Skip to main content
SpringerLink
Log in

Genetic Variations in Spike Protein: Linking SARS-CoV-2 Variants to Clinical Outcomes

  • EXPERIMENTAL PAPERS
  • Published:
Molecular Genetics, Microbiology and Virology Aims and scope Submit manuscript

Abstract

The COVID-19 pandemic has witnessed the emergence of diverse variants of SARS-CoV-2, with spike proteins playing a pivotal role in mutation due to their extracellular projection and exposure to immune system pressures. Clinical manifestations of COVID-19 have shown significant variation, ranging from severe symptoms requiring ICU admission or resulting in fatality to asymptomatic cases. This study aims to investigate genetic variations in the spike protein among two distinct groups of SARS-CoV-2 sequences: asymptomatic and ICU/deceased patients. The objective is to explore the viral genetic factors associated with these two clinical outcomes. Our analysis reveals that four spike protein mutations (P26S, D253G, K417N, and D614G) may be partially linked to the ICU/deceased outcome. Additionally, the Omicron and Delta variants exhibit the highest proportions of overall asymptomatic and ICU/deceased patients, respectively. Further evaluation of the ratio of asymptomatic cases to ICU/deceased within a singular variant demonstrates that the Beta and Gamma variants elicit the greatest proportion of asymptomatic and ICU/deceased cases, respectively. In conclusion, our findings suggest a possible association between four spike protein mutations and the outcome of ICU admission or death. The Gamma variants demonstrate greater lethality, while the Delta variants are associated with higher mortality rates.

This is a preview of subscription content, log in via an institution to check access.

Access this article

Log in via an institution

Price excludes VAT (USA)
Tax calculation will be finalised during checkout.

Instant access to the full article PDF.

Institutional subscriptions

Fig. 1.
Fig. 2.
Fig. 3.
Fig. 4.

DATA AVAILABILITY

The data that support the findings of this study are available from the corresponding author upon reasonable request.

REFERENCES

  1. Kumar, A., et al., SARS-CoV-2-specific virulence factors in COVID-19, J. Med. Virol., 2021, vol. 93, no. 3, pp. 1343–1350.

    Article  PubMed  CAS  Google Scholar 

  2. Thye, A.Y.-K., et al., Emerging SARS-CoV-2 variants of concern (VOCs): An impending global crisis, Biomedicines, 2021, vol. 9, no. 10, p. 1303.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  3. Tracking SARS-CoV-2 Variants, World Health Organization, 2021.

  4. Wise, J., Covid-19: New coronavirus variant is identified in UK, BMJ, 2020, vol. 371, p. m4857.

    Article  PubMed  Google Scholar 

  5. Faria, N.R., et al., Genomic characterization of an emergent SARS-CoV-2 lineage in Manaus: Preliminary findings, Virological, 2021, vol. 372, pp. 815–821.

    CAS  Google Scholar 

  6. Bian, L., et al., Impact of the Delta variant on vaccine efficacy and response strategies, Expert Rev. Vaccines, 2021, vol. 20, no. 10, pp. 1201–1209.

    Article  PubMed  CAS  Google Scholar 

  7. Ali, A.M., et al., Disease severity and efficacy of homologous vaccination among patients infected with SARS-CoV-2 Delta or Omicron VOCs, compared to unvaccinated using main biomarkers, J. Med. Virol., 2022, vol. 94, no. 12, pp. 5867–5876.

    Article  PubMed  CAS  Google Scholar 

  8. Abdullah, H.M., et al., Severe refractory COVID-19 patients responding to convalescent plasma; A case series, Ann. Med. Surg., 2020, vol. 56, pp. 125–127.

    Article  Google Scholar 

  9. Romero, P.E., et al., The emergence of SARS-CoV-2 variant lambda (C. 37) in South America, Microbiol. Spectrum, 2021, vol. 9, no. 2, p. e00789-21.

    Article  CAS  Google Scholar 

  10. Chatterjee, D., et al., Antigenicity of the Mu (B. 1.621) and A. 2.5 SARS-CoV-2 spikes, Viruses, 2022, vol. 14, no. 1, p. 144.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  11. Mittal, A., Khattri, A., and Verma, V., Structural and antigenic variations in the spike protein of emerging SARS-CoV-2 variants, PLoS Pathog., 2022, vol. 18, no. 2, p. e1010260.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  12. Rashid, P. and Salih, G.F., Molecular and computational analysis of spike protein of newly emerged omicron variant in comparison to the delta variant of SARS-CoV-2 in Iraq, Mol. Biol. Rep., 2022, vol. 49, no. 8, pp. 7437–7445.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  13. Oran, D.P. and Topol, E.J., The proportion of SARS-CoV-2 infections that are asymptomatic: A systematic review, Ann. Intern. Med., 2021, vol. 174, no. 5, pp. 655–662.

    Article  PubMed  Google Scholar 

  14. Stokes, E.K., et al., Coronavirus disease 2019 case surveillance—United States, January 22–May 30, 2020, Morb. Mortal. Wkly. Rep., 2020, vol. 69, no. 24, p. 759.

    Article  CAS  Google Scholar 

  15. Jin, J.-M., et al., Gender differences in patients with COVID-19: Focus on severity and mortality, Front. Public Health, 2020, vol. 8, p. 152.

    Article  PubMed  PubMed Central  Google Scholar 

  16. Ulloa, A.C., et al., Estimates of SARS-CoV-2 Omicron variant severity in Ontario, Canada, JAMA, 2022, vol. 327, no. 13, pp. 1286–1288.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  17. Gasteiger, E., et al., ExPASy: The proteomics server for in-depth protein knowledge and analysis, Nucleic Acids Res., 2003, vol. 31, no. 13, pp. 3784–3788.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  18. Aksamentov, I., et al., Nextclade: Clade assignment, mutation calling and quality control for viral genomes, J. Open Source Software, 2021, vol. 6, no. 67, p. 3773.

    Article  Google Scholar 

  19. Waterhouse, A., et al., SWISS-MODEL: Homology modelling of protein structures and complexes, Nucleic Acids Res., 2018, vol. 46, no. W1, pp. W296–W303.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  20. Chen, C.-W., Lin, J., and Chu. Y.-W., iStable: off-the-shelf predictor integration for predicting protein stability changes, BMC Bioinf., 2013, vol. 14, no. 2, suppl., p. S55.

  21. Baer, C.F., Does mutation rate depend on itself, PLoS Biol., 2008, vol. 6, no. 2, p. e52.

    Article  PubMed  PubMed Central  Google Scholar 

  22. Ali, K.M., et al., Clinical outcomes and phylogenetic analysis in reflection with three predominant clades of SARS-CoV-2 variants, Eur. J. Clin. Invest., 2023, vol. 53, no. 9, p. e14004.

    Article  PubMed  CAS  Google Scholar 

  23. Hu, D., et al., Influence of age and gender on the epidemic of COVID-19, Wien. Klin. Wochenschr., 2021, vol. 133, no. 7, pp. 321–330.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  24. Rashid, P. and Salih, G.F., Genetic polymorphism between the Sorani and Hawrami Kurdish populations and COVID-19 outcome, Mol. Biol. Rep., 2023, vol. 50, no. 6, pp. 5177–5183.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  25. Fang, S., et al., Updated SARS-CoV-2 single nucleotide variants and mortality association, J. Med. Virol., 2021, vol. 93, no. 12, pp. 6525–6534.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  26. Groves, D.C., Rowland-Jones, S.L., and Angyal, A., The D614G mutations in the SARS-CoV-2 spike protein: Implications for viral infectivity, disease severity and vaccine design, Biochem. Biophys. Res. Commun., 2021, vol. 538, pp. 104–107.

    Article  PubMed  CAS  Google Scholar 

  27. Troyer, Z., et al., Extracellular vesicles carry SARS-CoV-2 spike protein and serve as decoys for neutralizing antibodies, J. Extracell. Vesicles, 2021, vol. 10, no. 8, p. e12112.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  28. Choi, H., et al., The viral phoenix: enhanced infectivity and immunity evasion of SARS-CoV-2 variants, Environ. Chem. Lett., 2021, vol. 20, no. 3, pp. 1–6.

    Google Scholar 

  29. McCallum, M., et al., N-terminal domain antigenic mapping reveals a site of vulnerability for SARS-CoV-2, Cell, 2021, vol. 184, no. 9, pp. 2332–2347.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  30. Wang, R., et al., Analysis of SARS-CoV-2 variant mutations reveals neutralization escape mechanisms and the ability to use ACE2 receptors from additional species, Immunity, 2021, vol. 54, no. 7, pp. 1611–1621.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  31. Becerra-Flores, M. and Cardozo, T., SARS-CoV-2 viral spike G614 mutation exhibits higher case fatality rate, Int. J. Clin. Pract., 2020, vol. 74, no. 8, p. e13525.

    Article  PubMed  CAS  Google Scholar 

  32. Mahmoudi Gomari, M., et al., Insight into molecular characteristics of SARS-CoV-2 spike protein following D614G point mutation, a molecular dynamics study, J. Biomol. Struct. Dyn., 2022, vol. 40, no. 12, pp. 5634–5642.

    Article  PubMed  CAS  Google Scholar 

  33. Miosge, L.A., et al., Comparison of predicted and actual consequences of missense mutations, Proc. Natl. Acad. Sci. U. S. A., 2015, vol. 112, no. 37, pp. E5189–E5198.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  34. Yu, W., et al., Proportion of asymptomatic infection and non-severe disease caused by SARS-CoV-2 Omicron variant: A systematic review and analysis, J. Med. Virol., 2022, vol. 94, no. 12, pp. 5790–5801.

    Article  PubMed  CAS  Google Scholar 

  35. Lorenzo-Redondo, R., Ozer, E.A. and Hultquist, J.F., Covid-19: Is omicron less lethal than delta?, Br. Med. J., 2022, vol. 2, no. 378, p. o1806

    Article  Google Scholar 

  36. Tegally, H., et al., Rapid replacement of the Beta variant by the Delta variant in South Africa, MedRxiv, 2021. https://doi.org/10.1101/2021.09.23.21264018.

  37. Saito, A., et al., SARS-CoV-2 spike P681R mutation, a hallmark of the Delta variant, enhances viral fusogenicity and pathogenicity, BioRxiv, 2021. https://doi.org/10.1101/2021.06.17.448820

  38. Florensa, D., et al., Severity of COVID-19 cases in the months of predominance of the Alpha and Delta variants, Sci. Rep., 2022, vol. 12, no. 1, pp. 1–6.

    Article  Google Scholar 

  39. Hendaus, M.A. and Jomha, F.A., Delta variant of COVID-19: A simple explanation, Qatar Med. J., 2021, vol. 2021, no. 3, p. 49.

    PubMed  PubMed Central  Google Scholar 

  40. Liu, W. and Li, H., COVID-19: Attacks Immune Cells and Interferences with Antigen Presentation through MHC-Like Decoy System, J. Immunother., 2023, vol. 1, no. 3, pp. 75–88.

    Article  Google Scholar 

  41. Álvarez-Díaz, D.A., et al., Clinical outcomes associated with Mu variant infection during the third epidemic peak of COVID-19 in Colombia, Int. J. Infect. Dis., 2022, vol. 125, pp. 149–152.

    Article  PubMed  PubMed Central  Google Scholar 

  42. Xie, X., et al., Emerging SARS-CoV-2 B.1.621/Mu variant is prominently resistant to inactivated vaccine-elicited antibodies, Zool. Res., 2021, vol. 42, no. 6, p. 789.

    Article  PubMed  PubMed Central  Google Scholar 

  43. Pascarella, S., et al., The SARS-CoV-2 Mu variant should not be left aside: It warrants attention for its immuno-escaping ability, J. Med. Virol., 2022, vol. 94, no. 6, pp. 2479–2486.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

Download references

ACKNOWLEDGMENTS

The authors like to thanks Dr. Dana I. Omer for consultation of statistical methods. As well as many thanks to Dr. Nahla M. Saeed for providing access to some laboratory facilities.

Funding

This work was supported by ongoing institutional funding. No additional grants to carry out or direct this particular research were obtained.

Author information

Authors and Affiliations

  1. Medical Laboratory Science Department, Komar University of Science and Technology, Sulaymaniyah, Iraq

    Peshnyar M. A. Rashid

  2. Department of Biology, College of Science, University of Sulaimani, Sulaimaniyah, Iraq

    Gaza F. Salih

Authors
  1. Peshnyar M. A. Rashid
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Gaza F. Salih
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

PMAR performed the lab work. All authors equally participated in writing, reviewing, and data analysis of the manuscript.

Corresponding author

Correspondence to Peshnyar M. A. Rashid.

Ethics declarations

CONFLICT OF INTEREST

The authors of this work declare that they have no conflicts of interest.

ETHICS APPROVAL AND CONSENT TO PARTICIPATE

In this study, all methods were carried out in accordance with the relevant institutional and national guidelines and regulations. Additionally, we vouch for the Ethics Licensing Committee of the Health Directorate’s approval for all experimental protocols (no. 8375 on May 20, 2021). We received verbal consent from an illiterate individual to utilize their samples that had previously been taken from them for diagnostic purposes.

Additional information

Publisher’s Note.

Allerton Press remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION

figure 5

Fig. S1. Agarose gel electrophoresis pattern shows PCR amplification of spike gene of the SARS-CoV-2. Lane L: DNA ladder (100 bp), Lane N: negative control, Lane P: positive control, Lane 1: 1190 bp, Lane 2: 1349 bp, Lane 3: 1329 bp, Lane 4: 917 bp.

Table S1.  List of primer designed for purpose of sequencing of spike gene

Primer name

Direction

Sequence

Amplicon size, bp

Suli-1f

Forward

tgtttttcttgttttattgccact

1190

Suli-1r

Reverse

tctgcatagacattagtaaagcagaga

Suli-2f

Forward

tgctgtagactgtgcacttga

1345

Suli-2r

Reverse

gatgtcttggtcatagacactgg

Suli-3f

Forward

gcacagaagtccctgttgct

1329

Suli-3r

Reverse

acaccatgaggtgctgactg

Suli-4f

Forward

gtggtcaaccaaaatgcaca

917

Suli-4r

Reverse

aaatttgcagcaggatccac

Table S2.  List of viral names, accession ID and patient status

 

Accession ID

Patients status

hCoV-19/Iraq/Sulaimani-1/2021

EPI_ISL_150388

ICU

hCoV-19/Iraq/Sulaimani-2/2021

EPI_ISL_150392

ICU

hCoV-19/Iraq/Sulaimani-3/2021

EPI_ISL_150392

ICU

hCoV-19/Iraq/Sulaimani-4/2021

EPI_ISL_150913

ICU

hCoV-19/Iraq/Sulaimani-5/2021

EPI_ISL_150913

ICU

hCoV-19/Iraq/Sulaimani-7/2021

EPI_ISL_150913

Asymptomatic

hCoV-19/Iraq/Sulaimani-9/2021

EPI_ISL_150913

Asymptomatic

hCoV-19/Iraq/Sulaimani-10/2021

EPI_ISL_150915

Asymptomatic

hCoV-19/Iraq/Sulaimani-2/2022

EPI_ISL_151531

ICU

hCoV-19/Iraq/Sulaimani-11/2021

EPI_ISL_658310

Asymptomatic

hCoV-19/Iraq/Sulaimani-1/2022

EPI_ISL_924634

Asymptomatic

hCoV-19/Iraq/Sulaimani-8/2021

EPI_ISL_924732

Asymptomatic

Table S3. Spike protein mutations for the asymptomatic and ICU patients in Sulaimani province and global scale, the predicted pathogenicity and stability of mutations are indicated by the letters D (indicated for deleterious), N (neutral), Dec. (reduction in stability), Inc. (increase in stability), and null (not predicted). The red color demonstrate (OR > 2) that may relate to ICU/deceased cases. The strong pink color illustrates the predicted deleterious mutation. The yellow indicate predicted mutation with increase in stability

Table S3. (Contd.)

Table S4. Statistical analysis of the SARS-CoV-2 variant in ICU/deceased, and asymptomatic patients found in the GISAID database The yellow highlight indicated a variant with OD < 0.5 that was related to asymptomatic COVID-19. The red highlight indicated an OD > 2 variant

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Rashid, P.M., Salih, G.F. Genetic Variations in Spike Protein: Linking SARS-CoV-2 Variants to Clinical Outcomes. Mol. Genet. Microbiol. Virol. 38, 185–196 (2023). https://doi.org/10.3103/S0891416823030072

Download citation

  • Received:

  • Revised:

  • Accepted:

  • Published:

  • Issue Date:

  • DOI: https://doi.org/10.3103/S0891416823030072

Keywords:

Search

Navigation