Advertisement

BMC Research Notes

, 11:725 | Cite as

Genetic diversity and chemical variability of Lippia spp. (Verbenaceae)

  • Milene C. Almeida
  • Ediedia S. Pina
  • Camila Hernandes
  • Sonia M. Zingaretti
  • Silvia H. Taleb-Contini
  • Fátima R. G. Salimena
  • Svetoslav N. Slavov
  • Simone K. Haddad
  • Suzelei C. França
  • Ana M. S. Pereira
  • Bianca W. Bertoni
Open Access
Research note

Abstract

Background

The genus Lippia comprises 150 species, most of which have interesting medicinal properties. Lippia sidoides (syn. L. origanoides) exhibits strong antimicrobial activity and is included in the phytotherapy program implemented by the Brazilian Ministry of Health. Since species of Lippia are morphologically very similar, conventional taxonomic methods are sometimes insufficient for the unambiguous identification of plant material that is required for the production of certified phytomedicines. Therefore, genetic and chemical analysis with chemotype identification will contribute to a better characterization of Lippia species.

Methods

Amplified Length Polymorphism and Internal Transcribed Spacer molecular markers were applied to determine the plants’ genetic variability, and the chemical variability of Lippia spp. was determined by essential oil composition.

Results

Amplified Length Polymorphism markers were efficient in demonstrating the intra and inter-specific genetic variability of the genus and in separating the species L. alba, L. lupulina and L. origanoides into distinct groups. Phylogenetic analysis using Amplified Length Polymorphism and markers produced similar results and confirmed that L. alba and L. lupulina shared a common ancestor that differ from L. origanoides. Carvacrol, endo-fenchol and thymol were the most relevant chemical descriptors.

Conclusion

Based on the phylogenetic analysis it is proposed that L. grata should be grouped within L. origanoides due to its significant genetic similarity. Although Amplified Length Polymorphism and Internal Transcribed Spacer markers enabled the differentiation of individuals, the genotype selection for the production of certified phytomedicines must also consider the chemotype classification that reflects their real medicinal properties.

Keywords

Lippia origanoides Phytomedicine AFLP ITS2 CG/MS Phylogenetic relationships 

Abbreviations

LT

individuals from the medicinal plants germplasm bank (Ribeirão Preto University, Brazil)

LU

individuals from medicinal botanical garden of Nature Pharmacy, Brazil

Background

The genus Lippia comprises 150 species, most of which are distributed in the Neotropical ecozone [1]. Brazil stands out as the centre of diversity of the genus with 98 species presenting high degrees of endemism. More than half of these species are concentrated in the Espinhaço Range, which stretches 1000 km through the Brazilian states of Minas Gerais and Bahia [2]. However, 18 species are considered rare or endangered, and nine are under threat of extinction due to the destruction of their natural environments in the Cerrado region (Brazilian type of Savana) [3].

The Brazilian Ministry of Health has developed an extensive phytotherapy program over the last decade with the aim of providing access to herbal medicines for the entire population. One of the target species of this program is Lippia sidoides Cham. (syn. L. origanoides) (Verbenaceae), a plant that was included in the Formulário de Fitoterápicos da Farmacopéia Brasileira [4, 5] based on its strong antimicrobial activity, against Candida albicans [6, 7], Staphylococcus aureus, and Escherichia coli [8] were included due to the presence of terpenoids in the essential oil. It is well known that terpenoids are produced as part of the plant defense system and have been considered a promising source of biological compounds [9, 10, 11, 12]. Several essential oil compounds such as linalool, eugenol, carvone, vanillin, carvacrol, and thymol have been accepted by the European Commission to be used in food preservation or flavorings [13].

The morphological similarities between this and other species within the genus tend to complicate the accurate botanical identification, leading to difficulties in the production of certified herbal medicines.

Based on the differential morphological characteristics, the genus Lippia was classified in seven sections [14]. The Zapania Schauer section is the most complex and exhibits inflorescences with flat bracts, spirally arranged, globose or hemispheric type, capituliform, with varying numbers of chromosomes (2n = 10–28). L. alba (Mill.) N.E.Br., L. aristata Schauer, L. brasiliensis (Link) T.R.S. Silva, L. corymbosa Cham., L. diamantinensis Glaz., L. duartei Moldenke, L. filifolia Mart. & Schauer, L. hermannioides Cham., L. lacunosa Mart. & Schauer, L. rotundifolia Cham. and L. rubella (Moldenke) T.R.S. Silva & Salimena [15, 16] are among the representatives of this section in the Brazilian flora.

The Goniostachyum Schauer section presents tetrastic inflorescences formed by four series of keeled bracts aligned in rows. This section is considered monophyletic and is characterized by small variations (2n = 12) in the number of chromosomes [15, 17]. A recent revision of the species belonging to Goniostachyum resulted in the validation of only four representatives, namely: L. grata Schauer, L. origanoides Kunth, L. sericea Cham. and L. stachyoides Cham. [17]. Thus, some nominations of species or varieties must be considered synonyms of L. origanoides including, amongst others, L. sidoides, L. graveolens Kunth, L. microphylla Cham., L. salviifolia Cham., L. velutina Schauer, and Lantana origanoides Martens & Galeotti. Additionally, L. dumetorum Herzog, L. gracilis Schauer ex DC, L. hickenii Tronc., L. laxibracteata Herzog, and others have received the synonym L. grata. [17]. The Rhodolippia Schauer section comprises species with numbers of chromosomes that are intermediate between those of sections Zapania and Goniostachyum [15, 18], including L. bradei Moldenke, L. felippei Moldenke, L. florida Cham., L. hederaefolia Mart. & Schauer, L. lupulina Cham., L. pseudothea Schauer, L. rhodocnemis Mart. & Schauer, and L. rosella Moldenke.

However, the taxonomic classification of Lippia remains incoherent mainly due to the morphological variability within the genus and the existence of a great number of nomenclatures for this species resulting in classification dualism, both of which can be explained if we consider the interaction between the genotype and the environment [19]. In this context, studies aimed at evaluating the genetic structure of the genus through analysis of molecular markers could be useful in classifying species into clusters according to their genetic similarities.

A number of reports confirm that the association of molecular markers such as amplified fragment length polymorphism (AFLP) and internal transcribed spacer 2 (ITS2) can contribute significantly to the analysis of genetic variability and phylogenetic inferences [20, 21].

Besides molecular markers, chemical markers can also be used to help the correct plant characterization. WinK [22] developed a phylogenetic classification based on the secondary metabolites produced by Fabaceae, Solanaceae and Lamiacea families. The author considered that the ability or inability to produce a specific metabolite—shown by different members of related phylogenetic groups, are the result of differential expression patterns that reflect specific plant strategies for adaptation that were incorporated into the phylogenetic structure.

Therefore, the aim of the present study was to assess the genetic and chemical variability of species of Lippia spp. using molecular and chemical markers, to draw inferences regarding the phylogenetic relationships within the genus, and to identify inconsistencies in the current taxonomic classification for the correct use of those plants in phytomedicine.

Methods

Plant materials, DNA extractions, PCR amplifications and sequencing

We used 141 accessions (Table 1) comprising six Lippia species; although L. sidoides and L. origanoides are synonymous, they were considered, for the purposes of this study, as they were classified. Thirty-seven of these accessions were from the medicinal plants germplasm bank (Ribeirão Preto University, Brazil) and 104 were collected in the medicinal botanical garden of Nature Pharmacy, Brazil, with voucher numbers; 1340; 1350;1351; 1353; 1355; 1359; 1360; 1362–1365; 1368–1376; 1378–1380; 2000–2015; 2017–2112; 2114; 2471; 2473–2475. Sampling permission, for both locations, were obtained from by the Brazilian Council for the Administration and Management of Genetic Patrimony (CGEN) of the Brazilian Ministry of the Environment (MMA) by the National Council for Scientific and Technological Development (CNPq—CGEN/MMA Process #: 02001.005059/2011-71). Fátima R. G. Salimena (Juiz de Fora Federal University, Brazil) identified all samples. Total genomic DNA was extracted from 0.15 g of frozen leaves using the cetyltrimethylammonium bromide (CTAB) method [23]. The DNA integrity was determined by electrophoresis on 0.8% agarose gels and the concentration and quality of the isolated nucleic acid was determined by a NanoPhotometer® P360 spectrophotometer (Inplen, Westlake Village, CA, USA).
Table 1

Location, Geographical coordinates and voucher number of Lippia species

Individual

Taxonomic identification

Location (State)

Geographical coordinates

Voucher

LT1

L. origanoides

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

2000

LT2

L. origanoides

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

2001

LT3

L. origanoides

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

2002

LT4

L. origanoides

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

2003

LT5

L. origanoides

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

2007

LT6

L. origanoides

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

2004

LT7

L. origanoides

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

2005

LT8

L. origanoides

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

2006

LT9

L. grata

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

2097

LT10

L. orig. × velut.

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

2077

LT11

L. origanoides

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

2008

LT12

L. origanoides

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

2009

LT13

L. origanoides

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

2010

LT14

L. origanoides

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

2011

LT15

L. origanoides

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

2012

LT16

L. grata

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

2098

LT18

L. origanoides

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

2013

LT19

L. origanoides

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

2014

LT20

L. origanoides

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

2015

LT23

L. orig. × velut.

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

2078

LT24

L. origanoides

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

2079

LT26

L. origanoides

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

2017

LT27

L. origanoides

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

2018

LT30

L. origanoides

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

2019

LT31

L. origanoides

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

2020

LT32

L. origanoides

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

2021

LT33

L. origanoides

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

2022

LT34

L. origanoides

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

2023

LT35

L. origanoides

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

2024

LT36

L. origanoides

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

2025

LT38

L. origanoides

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

2026

LT40

L. orig. × velut.

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

2080

LT42

L. velutina

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

2096

LT43

L. origanoides

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

2027

LT44

L. grata

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

2099

LT45

L. origanoides

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

2028

LT46

L. velutina

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

2095

LT47

L. grata

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

2100

LT48

L. origanoides

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

2029

LT49

L. origanoides

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

2030

LT50

L. origanoides

Minas Gerais 3

19°82′02.2″–43°91′96.9″ 589 m

2031

LT51

L. orig. × velut.

Minas Gerais 3

19°82′02.2″–43°91′96.9″ 589 m

2081

LT52

L. origanoides

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2032

LT53

L. origanoides

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2033

LT54

L. orig. × velut.

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2082

LT55

L. origanoides

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2034

LT57

L. origanoides

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2035

LT59

L. origanoides

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2036

LT60

L. origanoides

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2037

LT61

L. origanoides

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2038

LT63

L. orig. × velut.

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2083

LT64

L. origanoides

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2039

LT65

L. origanoides

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2040

LT66

L. origanoides

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2041

LT67

L. origanoides

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2042

LT68

L. orig. × velut.

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2084

LT69

L. orig. × velut.

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2085

LT70

L. origanoides

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2043

LT71

L. origanoides

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2044

LT72

L. origanoides

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2045

LT73

L. origanoides

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2046

LT75

L. origanoides

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2047

LT76

L. origanoides

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2048

LT77

L. orig. × velut.

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2086

LT78

L. velutina

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2094

LT79

L. orig. × velut.

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2087

LT80

L. origanoides

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2049

LT81

L. origanoides

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2050

LT82

L. origanoides

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2051

LT83

L. origanoides

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2052

LT86

L. orig. × velut.

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2088

LT87

L. origanoides

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2053

LT88

L. orig. × velut.

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2089

LT89

L. velutina

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2093

LT90

L. origanoides

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2054

LT91

L. orig. × velut.

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2090

LT92

L. origanoides

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2055

LT93

L. origanoides

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2056

LT94

L. origanoides

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2057

LT96

L. origanoides

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2058

LT97

L. origanoides

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2059

LT98

L. origanoides

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2060

LT99

L. origanoides

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2061

LT100

L. origanoides

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2062

LT101

L. origanoides

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2063

LT102

L. origanoides

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2064

LT103

L. origanoides

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2065

LT104

L. origanoides

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2066

LT105

L. origanoides

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2067

LT107

L. origanoides

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2068

LT108

L. origanoides

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2069

LT109

L. origanoides

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2070

LT110

L. origanoides

Bahia 2

10°33′38.1″–40°16′37.7″ 489 m

2071

LT111

L. origanoides

Bahia 3

11°11′ 25.5″–39°25′39.5″ 344 m

2072

LT112

L. origanoides

Bahia 3

11°11′ 25.5″–39°25′39.5″ 344 m

2073

LT113

L. origanoides

Bahia 3

11°11′ 25.5″–39°25′39.5″ 344 m

2075

LT114

L. origanoides

Bahia 3

11°11′ 25.5″–39°25′39.5″ 344 m

2074

LT115

L. origanoides

Bahia 3

11°11′ 25.5″–39°25′39.5″ 344 m

2076

LT116

L. orig. × velut.

São Paulo

21°11′55.5″–47°44′08.8″ 566 m

2091

LT117

L. orig. × velut.

São Paulo

21°11′55.5″–47°44′08.8″ 566 m

2092

LT118

L. origanoides

Minas Gerais 1

19°36′49.9″–42°08′20.8″ 929 m

2110

LT120

L. alba

São Paulo

21°11′55.5″–47°44′08.8″ 566 m

2101

LT121

L. alba

São Paulo

21°11′55.5″–47°44′08.8″ 566 m

2102

LT122

L. alba

São Paulo

21°11′55.5″–47°44′08.8″ 566 m

2103

LT123

L. alba

São Paulo

21°11′55.5″–47°44′08.8″ 566 m

2104

LT124

L. alba

São Paulo

21°11′55.5″–47°44′08.8″ 566 m

2105

LT125

L. alba

São Paulo

21°11′55.5″–47°44′08.8″ 566 m

2106

LT126

L. alba

Minas Gerais 2

19°51′37.3″–47° 20 27.9″1069 m

2106

LT127

L. alba

Minas Gerais 1

19°36′49.9″–42°08′20.8″ 929 m

2108

LT128

L. alba

Minas Gerais 1

19°36′49.9″–42°08′20.8″ 929 m

2109

LU129

L. orig. × velut.

Bahia 4

10°31′14.8″–40°13′57.7″ 594 m

1364

LU130

L. orig. × velut.

Bahia 5

10°50′48.1″–39°35′45.0″ 358 m

1380

LU132

L. orig. × velut.

Bahia 3

11°11′25.5″–39°25′39.5″ 344 m

1350

LU133

L. orig. × velut.

Bahia 3

11°11′25.5″–39°25′39.5″ 344 m

1351

LU134

L. origanoides

Bahia 3

11°11′25.5″–39°25′39.5″ 344 m

1353

LU135

L. origanoides

Bahia 3

11°11′25.5″–39°25′39.5″ 344 m

1355

LU137

L. origanoides

Bahia 3

11°11′25.5″–39°25′39.5″ 344 m

1359

LU138

L. origanoides

Bahia 3

11°11′25.5″–39°25′39.5″ 344 m

1360

LU140

L. origanoides

Bahia 3

11°11′25.5″–39°25′39.5″ 344 m

1362

LU141

L. origanoides

Bahia 3

11°11′25.5″–39°25′39.5″ 344 m

1363

LU142

L. grata

Bahia 6

11°11′25.5″–39°25′39.5″ 344 m

2475

LU143

L. grata

Bahia 6

11°11′25.5″–39°25′39.5″ 344 m

2474

LU144

L. grata

Bahia 6

11°11′25.5″–39°25′39.5″ 344 m

2473

LU145

L. velutina

Ceará 1

03°69′79.3″–38°57′35.1″ 005 m

2111

LU146

L. velutina

Ceará 1

03°69′79.3″–38°57′35.1″ 005 m

2112

LU148

L. velutina

Ceará 1

03°69′79.3″–38°57′35.1″ 005 m

2114

LU150

L. orig. × velut.

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

1365

LU151

L. orig. × velut.

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

1366

LU153

L. orig. × velut.

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

1368

LU154

L. orig. × velut.

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

1369

LU155

L. orig. × velut.

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

1370

LU156

L. orig. × velut.

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

1371

LU157

L. orig. × velut.

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

1372

LU158

L. orig. × velut.

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

1373

LU159

L. orig. × velut.

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

1374

LU160

L. orig. × velut.

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

1375

LU161

L. origanoides

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

1376

LU162

L. orig. × velut.

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

1378

LU163

L. orig. × velut.

Bahia 1

11°42′31.9″–39°31′10.5″ 222 m

1379

LU164

L. grata

Ceará 2

03°80′41.1″–08°45′60.7″ 014 m

2471

LU165

L. lupulina

Minas Gerais 2

19°51′37.3″–47°20′27.9″1069 m

1340

Location: Bahia 1: Riachão do Jacuípe; Bahia 2: Campo Formoso; Bahia 3: Santa Luz; Bahia 4: Missão; do Sahy; Bahia 5: Queimadas; Bahia 6: Contagem; Ceará 1: Quatro Varas; Ceará 2: Orto Fortaleza; Minas Gerais 1: Araxá; Minas Gerais 2: Sacramento; Minas Gerais 3: Mateus Leme; São Paulo: Jardinópolis

Reactions and analysis of AFLP data

Samples from all 141 genotypes were analyzed according to the method of Vos et al. [24]. Briefly, genomic DNA (300 ng) was digested with EcoRI/MseI enzymes (New England Biolabs, Ipswich, MA, US) at 37 °C for 3 h, followed by inactivation at 70 °C for 5 min. Resulting DNA fragments were ligated to adaptors complementary to the restriction enzymes recognition sites and the ligation products were then diluted 6× with deionized water. In the first round of polymerase chain reaction (PCR), pre-selective amplification was achieved with primers EcoRI + 1 (50 µM) and MseI + 1 (50 µM). The pre-selective products were diluted 10× with deionized water and a second round of PCR was carried out using marker primers fluorescently tagged with IRDye® (LI-COR Biosciences, Lincoln, NE, USA). The selected marked primers were those that generated the largest number of polymorphic bands. Genotyping of individuals was performed using a 4300 DNA Analyzer (LI-COR Biosciences, Lincoln, NE, USA) while data alignment was accomplished with the aid of SagaMX Automated AFLP Analysis software version 3.3 guided by molecular weight markers in the range 50–700 bp. A binary matrix was constructed based on a 1/0 score for the presence/absence of each electrophoretic band. The genetic distance was calculated from the binary matrix using Jaccard indices, whereas the dendrogram was constructed using the unweighted pair group method with arithmetic average (UPGMA) clustering technique with 1000 permutations and Free Tree software version 0.9.1.50 [25] and visualized through TreeView X program [26]. The genetic structure of genotypes was established by principal coordinates analysis (PCoA) using the software GenAlEx version 6.5 [27] and STRUCTURE version 2.2.4 [28], which generated a posterior distribution based on Bayesian and admixture models. Each analysis comprised a “burn-in” of 200,000 interactions followed by a run length of 500,000 interactions and five independent runs for each K value (K = 1 to 7). The most probable number of genetic groups was determined from the ΔK value [29]. The correlation between genetic and geographical data was performed using the Mantel test and the POPGENE 32 [30] and GENES version 2009.7.0 [31] programs with 1000 simulations.

Sequencing and phylogenetic analysis of the ITS2 gene

The primers employed in the amplification reactions ITS2F-5′AATTGCAGAATCCCGTGAAC3′ and ITS2R-5′GGTAATCCCGCCTGACCT3′ were designed based on ITS2 sequences of some Verbenaceae species from the GenBank database at the National Center for Biotechnology Information (NCBI), namely Aloysia gratissima (DQ463782.1), A. gratissima var. schulziae (AY178651.1), A. triphylla (EU761080.1), Lippia alba (EU761076.1), L. alba (EU761078.1), L. salsa (FJ867399.1), and Phyla dulcis (EU761079.1). Polymerase chain reaction was performed as described by Chen et al. [32] and the resulting amplified fragments were sequenced using a Thermo Sequenase™ Cycle Sequencing kit (Affymetrix, Inc, Cleveland, USA), following manufacturer recommendations, with e-Seq™ DNA Sequencing version 3.1 (LI-COR Biosciences). Consensus sequences were assembled with the aid of LI-COR Biosciences AlignIR software (version 2.1) and aligned with ClustalW. The sequence alignments were edited using the BioEdit software (version 7.2) [33]. Phylogenetic trees were inferred by the NJ method based on the Kimura-2 parameter using PHYLIP software version 3.69 [34]. The alignment quality of the final phylogenetic tree was verified by the presence of saturation of the nucleotide substitutions, and sequences exhibiting high genetic similarity were excluded from the phylogenetic analysis using DAMBE software version 4.0.36 [35]. Thirty-three sequences of the ITS2 region deposited in the NCBI GenBank were selected as references (Table 2).
Table 2

Accession number for ITS2 references of region from NCBI and used code

Species

Codea

Accession number

Lantana micrantha

Lamicr

HM120854.1

Lantana angustifolia

Laangu

HM120857.1

Lantana scabrida

Lascab

HM120860.1

Lantana camara

Lacama

AF437858.1

Lantana sp.

LaspX1

EF190037.1

Lantana strigocamara

Lastri

FJ004800.1

Lantana hodgei

Lahodg

HM120851.1

Lantana strigocamara

LastrA

HM120861.1

Glandularia subincana

Glsubi

FJ867442.1

Glandularia gooddingii var. gooddingii

Glgvgo

FJ867437.1

Glandularia guaranitica

Glguar

FJ867434.1

Glandularia mendocina

Glmend

FJ867421.1

Glandularia dissecta

Gldiss

FJ867419.1

Glandularia aristigera

Glaris

FJ867424.1

Glandularia cheitmaniana

Glchei

FJ867444.1

Glandularia bipinnatifida

Glbipi

JN686504.1

Glandularia chiricahensis

Glchir

FJ867436.1

Glandularia gooddingii var. nepetifolia

Glgvne

FJ867439.1

Glandularia wrightii

Glwrig

AY928525.1

Glandularia aurantiaca

Glaura

FJ867427.1

Glandularia bipinnatifida

GlbipT

Fj867440.1

Glandularia araucana

Glarau

FJ867429.1

Glandularia microphulla

Glmicr

FJ867432.1

Junellia micrantha

Jumicr

FJ867462.1

Junellia caespitosa

Jucaes

FJ867466.1

Junellia selaginoides

Jusela

FJ867463.1

Junellia aspera var. longidentata

Juavlo

FJ867460.1

Junellia spathulata

Juspat

FJ867456.1

Junellia ligustima var. lorentzii

Julvlo

FJ867568.1

Junellia uniflora

Juunif

FJ867450.1

Junellia asparagoides

Juaspa

FJ867458.1

Junellia aspera

Juaspe

FJ867459.1

Phyla canensis

 

HM193969.1

aCode used in the phylogenetic tree

Extraction and analysis of essential oils

The essential oils of L. origanoides, L. origanoides × velutina, L. velutina, L. sidoides, L. salviifolia, and L. grata were extracted from dried leaves and flowers by steam distillation in a Clevenger apparatus. A mixture of essential oil/ethyl acetate (v/4v) was analysed using gas chromatograph Varian, model 3900 (Palo Alto, CA, USA), coupled with a Saturn 2100T ion trap mass selective detector and equipped with a non-polar DB-5 fused silica capillary column (30 m × 0.25 mm i.d.; 0.25 μm). The analytical conditions were: carrier gas helium at 1 mL/min; oven temperature 60 to 240 °C at 3 °C/min; injector temperature 240 °C; detector temperature 230 °C; injector split ratio 1:20; injection volume 1 μL; ionization voltage 70 eV. Individual components of oil samples were identified from their Kovats retention indices [36] and by comparison of their electron impact spectra with entries in the NIST62 mass spectral library embedded in the GC/MS system. Data were submitted for principal component analysis (PCA) using the program GENES version 2009.7.0 [31] in order to determine which of the chemical descriptors contributed most to the variability.

Results

Analysis based on AFLP markers

The set of six primers selected for AFLP analysis of the 141 genotypes amplified 273 loci, of which 267 (97.8%) were polymorphic (Table 3). The dendrogram constructed from these amplified loci (Fig. 1) enabled the 141 genotypes to be discriminated into three distinct genotypic groups, namely group 1 (L. alba), group 2 (L. lupulina) and group 3 (L. origanoides, L. origanoides × velutina, L. velutina, L. sidoides, L. salviifolia, and L. grata). Interestingly, L. alba appeared to be more closely related to L. lupulina (boostrap 100%) than to L. origanoides.
Table 3

Sequences of selected primers IRDye 700/800 and number of amplified fragments

Primer

Fragments total

Polymorphic fragments

(%) polymorphic fragments

IRDye 700

 E-AAT-M-AGG

45

44

97.8

 E-AAT-M-TC

45

45

100

 E-ATG-M-TCG

50

50

100

IRDye 800

 E-AGA-M-AT

17

16

94.1

 E-AGA-M-TA

70

68

97.1

 E-AG-M-TTC

46

44

95.6

Total

273

267

97.8%

Fig. 1

UPGMA dendrogram constructed using data obtained AFLP polymorphic markers (1000 permutations). Individuals featured: Black circle: L. grata (LT9, LT16, LT44, LT47, LU142, LU143, LU144); white circle: L. salvifolia (LT118); black small circle: L. sidoides (LT116; LT117); lozenge: L. velutina (LT42, LT46, LT78, LT89, LU145, LU146, LU148)

The cluster formed by group 3 indicated the absence of significant differentiation between L. origanoides, L. origanoides × velutina, L. velutina, L. sidoides, L. salviifolia, and L. grata. However, only 29% of the hybrid individuals clustered together, whereas 71% assembled with other species. Furthermore, only 37.5% of L. grata individuals clustered together, while 62.5% clustered with other species, demonstrating the occurrence of intra- and inter-specific similarities in Lippia.

The results generated by PCoA analysis also revealed three groups (Fig. 2), but the Bayesian approach using the STRUCTURE software indicated that the genotypes could be organized into two main groups (K = 2), suggesting that L. lupulina (group 1) occupied an intermediate position between groups 1 and 3 (Fig. 3).
Fig. 2

Population structure as determined by principal coordinates analysis (PCoA) of 141 individuals of Lippia spp. Group 1—(Alb) L. alba; Group 2—(Lup) L. lupulina; Group 3—(Lor) L. origanoides, (Orv) L. origanoides × velutina, (Lv) L. velutina, (Sid) L. sidoides, (Sal) L. salviifolia and (Lgr) L. grata

Fig. 3

Population structure as determined by Bayesian analysis of 141 individuals genotypes of Lippia spp. Individual genotypes are represented by columns while the clusters (K = 2) are represented by the colors green and red. Two colors shown for the same individual indicate the percentages of the genome shared between the two groups

The measure of shared variance between the genetic and geographic variables for individuals in group 3 showed a significant positive correlation (r = 0.80; p = 0.46), while the isolation by distance showed the existence of gene flow across group 3 (Nm = 1.6), although gene flow between groups 1 and 3 was lower (Nm = 1.3).

Analysis based on ITS2 genotyping

Primers ITS2F and ITS2R amplified DNA fragments of approximately 340 bp. The saturation test revealed that the ITS2 region presents significant genetic variability among the Lippia spp.

The Neighbor-Joining (NJ) of the phylogenetic tree was rooted using the Phyla canescens species identified in France (Fig. 4: Table 4). The use of a outgroup species from a different geographic location favors a more robust separation of the tree branches confirming the separation of the phylogenetic groups.
Fig. 4

Evolutionary relationships between Lippia individuals generated from NJ analysis of ITS2 sequences (Kimura-2 model: PHYLIP software version 3.69). Reference sequences (see Table 2): Lamicr, Laangu, Lascab, Lacama, LaspX1, Lastri, Lahodg, LastrA, Glsubi, Glgvgo, Glguar, Glmend, Gldiss, Glaris, Glchei, Glbipi, Glchir, Glgvne, Glwrig, Glaura, GlbipT, Glarau, Glmicr, Jumicr, Jucaes, Jusela, Juavlo, Juspat, Julvlo, Juunif, Juaspa, Juaspe, Phylla canensis. Samples grouped by high genetic similarity: L2, L3, L4, L9, L11, L69, L118, L120, L129, L142 (see Table 4). Capital letters adjacent to code numbers 142 and 144 refer to the amplified bands of 340 bp (A) and 360 bp (B)

Table 4

Lippia individual grouped by genetic similarity (ITS2) by DAMBE program version 4.0.36

Individuals with high genetic similarity

Codea

LT2, LT31, LT34, LT36: L. origanoides

LT47: L. grata

LU156: L. orig. × velut.

L2

LT3, LT6, LT45: L. origanoides

L3

LT4, LT26, LT52, LT73: L. origanoides

LT116: L. orig. × velut.

L4

LT7, LT20, LT27, LT32, LT55, LT57, LT60, LT61, LT65, LT66, LT70, LT71, LT75, LT80, LT82, LT87, LT94, LT97, LT98, LT100, LT105, LT107, LT108, LT109, LU137: L. origanoides

LT10, LT68, LT77, LT79,

LT63, LT117, LU130, LU151, LU153, LU158: L. orig. × velut.

LT42, LT78: L. velutina

L7

LT9: L. grata

LT23: L. orig. × velut.

LT90, LT92: L. origanoides

L9

LT1, LT11, LT12, LT15, LT24, LT30, LT35, LT43, LT48, LT49, LT64, LT67, LT72, LT104, LU141: L. origanoides

LT54, LU133: L. orig. × velut.

L11

LT14, LU155—L. origanoides

L14

LT69, LU132: L. orig. × velut.

L69

LT118, LU145, LU146: L. velutina

LU164: L. grata

L118

LT120, LT123, LT124, LT125, LT126, LT127: L. alba

L120

LU129, LU159: L. orig. × velut.

L129

LU142, LU143: L. grata

L142

LU154, LU157: L. origanoides

L154

aCode used in the phylogenetic tree

The phylogenetic analysis based on the species from the genus Lantana (A), Glandularia (B), Junellia (C), and Lippia (D) demonstrated separation of the three branches into four principal clusters with 83%, 93%, 85%, and 96% bootstrap, respectively. In the Lantana group, Lippia lupulina (L165) and Lippia alba (L120, L121, L122, L128), divided into subgroups with a bootstrap of 71% and 83%, respectively, were also identified. The group of Glandularia and Junellia was clearly subdivided into two groups: one belonging to the species of Glandularia and another to the Junellia subgroup.

Most of the analyzed species were separated within the Lippia group as a monophyletic group. Samples LU145 (L. velutina) and LT118 (L. salviifolia) were identical to the sample classified as L. grata (LU164). Furthermore, a sample classified as L. velutina (LT78) was identical to one of L. sidoides (LT117), as well as to samples of L. origanoides and L. origanoides × velutina. Additionally, a L. grata individual (LT47) was identical to one L. origanoides × velutina (LU156) and to some L. origanoides (LT2, LT31, LT34, LT36).

Principal Components Analysis (PCA) of essential oil profiles

The application of PCA analysis allowed individuals to be grouped according to their different chemical profiles and enabled the seven original chemical descriptors, namely carvacrol, endo-fenchol, thymol, β-caryophyllene, isoborneol, trans-caryophyllene, and bicyclogermacrene, to be reduced to the first three (Fig. 5). Endo-fenchol (PC1) and carvacrol (PC2) accounted for most of the total variation (86.36%), with the first and second components contributing factors of 0.69 and 0.17, respectively, while the contribution of thymol was minimal (only 0.063). Considering all the analyzed individuals, 72% contained carvacrol and 16% contained endo-fenchol; since no individuals contained both carvacrol and endo-fenchol, the quantification of these two components would cover 88% of the analyzed samples (Fig. 5).
Fig. 5

Principal component analysis of the chemical constituents of Lippia essential oil

Discussion

AFLP analysis

The employed AFLP technique distributed the 141 Lippia genotypes into three groups (Fig. 1) that were compatible with the existing taxonomic sections, namely Zapania (L. alba), Rhodolippia (L. lupulina) and Goniostachyum (L. origanoides, L. sidoides, L. salviifolia, L. origanoides × velutina, and L. grata) [16, 17]. The efficiency of dominant AFLP markers to regroup genetically similar species has been also demonstrated in a number of studies [37, 38, 39], having been attributed to the large numbers of amplified loci that are generated [40]. Additionally, PCoA analysis (Fig. 2) confirmed the distribution of the studied genotypes into three groups, a separation likely related to the reduced gene flow between the groups [41] as demonstrated by the values of Nm (1.3–1.6) obtained for Lippia species.

However, Bayesian analysis performed using the program STRUCTURE identified only two genetic groups (K =2), demonstrating that L. lupulina shares 50% of the genome of each group (Fig. 3), for more detail see Additional file 1. This result corroborates the results of Campos et al., [18], which classified Rhodolippia section (Group 2) as an intermediary between Zapania (Group 1) and Goniostachyum (Group 3) sections.

A recent study by O’Leary et al. [17] grouped L. origanoides × velutina, L. velutina, L. sidoides, and L. salviifolia, but not L. grata, within L. origanoides. Our results showed that individuals classified as L. origanoides, L. origanoides × velutina, L. velutina, L. sidoides, L. salviifolia, and L. grata formed a single group due to their strong genetic similarity, and therefore should be recognized as a single taxon to be named L. origanoides.

Nuclear ribosome ITS2

The results presented herein show that species in the genus Glandularia and Junellia may be considered genetically similar as were forming one group (Fig. 4), thus confirming former results [42]. Furthermore, the species used as an outgroup, Phyla canescens, showed clear genetic divergence from Lantana, Glandularia, Junellia and Lippia, even though the separation of these genus has been proposed based on increased morphological descriptors [43, 44].

Lippia alba and L. lupulina are closely related to members of the genus Lantana and, together, they can be considered sister-groups [45, 46, 47], attesting the genetic similarity between the genera Lippia and Lantana [18, 48, 49].

Additionally, L. alba and L. lupulina exhibit longer branches in comparison with other Lippia species, suggesting that they underwent a more accelerated evolutionary rate and that they are older species [20, 43, 50].

The results of the phylogenetic analysis performed with ITS2 markers confirmed the results obtained with AFLP markers, suggesting the existence of only three species, namely L. alba, L. lupulina and L. origanoides. Of these, L. alba (section Zapania) can be considered the most divergent within the genus, whereas L. lupulina (section Rhodolippia) represents an intermediate between sections Zapania and Goniostachyum, for more detail see Additional files 2 and 3. In this aspect, the findings from the molecular-based analyses corroborate those based on cytogenetic and morphological characteristics [15, 16, 18].

Chemical markers

The PCA analysis of the terpenoid composition from L. origanoides L. origanoides × velutina, L. velutina, L. sidoides, L. salviifolia and L. grata showed no specific grouping by species (Fig. 5), suggesting that they are different chemotypes. Conversely, Sandasi et al. [51], when investigating the chemotaxonomic differentiation of South-African Lippia species, namely L. javanica, L. scaberrima, L. rehmannii and L. wilmsii, were able to separate the species into distinct clusters. These results, paired with AFPL and ITS, suggest that L. origanoides, L. origanoides × velutina, L. velutina, L. sidoides, L. salviifolia, and L. grata belong to the same species, but present different chemotypes, for more detail see Additional file 4.

The chemotypes may be associated with the diverse biotic and abiotic stimuli to which each of the individuals had been subjected, which led to the creation of a complex biological system [52]. It is clear that nowadays the taxonomic identification of plants frequently rely on molecular biology techniques, especially when plants exhibit very similar morphological characters. In regards to medicinal plants, the use of chemical markers becomes essential if we consider that the biological activity can, most of the time, be related to a specific chemotype. Therefore, when any species is employed in the production of certified phytomedicines, the plant material must be identified taxonomically and the chemotype identified to assure the biological activity of the extract.

Conclusions

The molecular markers AFLP and ITS2 were efficient in separating L. alba and L. lupulina, and in grouping L. origanoides, L. origanoides × velutina, L. velutina, L. sidoides, L. salviifolia, and L. grata. Moreover, the markers revealed the existence of intra- and inter-specific variability within the genus, as well as the close phylogenetic relationship between L. alba and L. lupulina. Since individuals grouped in L. origanoides exhibit morphological diversity and variability regarding the major constituents of the essential oils, the selection of genotypes for the production of certified phytomedicines must be based on the chemical profile of the oil produced.

Notes

Authors’ contributions

Conceived and designed the experiments: AMSP BWB SMZ SCF. Performed the experiments: MCA ESP CH FRGS. Analyzed the data: BWB MCA SHTC SNS SKH. Taxonomic identification: FRGS. Contributed with reagents/materials/analysis tools SMZ AMSP SCF BWB. Wrote the paper: MCA SMZ AMSP BWB SNS. All authors read and approved the final manuscript.

Acknowledgements

The authors are grateful to Dr. Luciana Rossini Pinto from the Campinas Agriculture Institute (IAC) (Ribeirão Preto, SP, Brazil) for technical support with the LI-COR Biosciences 4300 DNA Analyzer.

Competing interests

The authors declare that they have no competing interests.

Availability of data and materials

The datasets supporting the conclusions of this article are included within the article and its additional files.

Our data is available as Additional file 1: Table S1 Binary data, Additional file 2: Table S2 Chemical data, Additional file 3: Table S3 Genetic data and Additional file 4: Table S4 Accession number.

Consent to publish

Not applicable.

Ethics approval and consent to participate

Sampling permission, for both locations, were obtained from by the Brazilian Council for the Administration and Management of Genetic Patrimony (CGEN) of the Brazilian Ministry of the Environment (MMA) by the National Council for Scientific and Technological Development (CNPq—CGEN/MMA Process #: 02001.005059/2011-71).

Funding

Fundação de Pesquisa do Estado de São Paulo (FAPESP) (Process # 2011/11756-3).

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary material

13104_2018_3839_MOESM2_ESM.docx (15 kb)
Additional file 2: Table S2. Accession number of ITS2 nucleotide sequence from GenBank database at the National Center for Biotechnology Information (NCBI), for all species used as reference.
13104_2018_3839_MOESM3_ESM.docx (17 kb)
Additional file 3: Table S3. Fasta Sequences of amplified ITS fragments for all samples.

References

  1. 1.
    Atkins S. Verbenaceae: the families and genera of flowering plants, vol. 7. Berlin: Springer; 2004. p. 449–68.Google Scholar
  2. 2.
    Salimena FRG, Kutschenco DC, Monteiro NP, Myssen C. Verbenaceae: Livro Vermelho da Flora do Brasil. Instituto de Pesquisas Jardim Botânico, Rio de Janeiro; 2013. http://cncflora.jbrj.gov.br/arquivos/arquivos/pdfs/LivroVervelho.pdf. Accessed 20 Sept 2014.
  3. 3.
    Salimena F, França F, Silva TRS. VERBENACEAE: Plantas Raras do Brasil. Conservação Internacional, Belo Horizonte-MG; 2009. http://www.plantasraras.org.br/files/plantas_raras_do_brasil.pdf. Accessed 20 Sept 2014.
  4. 4.
    Anvisa (Agência Nacional de Vigilância Sanitária). RDC nº 14 - Dispõe sobre o registro de medicamentos fitoterápicos; 2010. http://www.crfma.org.br/site/arquivos/legislacao/resolucoesinstrucoesnormativasdaanvisa/RDC%2014%202010.pdf. Accessed 20 Sept 2014.
  5. 5.
    Anvisa (Agência Nacional de Vigilância Sanitária). Formulário de Fitoterápicos da Farmacopéia Brasileira, 1fst edition; 2011http://www.anvisa.gov.br/hotsite/farmacopeiabrasileira/conteudo/Formulario_de_Fitoterapicos_da_Farmacopeia_Brasileira.pdf. Accessed 20 Sept 2014.
  6. 6.
    Botelho MA, Nogueira NAP, Bastos GM, Fonseca SGC, Lemos TLG, Matos FJA, et al. Antimicrobial activity of the essential oil from Lippia sidoides, carvacrol and thymol against oral pathogens. Braz J Med Biol Res. 2007;40:349–56.CrossRefGoogle Scholar
  7. 7.
    Fontenelle ROS, Morais SM, Brito EHS, Kerntopf MR, Brilhante RSN, Cordeiro RA, et al. Chemical composition, toxicological spects and antifungal activity of essential oil from Lippia sidoides Cham. J Antimicrob Chemother. 2007;59:934–40.CrossRefGoogle Scholar
  8. 8.
    Bertini LM, Pereira AF, Oliveira CLL, Menezes EA, Morais SM, Cunha FA, Cavalcanti ESB. Perfil de sensibilidade de bactérias frente a óleos essenciais de algumas plantas do nordeste do Brasil. Infarma. 2005;17:80–3.Google Scholar
  9. 9.
    Almeida JRGS, Silva-Filho RN, Nunes XP, Dias CS, Pereira FO, Lima EO. Antimicrobial activity of the essential oil of Bowdichia virgilioides Kunt. Rev Bras Farmacogn. 2006;16:638–41.CrossRefGoogle Scholar
  10. 10.
    Arruda TA, Antunes RMP, Catão RMR, Lima EO, Sousa DP, Nunes XP, et al. Preliminary study of the antimicrobial activity of Mentha × villosa Hudson essential oil, rotundifolone and its analogues. Rev Bras Farmacogn. 2006;16:307–11.CrossRefGoogle Scholar
  11. 11.
    Benkeblia N. Antimicrobial activity of essential oil extracts of various onions (Allium cepa) and garlic (Allium sativum). LWT. 2005;37:263–8.CrossRefGoogle Scholar
  12. 12.
    Nunes XP, Maia GLA, Almeida JRGS, Pereira FO, Lima EO. Antimicrobial activity of the essential oil of Sida cordifolia L. Rev Bras Farmacog. 2006;16:642–4.CrossRefGoogle Scholar
  13. 13.
    Hyldgaard M, Mygind T, Meyer RL. Essential oils in food preservation: mode of action, synergies, and interactions with food matrix components. Front Microbiol. 2012;3:1–24.CrossRefGoogle Scholar
  14. 14.
    Troncoso NS. Los géneros de Verbenaceae de Sudamérica extra tropical (Argentina, Chile, Bolivia, Uruguay & sur de Brasil). Darwiniana. 1974;18:295–412.Google Scholar
  15. 15.
    Sanders RW. The genera of Verbenaceae in the southeastern United States. Harvard Papers in Botany. 2001;5:303–58.Google Scholar
  16. 16.
    Viccini LF, Pierre PMO, Praça MM, Costa DCS, Romanel EC, Sousa SM, et al. Chromosome numbers in the genus Lippia (Verbenaceae). Pl Syst Evol. 2006;256:171–8.CrossRefGoogle Scholar
  17. 17.
    O’Leary N, Denham SS, Salimena F, Múlgura ME. Species delimitation in Lippia section Goniostachyum (Verbenaceae) using the phylogenetic species concept. Bot J Linn Soc. 2012;170:197–219.CrossRefGoogle Scholar
  18. 18.
    Campos JMS, Souza SM, Silva PS, Pinheiro LC, Sampaio F, Viccini LF. Chromosome numbers and DNA C values in the genus Lippia (Verbenaceae). Plant Syst Evol. 2011;291:133–40.CrossRefGoogle Scholar
  19. 19.
    Salimena FRG. Novos sinônimos e tipificações em Lippia sect. Rhodolippia (Verbenaceae). Darwiniana. 2002;40:121–5.Google Scholar
  20. 20.
    Xu F, Sun M. Comparative analysis of phylogenetic relationships of grain amaranths and their wild relatives (Amaranthus; Amaranthaceae) using internal transcribed spacer, amplified fragment length polymorphism, and double-primer fluorescent intersimple sequence repeat markers. Mol Phylogenet Evol. 2001;21:372–87.CrossRefGoogle Scholar
  21. 21.
    Talavera M, Balao F, Casimiro-Soriguer R, Ortiz MA, Terrab A, Arista M, et al. Molecular phylogeny and systematics of the highly polymorphic Rumex bucephalophorus complex (Polygonaceae). Mol Phylogenet Evol. 2011;61:659–70.CrossRefGoogle Scholar
  22. 22.
    Wink M. Evolution of secondary metabolites from an ecological and molecular phylogenetic perspective. Phytochemistry. 2003;64:3–19.CrossRefGoogle Scholar
  23. 23.
    Doyle JJ, Doyle JL. Isolation of plant DNA from fresh tissue. Focus. 1987;12:13–5.Google Scholar
  24. 24.
    Vos P, Hogers R, Bleeker M, Reijans M, Lee TV, Hornes M, et al. AFLP: a new technique for DNA fingerprinting. Nucleic Acids Res. 1995;23:4407–14.CrossRefGoogle Scholar
  25. 25.
    Pavlícek A, Hrdá S, Flegr J. Free tree—freeware program for the construction of phylogenetic trees on the basis of distance data and Bootstrap/Jackknife analysis of the tree robustness. Application in the RAPD analysis of genus Frenkelia. Folia Biol (Praha). 1999;45:97–9.Google Scholar
  26. 26.
    Page RD. TreeView: an application to display phylogenetic trees on personal computers. Comput Appl Biosci. 1996;12:357–8.PubMedPubMedCentralGoogle Scholar
  27. 27.
    Peakall R, Smouse PE. GenAIEx 65: genetic analysis in excel. Population genetic software for teaching and research—an update. Bioinformatics. 2012;28:2537–9.CrossRefGoogle Scholar
  28. 28.
    Pritchard JK, Stephens M, Donnelly P. Inference of population structure using multilocus genotype data. Genetics. 2000;155:945–59.PubMedPubMedCentralGoogle Scholar
  29. 29.
    Evanno G, Regnaut S, Goudet J. Detecting the number of clusters of individuals using the software STRUCTURE: a simulation study. Mol Ecol. 2005;14:2611–20.CrossRefGoogle Scholar
  30. 30.
    Yeh FC, Yang R, Boyle T. POPGENE VERSION 1.31: Population Genetic Analysis. (Free access permitted by author); 1999. https://www.ualberta.ca/~fyeh/popgene.pdf. Accessed 15 Apr 2014.
  31. 31.
    Cruz D. Programa GENES: biometria. Viçosa: UFV; 2006. p. 382.Google Scholar
  32. 32.
    Chen S, Yao H, Han J, Liu C, Song J, Shi L, et al. Validation of the ITS2 region as a novel DNA barcode for identifying medicinal plant species. PLoS ONE. 2010;5:e-8613.CrossRefGoogle Scholar
  33. 33.
    Hall TA. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl Acids Symp Ser J. 1999;41:95–8.Google Scholar
  34. 34.
    Felsenstein J. Confidence limits on phylogenies: an approach using the bootstrap. Evolution. 1985;39:783–91.CrossRefGoogle Scholar
  35. 35.
    Xia X, Xie Z. DAMBE: software package for data analysis in molecular biology and evolution. J Hered. 2001;92:371–3.CrossRefGoogle Scholar
  36. 36.
    Adams RP. Identification of essential oil components by gas chromatography/mass spectroscopy. 4th ed. Carol Stream: Allured Publishing Corporation; 2009.Google Scholar
  37. 37.
    Cervera MT, Storme V, Soto A, Ivens B, Montagu MV, Rajora OP, et al. Intraspecific and interspecific genetic and phylogenetic relationships in the genus Populus based on AFLP markers. Theor Appl Genet. 2005;111:1440–56.CrossRefGoogle Scholar
  38. 38.
    De Riek J, De Cock K, Smulders MJM, Nybom H. AFLP-based population structure analysis as a means to validate the complex taxonomy of dogroses (Rosa section Caninae). Mol Phylogenet Evol. 2013;67:547–59.CrossRefGoogle Scholar
  39. 39.
    Koopman WJM, Wissemann V, De Cock K, Van Huylenbroeck J, De Riek J, Sabatino GJH, et al. AFLP markers as a tool to reconstruct complex relationships: a case study in Rosa (Rosaceae). Am J Bot. 2008;95:353–66.CrossRefGoogle Scholar
  40. 40.
    El Rabey HA, Al-Malki AL, Abulnaja K, Kumosani TA, Khan JA. Efficiency of AFLP markers and seed storage protein electrophoresis to study the phylogeny of some Hordeum species. Spanish J Agr Res. 2013;11:814–9.CrossRefGoogle Scholar
  41. 41.
    Jiménez-Mejías P, Escudero M, Guerra-Cárdenas S, Lye KA, Luceño M. Taxonomic delimitation and drivers of speciation in the Ibero-North African Carex sect. Phacocystis river-shore group (Cyperaceae). Am J Bot. 2011;98:1855–67.CrossRefGoogle Scholar
  42. 42.
    Yuan YW, Olmstead RG. A species-level phylogenetic study of the Verbena complex (Verbenaceae) indicates two independent intergeneric chloroplast transfers. Mol Phylogenet Evol. 2008;48:23–33.CrossRefGoogle Scholar
  43. 43.
    Steane DA, Scotland RW, Mabberley DJ, Wagstaff SJ, Reeves PA, Olmstead RG. Phylogenetic relationships of Clerodendrum s.l. (Lamiaceae) inferred from chloroplast DNA. Syst Bot. 1997;22:229–43.CrossRefGoogle Scholar
  44. 44.
    Wagstaff SJ, Olmstead RG. Phylogeny of Labiatae and Verbenaceae inferred from rbcL sequences. Syst Bot. 1997;22:165–79.CrossRefGoogle Scholar
  45. 45.
    Alarcón M, Roquet C, García-Fernández A, Vargas P, Aldasoro JJ. Phylogenetic and phylogeographic evidence for a Pleistocene disjunction between Campanula jacobaea (Cape Verde Islands) and C. balfourii (Socotra). Mol Phylogenet Evol. 2013;69:828–36.CrossRefGoogle Scholar
  46. 46.
    Kropf M, Kadereit JW, Comes HP. Differential cycles of range contraction and expansion in European high mountain plants during the Late Quaternary: insights from Pritzelago alpina (L.) O. Kuntze (Brassicaceae). Mol Ecol. 2003;12:931–49.CrossRefGoogle Scholar
  47. 47.
    Renner MAM, Devos N, Patino J, Brown EA, Orme A, Elgey M, et al. Integrative taxonomy resolves the cryptic and pseudo-cryptic Radula buccinifera complex (Porellales, Jungermanniopsida), including two reinstated and five new species. PhytoKeys. 2013.  https://doi.org/10.3897/phytokeys.27.5523.CrossRefPubMedPubMedCentralGoogle Scholar
  48. 48.
    Marx HE, O’Leary N, Yuan YW, Lu-Irving P, Tank DC, Múlgura ME, et al. A molecular phylogeny and classification of Verbenaceae. Am J Bot. 2010;97:1647–63.CrossRefGoogle Scholar
  49. 49.
    Silva TRS, Salimena FRG. Novas combinações e novos sinônimos em Lippia e Lantana (Verbenaceae). Darwiniana. 2002;40:57–9.Google Scholar
  50. 50.
    Schneider H. Qualidade dos dados: Métodos de Análises Filogenética: um Guia Prático. 3rd ed. Ribeirão Preto: Sociedade Brasileira de Genética/Holos; 2003.Google Scholar
  51. 51.
    Sandasi M, Kamatou GPP, Combrinck S, Viljoen AM. A chemotaxonomic assessment of four indigenous South African Lippia species using GC–MS and vibrational spectroscopy of the essential oils. Biochem Syst Ecol. 2013;51:142–52.CrossRefGoogle Scholar
  52. 52.
    Dixon RA, Gang DR, Charlton AJ, Fiehn O, Kuiper HA, Reynolds TL, et al. Applications of metabolomics in agriculture. J Agric Food Chem. 2006;54:8984–94.CrossRefGoogle Scholar

Copyright information

© The Author(s) 2018

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors and Affiliations

  • Milene C. Almeida
    • 1
  • Ediedia S. Pina
    • 1
  • Camila Hernandes
    • 2
  • Sonia M. Zingaretti
    • 1
  • Silvia H. Taleb-Contini
    • 1
  • Fátima R. G. Salimena
    • 3
  • Svetoslav N. Slavov
    • 4
  • Simone K. Haddad
    • 4
  • Suzelei C. França
    • 1
  • Ana M. S. Pereira
    • 1
  • Bianca W. Bertoni
    • 1
  1. 1.Departamento de BiotecnologiaUniversidade de Ribeirão PretoRibeirão PretoBrazil
  2. 2.Hospital Israelita Albert EinsteinSão PauloBrazil
  3. 3.Departamento de BotânicaUniversidade Federal de Juiz de ForaJuiz de ForaBrazil
  4. 4.Hemocentro de Ribeirão Preto, Faculdade de Medicina de Ribeirão PretoUniversidade de São PauloRibeirão PretoBrazil

Personalised recommendations