Advertisement

The AAPS Journal

, Volume 19, Issue 6, pp 1855–1863 | Cite as

siRNA-Mediated RNA Interference in Precision-Cut Tissue Slices Prepared from Mouse Lung and Kidney

  • Mitchel J. R. Ruigrok
  • Nalinie Maggan
  • Delphine Willaert
  • Henderik W. Frijlink
  • Barbro N. Melgert
  • Peter OlingaEmail author
  • Wouter L. J. Hinrichs
Open Access
Research Article

Abstract

Small interfering RNA (siRNA)-mediated RNAi interference (RNAi) is a powerful post-transcriptional gene silencing mechanism which can be used to study the function of genes in vitro (cell cultures) and in vivo (animal models). However, there is a translational gap between these models. Hence, there is a need for novel experimental models that combine the advantages of in vitro and in vivo models (e.g., simplicity, flexibility, throughput, and representability) to study the effects of siRNA. This need may be addressed by precision-cut tissue slices (PCTS), which represent an ex vivo model that mimics the structural and functional characteristics of a whole organ. The goal of this study was to investigate whether self-deliverable siRNA (Accell siRNA) can be used in precision-cut lung slices (PCLuS) and precision-cut kidney slices (PCKS) to achieve RNAi ex vivo. PCLuS and PCKS were prepared from mouse tissue, and they were subsequently incubated up to 48 h with no siRNA (untransfected), non-targeting Accell siRNA, or Gapdh-targeting Accell siRNA. Significant Gapdh mRNA silencing was achieved (PCLuS ~ 55%; PCKS ~ 40%) without compromising the viability and morphology of slices. Fluorescence microscopy confirmed that Accell siRNA diffused into PCLuS and PCKS. Spontaneous inflammation upon incubation was observed in PCLuS and PCKS as shown by a higher mRNA expression of pro-inflammatory cytokines Il1b, Il6, and Tnfa, although Accell siRNA appeared to diminish this response in PCLuS after 24 h. In conclusion, this ex vivo transfection model can be used to evaluate the effects of siRNA in relevant biological environments.

KEY WORDS

ex vivo gene silencing siRNA tissue slices transfection 

Abbreviations

18s

18S ribosomal RNA

ANOVA

Analysis of variance

ATP

Adenosine triphosphate

Birc5

Baculoviral inhibitor of apoptosis repeat-containing 5

Gapdh

Glyceraldehyde-3-phosphate dehydrogenase

H&E

Hematoxylin and eosin

Il1b

Interleukin 1 beta

Il6

Interleukin 6

KHB

Krebs-Henseleit buffer

PBS

Phosphate-buffered saline

PCKS

Precision-cut kidney slices

PCLuS

Precision-cut lung slices

PCR

Polymerase chain reaction

PCTS

Precision-cut tissue slices

PKR

Protein kinase R

PRR

Pattern recognition receptor

RIG-1

Retinoic-inducible gene 1

RNAi

RNA interference

TLR

Toll-like receptor

Tnfa

Tumor necrosis factor alpha

UW

University of Wisconsin

mRNA

Messenger RNA

qPCR

Real-time quantitative polymerase chain reaction

siRNA

Small interfering RNA

INTRODUCTION

Small interfering RNA (siRNA)-mediated RNA interference (RNAi) leads to the degradation of specific messenger RNA (mRNA), thereby limiting the production of a specific protein [1]. To that end, siRNA can be used, for instance, to decrease the expression of disease-related genes, to investigate the function of proteins, or to establish experimental models of disease. Therefore, the use of siRNA to induce RNAi in vitro (cell cultures) and in vivo (animal models) has been described in various publications [2, 3, 4]. However, there is a big translational gap between in vitro and in vivo models. In vitro models are known for their simplicity, flexibility, and high throughput but they lack a biological context. Conversely, in vivo models generate more biologically relevant data although they are more complex to use. Hence, there is an obvious need for novel experimental models that combine the advantages of in vitro and in vivo models to study the effects of siRNA.

This need may be addressed by using precision-cut tissue slices (PCTS). PCTS refer to viable explants, with a well-defined thickness and diameter, prepared from tissue (e.g., lung and kidney) that can be cultured ex vivo [5, 6]. In comparison to conventional in vitro models, PCTS offer crucial advantages. Firstly, PCTS comprise the structural and functional heterogeneity of tissues, including cell-matrix interactions and intercellular interactions. Moreover, interspecies comparisons regarding biological effects of siRNA are possible as PCTS can be prepared from animal and human tissue. PCTS can also be quickly prepared in a simple and reproducible manner with specialized equipment that maintains the viability of tissue during the slicing process. In addition, several experiments can be performed per animal as multiple PCTS can be prepared from a single piece of tissue. Lastly, PCTS can be incubated for up to 48–120 h, depending on the tissue type and species, which means they can be used to study endogenous metabolism, drug effects, and disease mechanisms [5, 7, 8, 9]. As such, PCTS appear to have potential as a novel experimental model to study the effects of siRNA.

Nevertheless, RNAi in PCTS requires the successful delivery of siRNA into the cytoplasm of cells. Because siRNA is negatively charged and does not readily pass cell membranes, researchers often use cationic nanocomplexes (e.g., polyplexes, lipoplexes, or lipopolyplexes) to achieve RNAi in vitro and in vivo [10]. Unfortunately, such nanocomplexes have a limited penetration into PCTS which appears to be dependent on particle size and electrostatic interactions between the particle and surrounding proteins; this could lead to aggregation of nanocomplexes [11,12]. To overcome this obstacle, self-deliverable siRNA could be used. Self-deliverable siRNA, which refers to siRNA conjugated with cell-penetrating peptides or sterols, requires no complexation with polymers or lipids to enable transport into cells [13]. The extent of diffusion through biological tissues is thought to be greater for self-deliverable siRNA as it is smaller than conventional nanocomplexes. Some publications have described the successful induction of RNAi in vivo upon administration of self-deliverable siRNA [14, 15]. Accordingly, PCTS could be an ideal model to timely assess effects of self-deliverable siRNA in both animal and human tissue.

Thus, the principal aim of this study was to investigate whether self-deliverable siRNA (Accell siRNA) can successfully silence mRNA expression in precision-cut lung slices (PCLuS) and precision-cut kidney slices (PCKS) prepared from mouse tissue. These organs were selected as PCLuS and PCKS represent non-solid and solid tissue. First, fluorescence microscopy and real-time quantitative polymerase chain reaction (qPCR) was used to assess the diffusion of Accell siRNA into slices and to determine whether RNAi was successfully induced, respectively. Next, we analyzed the adenosine triphosphate (ATP) content and morphology of slices to determine whether slices remained viable during transfections. Lastly, we studied the mRNA expression profile of pro-inflammatory cytokines (i.e., Il1b, Il6, and Tnfa) to determine whether spontaneous inflammation develops upon incubation and whether Accell siRNA can affect this (foreign nucleic acids can induce activation of the innate immune system) [16].

MATERIALS and METHODS

Animal Tissue

Tissue was obtained from C57BL/6J mice, which were housed under controlled conditions with a 12-hour light/dark cycle and free access to water and food (Central Animal Facility, University Medical Center Groningen, Groningen, The Netherlands). The lungs and kidneys were extracted in a terminal procedure conducted under isoflurane/O2 anesthesia (Nicholas Piramal, London, UK). Note, prior to being extracted, the lungs were inflated in situ with liquefied and pre-warmed (37°C) support medium containing 1.5% low-gelling-temperature agarose type VII (Sigma-Aldrich, Zwijndrecht, The Netherlands) and 0.9% NaCl (Merck, Darmstadt, Germany) to provide cutting support during the slicing process [5]. After extraction, organs were immediately placed in ice-cold University of Wisconsin (UW) preservation solution (DuPont Critical Care, Waukegab, USA). All experiments were approved by the Animal Ethical Committee of the University of Groningen (permit no. 6416AA).

Preparation of Slices

After the organ extraction, slices were prepared with a Krumdieck tissue slicer (Alabama Research and Development, Munford, USA), which was filled with ice-cold Krebs-Henseleit buffer (KHB) supplemented with 25 mM D-glucose (Merck), 25 mM NaHCO3 (Merck), and 10 mM HEPES (MP Biomedicals, Aurora, USA); saturated with carbogen (95% O2 and 5% CO2); and adjusted to a pH of 7.4 [5]. To prevent loss of viability, slices were immediately transferred to ice-cold UW preservation solution after slicing. PCLuS and PCKS had a wet weight of 5–6 and 4–5 mg, respectively, with an estimated thickness of 250–350 μm and a diameter of ~ 5 mm.

Incubation of Slices

Slices were incubated individually in a 1-mL pre-warmed and oxygenated culture medium at 37°C under 5% CO2 and 80% O2, while gently shaken (90 cycles per minute). PCLuS culture medium was composed of Accell siRNA Delivery Media (GE Dharmacon, Lafayette, USA) supplemented with 100 U/mL penicillin-streptomycin (Life Technologies, Bleiswijk, The Netherlands), 50 μg/mL gentamicin (Life Technologies), and 0.1 mM non-essential amino acids (Life Technologies). PCKS culture medium was composed of Accell siRNA Delivery Media (GE Dharmacon) supplemented with 10 μg/mL ciprofloxacin (Fresenius Kabi, Zeist, The Netherlands), and 10 mM glucose (Sigma-Aldrich).

Transfection of Slices

After the slicing procedure, slices were either directly sampled or pre-incubated for 2 h in culture medium, as described in the previous section. Slices were subsequently transferred to the 1-mL pre-warmed and oxygenated culture medium supplemented with 10 μL Accell siRNA buffer (GE Dharmacon), fluorescent red non-targeting Accell siRNA (GE Dharmacon), non-targeting Accell siRNA pool (GE Dharmacon), or Gapdh-targeting Accell siRNA pool (mouse) (GE Dharmacon). Accell siRNA buffer contained 60 mM KCl, 6 mM HEPES (pH 7.5), and 0.2 mM MgCl2. Gapdh-targeting Accell siRNA was used to study specific mRNA silencing while non-targeting Accell siRNA was used to identify potential off-target effects. PCLuS culture medium contained 0 or 0.5 μM siRNA, whereas PCKS culture medium contained 0 or 1.0 μM siRNA. After 24 or 48 h of incubation, slices were collected for analysis.

Fluorescence

Confocal laser scanning microscopy was used to assess the diffusion of red fluorescent non-targeting Accell siRNA into slices. Upon sampling, slices were briefly washed (~ 5 s) in ice-cold phosphate-buffered saline (PBS), embedded in KP-CryoCompound (Klinipath, Duiven, The Netherlands), and stored at − 80°C until use. Cross sections of 4 μm were prepared from the slices by using a cryostat at − 20°C. The sections were afterwards dried for 30 min at room temperature in the dark. Thereafter, ProLong Diamond Antifade Mountant with DAPI (Fisher Scientific, Landsmeer, The Netherlands) was applied to the sections, which were subsequently covered with glass coverslips. The sections were then dried for 24 h at room temperature in the dark. Sections were stored at room temperature in the dark until further use. Images were taken with a Leica TCS SP8 confocal microscope (Leica Microsystems, Rijswijk, The Netherlands). Imaging of DAPI and red fluorescent non-targeting Accell siRNA (DY-547) was done through excitation using laser lines at wavelengths of 405 and 552 nm, respectively.

mRNA Expression

Silencing and inflammatory effects of Accell siRNA on mRNA expression were determined by qPCR. After transfection, three slices of the same condition were pooled, snap-frozen in liquid nitrogen, and stored at − 80°C until further use. As column-based RNA isolation procedures are incompatible with agarose-containing slices, total RNA of PCLuS was extracted using the Maxwell 16 LEV SimplyRNA Tissue Kit (Promega, Leiden, The Netherlands), whereas total RNA of PCKS was isolated with the FavorPrep Tissue Total RNA Mini Kit (Bio-Connect, Huissen, The Netherlands) [17]. Isolated RNA (750 ng) was reverse transcribed with the Reverse Transcription System (Promega), using an Eppendorf mastercycler (25°C for 10 min, 45°C for 60 min, and 95°C for 5 min). Next, the mRNA expression was analyzed by qPCR, using specific primers (Table I) and FastStart Universal SYBR Green Master (Roche, Almere, The Netherlands). The qPCR analysis was carried out with a ViiA7 real-time qPCR (Applied Biosystems, Bleiswijk, The Netherlands), using 1 cycle of 10 min at 95°C and 40 cycles of 15 s at 95°C, 30 s at 60 C, and 30 s at 72 C. Finally, mRNA expression was calculated as fold induction with the 2−ΔΔCt method, using 18s as reference gene.
Table I

Primer Details

Gene

Forward sequence (5′-3′)

Reverse sequence (5′-3′)

18s

CTTAGAGGGACAAGTGGCG

ACGCTGAGCCAGTCAGTGTA

Gapdh

ACAGTCCATGCCATCACTGC

GATCCACGACGGACACATTG

Il1b

TGAGCACCTTCTTTTCCTTCA

TTGTCTAATGGGAACGTCACAC

Il6

TGATGCTGGTGACAACCACGGC

TAAGCCTCCGACTTGTGAAGTGGTA

Tnfa

CTGTAGCCCACGTCGTAGC

TTGAGATCCATGCCGTTG

ATP Content

The ATP content in slices was quantified to determine whether Accell siRNA affected the viability. After transfection, slices were placed individually in tubes containing 1 mL of sonication solution (70% ethanol and 2 mM EDTA). The samples were subsequently snap-frozen in liquid nitrogen and stored at − 80°C until use. Next, the ATP content was analyzed with the ATP Bioluminescence Kit (Roche Diagnostics, Mannheim, Germany), as described previously [5]. Obtained ATP values (pmol) were normalized with respect to the total amount of protein (μg) which was determined with the RC DC Protein Assay (Bio Rad).

Morphology

Morphological analyses were performed to assess whether Accell siRNA affected the structural integrity of the slices. After the transfection, slices were fixed in 4% formalin at 4°C for 24 h. Next, slices were dehydrated in ethanol baths with increasing concentrations. Slices were subsequently cleared in xylene baths. Thereafter, slices were horizontally embedded in paraffin and sectioned (4 μm). Prior to staining with hematoxylin and eosin (H&E), sections were deparaffinized and rehydrated. The microscopic appearance of slices was assessed by evaluating the cytoplasm and the shape/staining of nuclei. Sections were scanned with a C9600 NanoZoomer (Hamamatsu Photonics, Hamamatsu City, Japan).

Statistics

Statistics were performed with GraphPad Prism 6.0 using one-way analyses of variance (ANOVA) followed by post hoc Tukey’s multiple comparisons tests. Differences between groups were considered to be statistically significant when p < .05. Note, qPCR data was analyzed statistically by using the ΔCt values, although the data is shown as fold induction (2−ΔΔCt).

RESULTS

siRNA Penetration into PCTS

Confocal laser scanning microscopy was used to confirm whether Accell siRNA penetrates into PCLuS and PCKS after 48 h of incubation (Fig. 1). Nuclei were stained with DAPI (blue) and showed a staining pattern consistent with morphology data (i.e., apoptotic regions at proximal tubules in PCKS). More importantly, fluorescent non-targeting Accell siRNA (red) was able to diffuse into PCLuS and PCKS, though the extent of diffusion was greater in PCLuS than in PCKS.
Fig. 1

siRNA penetration into PCTS. Slices were untransfected (a PCLuS, b PCKS) or treated with non-targeting Accell siRNA (c PCLuS, d PCKS) or fluorescent red non-targeting Accell siRNA (e PCLuS, f PCKS) for 48 h (n = 4). Slices were subsequently collected for analysis by confocal laser scanning microscopy. Cross sections (4 μm) were prepared with a cryostat and mounted with ProLong Diamond Antifade Mountant with DAPI (blue). Representative images (magnification 20×) are shown of independent experiments performed in triplicate

siRNA-Mediated RNAi in PCTS

qPCR analyses were performed to determine whether siRNA-mediated RNAi occurred in PCLuS and PCKS after being incubated with no siRNA (untransfected), non-targeting Accell siRNA, or Gapdh-targeting Accell siRNA for 48 h (Fig. 2). In PCLuS and PCKS, Gapdh-targeting Accell siRNA significantly lowered Gapdh mRNA expression by ~ 55 and ~ 40%, respectively, compared to untransfected slices. Furthermore, non-targeting Accell siRNA did not significantly change Gapdh mRNA expression in PCLuS and PCKS.
Fig. 2

siRNA-mediated RNAi in PCTS. a PCLuS and b PCKS were untransfected or treated with non-targeting Accell siRNA or Gapdh-targeting Accell siRNA for 48 h (n = 4). Thereafter, Gapdh mRNA expression was analyzed by qPCR. 18s was used as reference gene. Values represent individual experiments performed in triplicate and are accompanied with the arithmetic mean (horizontal line) ± standard error of the mean (error bars). Differences were statistically significant when p < .05 (one-way ANOVA, post hoc Tukey’s multiple comparisons test)

ATP Content During siRNA Transfections

The ATP content in PCLuS and PCKS was quantified to check whether Accell siRNA could negatively affect the viability after culturing slices up to 48 h (Fig. 3). No significant changes were observed in ATP content between PCLuS and PCKS treated with no siRNA, non-targeting Accell siRNA, and Gapdh-targeting Accell siRNA.
Fig. 3

ATP content during siRNA transfections. a PCLuS and b PCKS were untransfected or treated with non-targeting Accell siRNA or Gapdh-targeting Accell siRNA for 24 and 48 h (n = 4), after which the ATP content was determined. Values (relative to untransfected slices, which are set to 1.0, at 24 and 48 h) represent individual experiments performed in triplicate and are accompanied with the arithmetic mean (horizontal line) ± standard error of the mean (error bars). No significant differences were observed (one-way ANOVA, post hoc Tukey’s multiple comparisons test)

Morphology After siRNA Transfections

The morphology of PCLuS and PCKS was evaluated to identify whether Accell siRNA affected the structural integrity of slices after 48 h of incubation (Fig. 4). As shown, PCLuS maintained their structural integrity. No substantial differences were observed between untransfected slices and slices treated with non-targeting Accell siRNA or Gapdh-targeting Accell siRNA. In general, PCKS maintained their structural integrity after 48 h of incubation as well, with no differences between the treatment groups, though minor signs of cellular damage (e.g., cellular swelling and nuclear dissolution) were observed in proximal tubules.
Fig. 4

Morphology after siRNA transfections. Slices were untransfected (a PCLuS, b PCKS) or treated with non-targeting Accell siRNA (c PCLuS, d PCKS) or Gapdh-targeting Accell siRNA (e PCLuS, f PCKS) for 48 h (n = 4). Thereafter, slices were collected for morphological analysis. Paraffin sections (4 μm) were stained with H&E and subsequently scanned. Representative images (magnification 20×) are shown of independent experiments performed in triplicate

Spontaneous Inflammation in Untransfected PCTS

qPCR analyses were also performed to determine whether spontaneous inflammation occurred in untransfected PCLuS and PCKS (Fig. 5). To that end, mRNA expression of Il1b, Il6, and Tnfa was studied over time (0, 24, and 48 h). In PCLuS, mRNA expression of these pro-inflammatory cytokines was found to significantly increase over time. Tnfa mRNA expression in PCKS had a similar pattern as in PCLuS. However, in PCKS, different patterns were observed in Il1b and Il6 mRNA expression as it significantly increased during the first 24 h of culturing, after which it appeared to decrease again.
Fig. 5

Spontaneous inflammation in untransfected PCTS. Untransfected PCLuS and PCKS were sampled directly after slicing (0 h) and after an incubation of 24 or 48 h (n = 3–4). Thereafter, mRNA expression of Il1b (a PCLuS, d PCKS), Il6 (b PCLuS, e PCKS), and Tnfa (c PCLuS, f PCKS) was analyzed by qPCR. 18s was used as reference gene. Values represent individual experiments performed in triplicate and are accompanied with the arithmetic mean (horizontal line) ± standard error of the mean (error bars). Differences were statistically significant when p < .05 (one-way ANOVA, post hoc Tukey’s multiple comparisons test)

Pro-inflammatory Cytokines in Transfected PCTS

The impact of Accell siRNA on the mRNA expression of pro-inflammatory cytokines in PCLuS and PCKS was studied by qPCR as well (Fig. 6). After 24 h, non-targeting Accell siRNA and Gapdh-targeting Accell siRNA significantly decreased the mRNA expression of Il1b and Tnfa in PCLuS by approximately 50%, as compared to untransfected slices. Additionally, in comparison to untransfected PCLuS, PCLuS treated with non-targeting Accell siRNA had a significantly lower (~ 50%) Il6 mRNA expression after 48 h. In contrast, non-targeting Accell siRNA and Gapdh-targeting Accell siRNA did not significantly affect mRNA expression of pro-inflammatory cytokines in PCKS after an incubation up to 48 h.
Fig. 6

Pro-inflammatory cytokines in transfected PCTS. PCLuS and PCKS were untransfected or treated with non-targeting Accell siRNA or Gapdh-targeting Accell siRNA for 24 and 48 h (n = 4). Afterwards, the mRNA expression of Il1b (a PCLuS, d PCKS), Il6 (b PCLuS, e PCKS), and Tnfa (c PCLuS, f PCKS) was analyzed by qPCR. 18s was used as reference gene. Values (relative to untransfected slices, which are set to 1.0, at 24 and 48 h) represent individual experiments performed in triplicate and are accompanied with the arithmetic mean (horizontal line) ± standard error of the mean (error bars). Differences were statistically significant when p < .05 (one-way ANOVA, post hoc Tukey’s multiple comparisons test)

DISCUSSION

In this study, we set out to explore whether RNAi could be achieved in PCLuS and PCKS from mouse tissue. It was found that both PCLuS and PCKS were successfully transfected with Gapdh-targeting Accell siRNA. This resulted in significant silencing of Gapdh mRNA expression, without affecting the viability, and with limited effects on inflammation.

Slice Transfection

To induce RNAi in PCTS, diffusion of Accell siRNA into slices is required. In this study, it was demonstrated that fluorescent Accell siRNA diffused into PCLuS and PCKS, though the extent of diffusion was greater in PCLuS. Thereafter, we showed that RNAi was successfully induced in PCLuS and PCKS with Accell siRNA as significantly lower Gapdh mRNA expression was observed in slices treated with Gapdh-targeting Accell siRNA. Non-targeting Accell siRNA did not induce significant changes in Gapdh mRNA expression, suggesting no off-target effects. Preliminary experiments showed lower siRNA concentrations did not result in Gapdh mRNA silencing, whereas higher concentrations induced off-target effects (data not shown). A previous publication on polyplex-mediated siRNA transfections in PCTS prepared from tumor xenografts (solid tissue) described similar mRNA silencing (~ 50% after 96 h of incubation with 1 μM siRNA) but then for Birc5 mRNA [12]. However, their transfection technique cannot be compared to the technique presented here (siRNA polyplexes vs. self-deliverable siRNA) as different target mRNAs (Birc5 vs. Gapdh) and different tissue types (tumor tissue vs. primary tissue) were used. We also attempted to transfect PCTS with Lipofectamine RNAiMAX, which is a commonly used lipid transfection reagent to transfect continuous cell lines, but we did not observe any mRNA silencing (data not shown). However, such reagents have a limited transfection efficiency in primary cells [18]. As PCTS contain primary cells, it may have been the case that lipoplexes were unable to be taken up via endocytosis or to diffuse into PCTS. Accell siRNA does not depend on endocytosis and, consequently, can lead to RNAi in PCTS. In this present study, however, it appears a transfection was achieved in the majority of cells that are present in the slices, though further research is necessary to obtain direct evidence. To that end, immunohistochemistry could be used to identify if the transfection with siRNA was uniform. In addition, by using a double-staining for cell-specific markers, immunohistochemistry could be used to show which cells are affected by the siRNA [19]. As GAPDH is an intracellular house-keeping enzyme, further research on specific cell-matrix and cell-cell interactions was beyond the scope of this study, though such interactions could be assessed in future studies with, for instance, in situ polymerase chain reaction (PCR) [20].

Interestingly, differences were observed in Gapdh mRNA silencing and siRNA penetration between PCLuS and PCKS. PCKS required a higher concentration of Accell siRNA than PCLuS to produce mRNA silencing effects (1 vs. 0.5 μM). This might be caused by differences in the number of cells and the number of cells per unit volume. PCKS are prepared from solid tissue, whereas PCLuS are prepared from non-solid lung tissue inflated with agarose, which accounts for a large volume in slices. As a result, PCKS contain more cells than PCLuS [5]. Furthermore, the greater number of cells per unit volume in PCKS might have also affected the penetration of Accell siRNA by restraining the diffusion of siRNA from a region of high concentration to a region of low concentration. Researchers have previously shown that fluorescent lysozyme (~ 15 kDa) diffused into PCKS prepared from mice [21,22]. As such, it is not surprising that Accell siRNA, which has a comparable molecular weight to the fluorescent lysozyme, could also diffuse into PCKS. Unlike PCKS, PCLuS contained an agarose matrix with a pore size that enabled rapid diffusion of Accell siRNA, thereby resulting in a higher mRNA silencing. Though there are differences in the penetration of Accell siRNA between PCLuS and PCKS, it remains striking that 55% Gapdh mRNA silencing in PCLuS requires 0.5 μM Accell siRNA, whereas only 40% Gapdh mRNA silencing in PCKS requires 1.0 μM Accell siRNA. This suggests that the outermost cells in PCKS were more extensively transfected than the outermost cells in PCLuS. Nonetheless, the precise cellular and intracellular localization of Accell siRNA remains largely unclear and should be addressed in future research.

However, in neither PCLuS nor PCKS was GAPDH protein expression affected by Gapdh-targeting Accell siRNA after 48 h of incubation, as determined by Western blotting (data not shown). The discrepancy between Gapdh mRNA expression and GAPDH protein expression could have arisen from differences in their intracellular half-lives. The half-life of Gapdh mRNA in HeLa cells has been previously demonstrated to be ~ 8 h, whereas the half-lives of GAPDH protein in NRK-52E and A549 cells have been shown to be greater than 35 h [23, 24, 25]. This could mean that equilibration between Gapdh mRNA and protein levels requires more time because reductions in mRNA do not directly affect protein concentrations. Thus, it is worthwhile to select proteins with a quick turn-over or to extend the incubation time to allow for equilibration between mRNA and protein. However, extending the incubation time would require the optimization of incubation conditions in order to prevent myofibroblast overgrowth in PCLuS and to prevent apoptosis of the proximal tubules in PCKS.

Slice Viability

The effects of Accell siRNA on the viability of PCLuS and PCKS was studied from a biochemical and morphological perspective. In both PCLuS and PCKS, no significant differences in ATP content were observed between untransfected slices and slices treated with non-targeting Accell siRNA and Gapdh-targeting Accell siRNA. This indicates that the viability of slices was not affected. These results are in line with the morphology of the slices. PCLuS maintained all morphological features after 48 h of incubation. However, both untransfected and transfected PCKS contained some apoptotic proximal tubules (marked by loss of nuclei and swelling of cells), although the general morphology remained unaffected. Apoptosis in proximal tubules has been reported previously, and the authors suggested it is caused by a disturbed pre-urine flow [8,22]. As such, observed morphological changes in PCKS are not attributable to the siRNA.

Slice Inflammation

We also showed that spontaneous inflammation developed in untransfected PCLuS and PCKS, as marked by a significant increase in mRNA expression of pro-inflammatory markers Il1b, Il6, and Tnfa during incubation [16]. Conversely, in PCKS, mRNA expression of Il1b and Il6 appeared to decrease after 24 h, suggesting partial resolution. Nonetheless, cytokine production in PCTS is usually not as pronounced as immune responses in vivo because immune cells cannot be recruited from the blood [26]. As such, the extent of immune responses in PCTS is dependent on the number and type of immune cells in the tissue slice. The root-cause of this inflammatory response in slices is not fully understood, though it probably results from mechanical (e.g., slicing procedure itself) and chemical injury (e.g., warm/cold ischemia) which can lead to a wound-repair response [27]. Previous literature reported similar responses in precision-cut intestinal slices (PCIS) prepared from rat, mouse, and human tissue [28]. Furthermore, PCKS prepared from human tissue have also been characterized by inflammation upon incubation for up to 48 h [8].

We also studied whether Accell siRNA had an effect on the spontaneous inflammation in PCLuS and PCKS. In general, unmodified siRNA can activate the innate immune system via siRNA sequence-dependent or sequence-independent recognition by pattern recognition receptors (PRR) such as toll-like receptors (TLR) 3, 7, and 8; protein kinase R (PKR); and retinoic-inducible gene 1 (RIG-1) [16]. Activation of these receptors sets off an immune signaling cascade which leads to an inflammatory response characterized by an increased mRNA expression of pro-inflammatory cytokines Il1b, Il6, and Tnfa. Interestingly, non-targeting and Gapdh-targeting Accell siRNA appeared to diminish spontaneous inflammation in PCLuS as demonstrated by decreases in Il1b (at 24 h), Il6 (at 48 h), and Tnfa (at 24 h) mRNA expression. These effects were observed in PCLuS but not in PCKS. This could perhaps be caused by differences in the amount and type of immune cells present in both tissue types, as mentioned previously [6]. As these reductions are similar between non-targeting and Gapdh-targeting Accell siRNA, we hypothesize that Accell siRNA acts as an antagonist on siRNA sequence-independent proteins PKR and RIG-1, which are both present in the cytoplasm. It could be that the sterol modification on Accell siRNA inhibits the activation of PKR and RIG-1 through steric hindrance and, as a result, prevent activation of an immune signaling cascade. Nevertheless, the exact cause of immunosuppressive effects remains the subject of speculation. Further analysis was beyond the scope of this study.

CONCLUSION

In this study, we have demonstrated that PCLuS and PCKS can be successfully transfected with Accell siRNA to induce RNAi. Significant mRNA silencing was achieved without compromising the viability and structural integrity of the slices. Moreover, Accell siRNA did not induce an inflammatory response in either PCLuS or PCKS. As such, this ex vivo transfection model, which combines advantages of in vitro and in vivo models (e.g., simplicity, flexibility, throughput, and representability), could be used to decrease the expression of disease-related genes, to investigate the function of proteins, or to establish experimental models of disease in PCTS. Furthermore, PCTS can be prepared from human tissue which makes this transfection model particularly useful in translational research.

Notes

Acknowledgements

The authors thank Harry van Goor for the morphological evaluation of PCLuS and PCKS and Louise van Wijk for providing technical assistance during Western blotting analyses.

References

  1. 1.
    Hannon GJ. RNA interference. Nature. 2002;418:244–51.  https://doi.org/10.1038/418244a.CrossRefPubMedGoogle Scholar
  2. 2.
    Xia H, Mao Q, Paulson HL, Davidson BL. siRNA-mediated gene silencing in vitro and in vivo. Nat Biotechnol. 2002;20:1006–10.  https://doi.org/10.1038/nbt739.CrossRefPubMedGoogle Scholar
  3. 3.
    Minakuchi Y, Takeshita F, Kosaka N, Sasaki H, Yamamoto Y, Kouno M, et al. Atelocollagen-mediated synthetic small interfering RNA delivery for effective gene silencing in vitro and in vivo. Nucleic Acids Res. 2004;32:e109.  https://doi.org/10.1093/nar/gnh093.CrossRefPubMedPubMedCentralGoogle Scholar
  4. 4.
    Urban-Klein B, Werth S, Abuharbeid S, Czubayko F, Aigner A. RNAi-mediated gene-targeting through systemic application of polyethylenimine (PEI)-complexed siRNA in vivo. Gene Ther. 2005;12:461–6.  https://doi.org/10.1038/sj.gt.3302425.CrossRefPubMedGoogle Scholar
  5. 5.
    de Graaf IAM, Olinga P, de Jager MH, Merema MT, de Kanter R, van de Kerkhof EG, et al. Preparation and incubation of precision-cut liver and intestinal slices for application in drug metabolism and toxicity studies. Nat Protoc. 2010;5:1540–51.  https://doi.org/10.1038/nprot.2010.111.CrossRefPubMedGoogle Scholar
  6. 6.
    Westra IM, Pham BT, Groothuis GMM, Olinga P. Evaluation of fibrosis in precision-cut tissue slices. Xenobiotica. 2013;43:98–112.  https://doi.org/10.3109/00498254.2012.723151.CrossRefPubMedGoogle Scholar
  7. 7.
    Westra IM, Mutsaers HAM, Luangmonkong T, Hadi M, Oosterhuis D, de Jong KP, et al. Human precision-cut liver slices as a model to test antifibrotic drugs in the early onset of liver fibrosis. Toxicol. Vitr. 2016;35:77–85.  https://doi.org/10.1016/j.tiv.2016.05.012.CrossRefGoogle Scholar
  8. 8.
    Stribos EGD, Luangmonkong T, Leliveld AM, de Jong IJ, van Son WJ, Hillebrands J-L, et al. Precision-cut human kidney slices as a model to elucidate the process of renal fibrosis. Transl Res. 2016;170:8–16.e1.  https://doi.org/10.1016/j.trsl.2015.11.007.CrossRefPubMedGoogle Scholar
  9. 9.
    Starokozhko V, Vatakuti S, Schievink B, Merema MT, Asplund A, Synnergren J, et al. Maintenance of drug metabolism and transport functions in human precision-cut liver slices during prolonged incubation for 5 days. Arch Toxicol. 2017;91:2079–92.  https://doi.org/10.1007/s00204-016-1865-x.CrossRefPubMedGoogle Scholar
  10. 10.
    Ruigrok MJR, Frijlink HW, Hinrichs WLJ. Pulmonary administration of small interfering RNA: the route to go? J Control Release. 2016;235:14–23.  https://doi.org/10.1016/j.jconrel.2016.05.054.CrossRefPubMedGoogle Scholar
  11. 11.
    Lynch I, Dawson KA. Protein-nanoparticle interactions. Nano Today. 2008;3:40–7.  https://doi.org/10.1016/S1748-0132(08)70014-8.CrossRefGoogle Scholar
  12. 12.
    Merz L, Höbel S, Kallendrusch S, Ewe A, Bechmann I, Franke H, et al. Tumor tissue slice cultures as a platform for analyzing tissue-penetration and biological activities of nanoparticles. Eur J Pharm Biopharm. 2017;112:45–50.  https://doi.org/10.1016/j.ejpb.2016.11.013.CrossRefPubMedGoogle Scholar
  13. 13.
    De Paula D, Bentley MVLB, Mahato RI. Hydrophobization and bioconjugation for enhanced siRNA delivery and targeting. RNA. 2007;13:431–56.  https://doi.org/10.1261/rna.459807.CrossRefPubMedPubMedCentralGoogle Scholar
  14. 14.
    Hegde V, Hickerson RP, Nainamalai S, Campbell PA, Smith FJD, Mclean WHI, et al. In vivo gene silencing following non-invasive siRNA delivery into the skin using a novel topical formulation. J Control Release. 2014;196:355–62.  https://doi.org/10.1016/j.jconrel.2014.10.022.CrossRefPubMedPubMedCentralGoogle Scholar
  15. 15.
    Mazzeo C, Gámez C, Rodriguez Marco A, de Zulueta A, Sanz V, Bilbao I, et al. Gene silencing of SOCS3 by siRNA intranasal delivery inhibits asthma phenotype in mice. PLoS One. 2014;9:e91996.  https://doi.org/10.1371/journal.pone.0091996.CrossRefPubMedPubMedCentralGoogle Scholar
  16. 16.
    Whitehead KA, Dahlman JE, Langer RS, Anderson DG. Silencing or stimulation? siRNA delivery and the immune system. Annu Rev Chem Biomol Eng. 2011;2:77–96.  https://doi.org/10.1146/annurev-chembioeng-061010-114133.CrossRefPubMedGoogle Scholar
  17. 17.
    Niehof M, Hildebrandt T, Danov O, Arndt K, Koschmann J, Dahlmann F, et al. RNA isolation from precision-cut lung slices (PCLS) from different species. BMC Res Notes. 2017;10:121.  https://doi.org/10.1186/s13104-017-2447-6.CrossRefPubMedPubMedCentralGoogle Scholar
  18. 18.
    Merkel OM, Rubinstein I, Kissel T. siRNA delivery to the lung: what’s new? Adv Drug Deliv Rev. 2014;75:112–28.  https://doi.org/10.1016/j.addr.2014.05.018.CrossRefPubMedGoogle Scholar
  19. 19.
    van der Loos CM. Chromogens in multiple immunohistochemical staining used for visual assessment and spectral imaging: the colorful future. J Histotechnol. 2010;33:31–40.  https://doi.org/10.1179/his.2010.33.1.31.CrossRefGoogle Scholar
  20. 20.
    Bagasra O. Protocols for the in situ PCR-amplification and detection of mRNA and DNA sequences. Nat Protoc. 2007;2:2782–95.  https://doi.org/10.1038/nprot.2007.395.CrossRefPubMedGoogle Scholar
  21. 21.
    Halwer M, Nutting GC, Brice BA. Molecular weight of lactoglobulin, ovalbumin, lysozyme and serum albumin by light scattering 2. J Am Chem Soc. 1951;73:2786–90.  https://doi.org/10.1021/ja01150a105.CrossRefGoogle Scholar
  22. 22.
    Poosti F, Pham BT, Oosterhuis D, Poelstra K, van Goor H, Olinga P, et al. Precision-cut kidney slices (PCKS) to study development of renal fibrosis and efficacy of drug targeting ex vivo. Dis Model Mech. 2015;8:1227–36.  https://doi.org/10.1242/dmm.020172.CrossRefPubMedPubMedCentralGoogle Scholar
  23. 23.
    Dani C, Piechaczyk M, Audigier Y, Sabouty S, Cathala G, Marty L, et al. Characterization of the transcription products of glyceraldehyde 3-phosphate-dehydrogenase gene in HeLa cells. Eur J Biochem. 1984;145:299–304.  https://doi.org/10.1111/j.1432-1033.1984.tb08552.x.CrossRefPubMedGoogle Scholar
  24. 24.
    Franch HA. A mechanism regulating proteolysis of specific proteins during renal tubular cell growth. J Biol Chem. 2001;276:19126–31.  https://doi.org/10.1074/jbc.M101777200.CrossRefPubMedGoogle Scholar
  25. 25.
    Doherty MK, Hammond DE, Clague MJ, Gaskell SJ, Beynon RJ. Turnover of the human proteome: determination of protein intracellular stability by dynamic SILAC. J Proteome Res. 2009;8:104–12.  https://doi.org/10.1021/pr800641v.CrossRefPubMedGoogle Scholar
  26. 26.
    Sauer UG, Vogel S, Aumann A, Hess A, Kolle SN, Ma-Hock L, et al. Applicability of rat precision-cut lung slices in evaluating nanomaterial cytotoxicity, apoptosis, oxidative stress, and inflammation. Toxicol Appl Pharmacol. 2014;276:1–20.  https://doi.org/10.1016/j.taap.2013.12.017.CrossRefPubMedGoogle Scholar
  27. 27.
    Behrsing HP, Furniss MJ, Davis M, Tomaszewski JE, Parchment RE. In vitro exposure of precision-cut lung slices to 2-(4-amino-3-methylphenyl)-5-fluorobenzothiazole lysylamide dihydrochloride (NSC 710305, Phortress) increases inflammatory cytokine content and tissue damage. Toxicol Sci. 2013;131:470–9.  https://doi.org/10.1093/toxsci/kfs319.CrossRefPubMedGoogle Scholar
  28. 28.
    Iswandana R, Pham BT, van Haaften WT, Luangmonkong T, Oosterhuis D, Mutsaers HAM, et al. Organ- and species-specific biological activity of rosmarinic acid. Toxicol Vitr. 2016;32:261–8.  https://doi.org/10.1016/j.tiv.2016.01.009.CrossRefGoogle Scholar

Copyright information

© The Author(s) 2017

Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.

Authors and Affiliations

  • Mitchel J. R. Ruigrok
    • 1
  • Nalinie Maggan
    • 1
  • Delphine Willaert
    • 1
  • Henderik W. Frijlink
    • 1
  • Barbro N. Melgert
    • 2
  • Peter Olinga
    • 1
    Email author
  • Wouter L. J. Hinrichs
    • 1
  1. 1.Groningen Research Institute of Pharmacy, Department of Pharmaceutical Technology and BiopharmacyUniversity of GroningenGroningenThe Netherlands
  2. 2.Groningen Research Institute of Pharmacy, Department of Pharmacokinetics, Toxicology, and TargetingUniversity of GroningenGroningenThe Netherlands

Personalised recommendations