12:231-240
CAS PubMed Google Scholar

Download references

Acknowledgements

I would like to acknowledge the help of Sabrina Ali and Robin Imperial in assembling the table of published hns mutants and their phenotypes. I would further like to thank David Haniford, Blair Gordon, and Simon Dove for critical reading of portions of the manuscript.

Author information

Authors and Affiliations

Department of Molecular Genetics, University of Toronto, 1 King’s College Circle – Room 4379, Toronto, Ontario, M5S 1A8, Canada
William Wiley Navarre

Authors

William Wiley Navarre
View author publications
You can also search for this author in PubMed Google Scholar

Corresponding author

Correspondence to William Wiley Navarre .

Editor information

Editors and Affiliations

Leiden Institute of Chemistry, Leiden University, Einsteinweg 55, 2333 CC, Leiden, Netherlands
Remus T. Dame (Faculty of Mathematics and Natural Sciences) (Faculty of Mathematics and Natural Sciences)
Division of Physics and Astronomy Section Physics of Complex Systems, VU University Amsterdam, De Boelelaan 1081, 1081 HV, Amsterdam, The Netherlands
Remus T. Dame (Faculty of Mathematics and Natural Sciences) (Faculty of Mathematics and Natural Sciences)
Department of Microbiology School of Genetics and Microbiology, University of Dublin Trinity College, Dublin 2, Ireland
Charles J. Dorman

Rights and permissions

Reprints and permissions

Copyright information

About this chapter

Cite this chapter

Navarre, W.W. (2010). H-NS as a Defence System. In: Dame, R.T., Dorman, C.J. (eds) Bacterial Chromatin. Springer, Dordrecht. https://doi.org/10.1007/978-90-481-3473-1_13

Download citation

DOI: https://doi.org/10.1007/978-90-481-3473-1_13
Publisher Name: Springer, Dordrecht
Print ISBN: 978-90-481-3472-4
Online ISBN: 978-90-481-3473-1
eBook Packages: Biomedical and Life SciencesBiomedical and Life Sciences (R0)

Publish with us

Policies and ethics