Trapped in the extinction vortex? Strong genetic effects in a declining vertebrate population

Table 2 Characteristics of microsatellite loci used to assess individual heterozygosity in southern dunlins (n = 76 individuals)

Locus*	No. of alleles	Allele size range (bp)	H_O	H_E
Calp2	8	127-147	0.684	0.711
Calp4	5	118-128	0.173^†	0.451
Calp5	4	112-118	0.500	0.590
Ruff1	9	175-215	0.868	0.842
Ruff6	7	123-147	0.763	0.779
Ruff9	6	180-200	0.763	0.791
Ruff10	6	252-280	0.421^†	0.649
PGT83^‡	8	155-171	0.697	0.754
4A11	2	143-145	0.167	0.359

For each locus, the name, the source species from which the locus was originally isolated and its reference are presented. Amplification results are shown as number of alleles, range of allele sizes in base pairs (bp), observed (H_O) and expected heterozygosity (H_E).
*Locus name (source species, reference): Calp2-5 (Calidris alpina, [54]); Ruff1-10 (Philomachus pugnax, [55]); PGT83 (Calidris canutus; D.M. Buehler, A.J. Baker, unpublished data; GenBank Accession number AY198173); 4A11 (Haematopus ostralegus, [56]).
^†Significant deviation from Hardy-Weinberg Equilibrium (χ² = 26.7, df = 1, p < 0.001, and χ² = 9.5, df = 1, p < 0.01, respectively).
^‡Primer sequence (5'-3'); F: AATCCGTTTCTGGGGACTGGG, R: TGCCTAATGCTGACTCACACC (A. Pauliny, unpublished data).