Detection and epidemic dynamic of ToCV and CCYV with Bemisia tabaci and weed in Hainan of China
Abstract
Background
In recent years, two of the crinivirus, Tomato chlorosis virus (ToCV) and Cucurbit chlorotic yellows virus (CCYV) have gained increasing attention due to their rapid spread and devastating impacts on vegetable production worldwide. Both of these viruses are transmitted by the sweet potato whitefly, Bemisia tabaci (Gennadius), in a semi-persistent manner. Up to now, there is still lack of report in Hainan, the south of China.
Methods
We used observational and experimental methods to explore the prevalence and incidence dynamic of CCYV and ToCV transmitted by whiteflies in Hainan of China.
Results
In 2016, the chlorosis symptom was observed in the tomato and cucumber plants with a large number of B. tabaci on the infected leaves in Hainan, China, with the incidence rate of 69.8% and 62.6% on tomato and cucumber, respectively. Based on molecular identification, Q biotype was determined with a viruliferous rate of 65.0% and 55.0% on the tomato and cucumber plants, respectively. The weed, Alternanthera philoxeroides near the tomato and cucumber was co-infected by the two viruses. Furthermore, incidence dynamic of ToCV and CCYV showed a close relationship with the weed, Alternanthera philoxeroides, which is widely distributed in Hainan.
Conclusion
Our results firstly reveal that the weed, A. philoxeroides is infected by both ToCV and CCYV. Besides, whiteflies showed a high viruliferous rate of ToCV and CCYV. Hainan is an extremely important vegetable production and seed breeding center in China. If the whitefly can carry these two viruses concurrently, co-infection in their mutual host plants can lead to devastating losses in the near future.
Keywords
Tomato chlorosis virus; cucurbit chlorotic yellows virus; Bemisia tabaci Molecular identification Q biotype Alternanthera philoxeroidesAbbreviations
- CCYV
Cucurbit chlorotic yellows virus
- CP
Coat protein
- HSP70h
Heat shock 70-like protein
- RT-PCR
Reverse transcript–polymerase chain reaction
- ToCV
Tomato chlorosis virus
- TYLCV
Tomato yellow leaf curl virus
Background
Plant virus causes serious threat in the growth and product of crops and vegetables in the world [1]. Plant viruses depend on insect vectors for transmission in a non-persistent, semi-persistent and persistent manner, respectively [2]. The prevalence of plant viruses is closely related to the dynamics of insect vectors [3, 4].
The whitefly, Bemisia tabaci (Gennadius) (hemiptera; Aleyrodidae) is a main vector for plant virus transmission in greenhouse, which has rapidly increased all over the world followed by outbreaks of whitefly-transmitted viruses, causing great losses in agricultural production [5, 6, 7]. The most destructive vector in China is B. tabaci B (MEAM1) and Q (MED) [8]. B. tabaci B has been documented in China since the mid-1990’s, but Tomato yellow leaf curl virus (TYLCV) was not detected until Q became established in 2003 [9, 10], and epidemic of TYLCV is associated with the increasing number of Q [10, 11]. Plant virus can be transmitted by whiteflies in a persistent or semi-persistent manner. Up to now, most research has been focused on the persistent-transmitted virus such as TYLCV but less attention is paid on semi-persistent transmitted viruses. To note, research on the relationship between epidemiology of the crinivirus and whitefly is important to prevent virus outbreak.
Tomato chlorosis virus (ToCV), genus crinivirus, family closteroviridae [12], is transmitted by B. tabaci in a semi-persistent manner [1, 13]. The disorder and yellow symptoms such as the interveinal chlorosis, the leaf brittleness, and the limited necrotic flecking can be used to determine the virus [1, 14, 15]. ToCV was first reported in Florida [16], and then it transmitted to Spain [17], Africa [18, 19], the Middle East [17], and Asia [20, 21]. ToCV can be infected in 24 species of 7 family plants [1]. In Spain Q whiteflies has been determined on ToCV-infected leaves [17]. In Costa Rica Q whiteflies has also been detected on ToCV-infected leaves [22]. In China ToCV was first found in Taiwan [23], and then was found in Shandong [21] and many other northern places, such as Shanxi, Beijing and Neimenggu [24]. Up to now, there is still lack of report in the south of mainland China such as Hainan. With the increasing number of whiteflies in recent years, the potential threat should be noticed.
Cucurbit chlorotic yellows virus (CCYV) belongs to genus crinivirus, family closteroviridae [25]. CCYV can cause chlorotic leaf spots and yellowing of leaves in pumpkin, melon, watermelon, and tobacco [25, 26]. CCYV is transmitted by B. tabaci B and Q in a semi-persistent manner. It was first determined in Japan in 2010 [27], and then it was found in China [28], Sudan [29], Greece [30] and Iran [31]. CCYV was also found in many northern places in China, such as Beijing, Hebei, and Anhui provinces (unpublished data). There is still lack of reports on whitefly biotype detection on virus-infected plants, which has an important role in research of the relationship between epidemiology of the crinivirus and whitefly.
In this research, we found the severe typical chlorotic symptoms on tomato and cucumber in many vegetable growing areas in Hainan province—the south of China. We found that numerous whiteflies gathered on infected plant leaves in cultivated places. We then collected the whiteflies and infected leaves with typical symptoms and then brought them into laboratory to detect the whitefly biotype and to determine the virus. ToCV and CCYV were identified, and B. tabaci Q was determined in all infected leaves. The weeds, Alternanthera philoxeroides nearby were also collected and determined, and the dynamics of ToCV and CCYV were then determined on tomato, cucumber and weeds in four growth stages in Yongfazhen where ToCV and CCYV showed a high virus incidence. Our results provide a basis for monitoring and prevention of viral diseases.
Methods
Field survey
Geographic locations of surveyed plants. Five sites in Yunlongzhen, Yongfazhen, Xinzhuzhen, Yachengzhen, and Tianyazhen were shown in the figure. In each site tomato and cucumber plants were investigated and sampled. Red circles and sectors represent tomato plants. Green circles and sectors represent cucumber plants. Yellow sectors represent virus-infected tomato and cucumber plants
Whitefly biotype and viruliferous rate detection
The whitefly samples were divided into four parts, of which two parts were used to detect the whitefly biotype on tomato and cucumber, and the other two parts were used to detect the viruliferous rate of ToCV and CCYV. The whitefly biotype was detected using the CAPS-cleavage amplified polymorphic sequence of mitochondrial cytochrome oxidase I gene (mtCOI) with the restriction endonuclease AseI [32]. The viruliferous rate detection method was described in section of virus detection in plants. In each part, 20 whiteflies were detected, and each of the detection was repeated three times.
RNA extraction and reverse transcription from infected leaves
Total RNA was extracted separately from 0.1 g infected tomato and cucumber leaves using the total RNA extraction kit (Tiangen Biotech, Beijing, China) following the manufacturer’s instruction. Each of 20 samples was extracted from tomato and cucumber respectively. Each of the detection was repeated three times. Reverse transcription of RNA from the total nucleic acid extracts was performed using cDNA synthesis kit (Takara, Beijing, China), following the manufacturer’s instruction.
Virus detection in plants
Primers of the ToCV, CCYV and whitefly
Name | Primer | Sequence |
---|---|---|
ToCV | F | AAACTGCCTGCATGAAAAGTCTC |
R | GGTTTGGATTTTGGTACTACATTCAGT | |
CCYV | F | CGCAATCAATAAGGCGGCGACC |
R | ACTACAACCTCCCGGTGCCAACT | |
Whitefly | F | TTGATTTTTTGGTCATCCAGAAGT |
R | CTGAATATCGRCGAGGCATTCC |
CCYV detection: We selected 60 chlorosis cucumber leaves for detection, of which 20 leaves were detected each time, and all the cucumber leaves were detected for 3 times. The PCR of the cucumber samples was carried out using the primers designed in the coat protein (CP) gene of CCYV using Primer Premier 5 software (Table 1). The PCR of CCYV was performed in 20 μl of reaction mixtures including 7 μl of ddH2O, 10 μl of mix, 1 μl of each primer, and 1 μl of cDNA. The PCR procedures are as follows: initial denaturation at 94 °C for 5 min, followed by 35 cycles of 94 °C for 15 s, 53 °C for 30 s and 72 °C for 1 min, and a final extension at 72 °C for 10 min. The PCR products of CCYV were obtained and then separated by electrophoresis using 1.0% agarose gels.
ToCV and CCYV detection on weeds: In Yongfazhen, where ToCV and CCYV were detected with a high incidence, we collected the weeds, A. philoxeroides which are close to the infected tomato and cucumber to detect ToCV and CCYV. We collected 60 weed leaves for detection of ToCV and CCYV in three replicates.
Nucleotide sequencing analysis
The target PCR products were purified by the AxyPrep DNA gel extraction kit (Axygen, Zhejiang, China), following the manufacturer’s instructions. The purified products were then sequenced at the Sangon biotech (Shanghai, China). The sequence data of the whiteflies, ToCV and CCYV on tomato, cucumber and weeds were analysed using the BioEdit software. Sequences were compared with the NCBI nucleotide database via the BLAST tools on NCBI online server.
Virus incidence dynamic on tomato, cucumber and weeds
The incidence dynamics of ToCV and CCYV were determined on tomato, cucumber and the weeds nearby: In four growth stages, transplanting, seedling, flowering and ripening of tomato and cucumber, plants were collected to our lab to detect the viruliferous rate of ToCV and CCYV. The weed, A. philoxeroides that was grown near the tomato and cucumber plants was also collected to detect the viruliferous rate of ToCV and CCYV. In each of the five sites of Yongfazhen where ToCV and CCYV were detected with a high incidence, 100 tomato leaves were collected for detection of ToCV, and 100 cucumber leaves were collected for detection of CCYV. The tomato plants and cucumber plants were adjacent, therefore 100 weed leaves nearby were collected for detection of ToCV and CCYV. That is to say, 500 tomato leaves, 500 cucumber leaves and 500 weed leaves were collected in one growth stage.
Data analysis
Statistical analyses were performed with SPSS (version 19.0, Chicago, IL, USA). One-way ANOVA was used to compare the viruliferous rate of plants in different growth stages and weeds.
Results
Incidence of chlorosis disease
Incidence of ToCV and CCYV
Virus | Host plants | Geographic locations | Number of plants surveyed | Number of infected plants | Incidence of chlorosis disease (%) | Average incidence of chlorosis disease (%) |
---|---|---|---|---|---|---|
ToCV | Tomato | Yunlongzhen | 145 | 0 | 0.0 | 69.8 |
Xinzhuzhen | 146 | 93 | 63.7 | |||
Yongfazhen | 154 | 117 | 76.0 | |||
Yachengzhen | 165 | 0 | 0.0 | |||
Tianyazhen | 150 | 0 | 0.0 | |||
CCYV | Cucumber | Yunlongzhen | 92 | 0 | 0.0 | 62.6 |
Xinzhuzhen | 90 | 48 | 53.3 | |||
Yongfazhen | 84 | 62 | 73.8 | |||
Yachengzhen | 66 | 40 | 60.6 | |||
Tianyazhen | 81 | 0 | 0.0 | |||
ToCV | Weed | Yongfazhen | 60 | 9 | 15.0 | 15.0 |
CCYV | Weed | Yongfazhen | 60 | 7 | 11.7 | 11.7 |
Whitefly biotype and viruliferous rate detection
Whitefly biotype detection. CK1 positive control; CK2 negative control; CK3 black control. a Whitefly biotype on infected tomato plants. b Whitefly biotype on infected cucumber plants. The size of 122 bp and 498 bp fragment based on amplification of mtCOI and restriction endonuclease was used to detect the biotype. Results of 20 samples were shown in figure a and b
Whitefly biotype and viruliferous rate
Virus | Number of whiteflies | Whitefly biotype | Number of viruliferous whiteflies | Viruliferous rate |
---|---|---|---|---|
ToCV | 60 | Q | 39 | 65.0% |
CCYV | 60 | Q | 33 | 55.0% |
Virus detection in plants
ToCV detection from tomato plants. CK1 positive control; CK2 negative control; CK3 black control. The size of 466 bp based on amplification of HSP70h gene of ToCV was used. Results of 20 samples were shown in this figure
CCYV detection from cucumber plants. CK1 positive control; CK2 negative control; CK3 black control. The size of 804 bp based on amplification of CP (coat protein) gene of CCYV was used. Results of 20 samples were shown in this figure
ToCV and CCYV detection from weeds. a CCYV detection on weeds. b ToCV detection on weeds. CK1 positive control; CK2 negative control; CK3 black control. The size of 804 bp based on amplification of CP (coat protein) gene of CCYV and the size of 466 bp based on amplification of HSP70h gene of ToCV were used. Results of 20 samples were shown in figure a and b
Nucleotide sequencing analysis
Nucleotide sequencing analysis of B. tabaci and plant viruses
Sample | Sequencing description | Accession | Max score | Total score | Query cover | E value | Identities |
---|---|---|---|---|---|---|---|
Tomato | Tomato chlorosis virus isolate ToCV-BJ segment RNA2 | KC887999.1 | 863 | 863 | 45% | 0.0 | 100% |
Cucumber | Cucurbit chlorotic yellows virus isolate GX-BH capsid protein gene | KX118632.1 | 1354 | 1354 | 97% | 0.0 | 99% |
B. tabaci | Bemisia tabaci biotype Q cytochrome oxidase subunit 1 (COI) gene | KT265875.1 | 1062 | 1062 | 99% | 0.0 | 99% |
Weed | Tomato chlorosis virus isolate ToCV-BJ segment RNA2 | KC887999.1 | 856 | 856 | 41% | 0.0 | 99% |
Weed | Cucurbit chlorotic yellows virus isolate GX-BH capsid protein gene | KX118632.1 | 1055 | 1055 | 77% | 0.0 | 97% |
Virus incidence dynamic on tomato, cucumber and weeds
Virus incidence dynamic on tomato, cucumber and weeds in four of plant growth stages. a Viruliferous rate of ToCV in four of the tomato growth stages. b Viruliferous rate of CCYV in four of the cucumber growth stages. Values are means ± SE. 1 transplanting stage; 2 seedling stage; 3 flowering stage; 4 ripening stage. On each growth stage, different lowercase letters of a-d indicate significant differences on weed and different uppercase letters of A-D indicate significant differences on plants (P < 0.05)
Discussion
B. tabaci is a most important insect vector in agricultural areas and has caused great losses in economy and crop production worldwide [25, 33]. The indirect damage caused by virus transmission is much serious than the direct feeding on the host. For example, TYLCV is transmitted by whitefly in a persistent manner, which causes destructive damage in China [9, 34]. In recent years, TYLCV has attracted the large attention and a series of measure has been used to prevent the disease by researchers in China [11, 35, 36, 37]. However, up to now, we still pay less attention to most of the semi-persistent viruses transmitted by the whitefly. Furthermore, those plant viruses such as ToCV and CCYV are huge potential crises to agricultural production.
In our research, we found that high density rates of Q at open field in Hainan province and at the same areas we determined that the leaves were infected by ToCV and CCYV, with the incidence of 69.8% and 62.6% on tomato and cucumber plants, respectively. Besides, the viruliferous rate of Q was 65.0% and 55.0% on the tomato and cucumber plants, respectively. Plant virus disease prevalence is closely related to the spread of insect vector. Although B. tabaci B has been shown to be an effective vector of ToCV [1], recently, Q has become a major threat to the quality and yields by transmitting ToCV [22]. Besides, B. tabaci Q plays more roles than B in carrying CCYV [38]. In this research, we notice that the prevalence of CCYV in cucumber and ToCV in tomato was high which was consistent with the high viruliferous rate of Q. Therefore we can speculate that high viruliferous rate of Q may facilitate transmission of ToCV and CCYV.
The weed A. philoxeroides, which was grown near the infected tomato and cucumber, was also infected by ToCV and CCYV. The virus dynamic was then detected on tomato, cucumber and the weeds nearby. In the four growth stages, virus showed a different dynamic on plants and on weeds. On tomato and cucumber plants, viruliferous rate of ToCV and CCYV increased gradually from transplanting stage to ripening stage. On weeds, viruliferous rate of ToCV and CCYV decreased gradually from ripening stage to transplanting stage. Furthermore, both of the ToCV and CCYV were detected on the weed, A. philoxeroides, which is a widely distributed weed in Hainan. To our knowledge, this is the first report of ToCV and CCYV on the weed, A. philoxeroides. From our results we can see that the weed, A. philoxeroides is co-infected and may promote the virus transmission, it’s a pity that we didn’t detect whether the whiteflies were co-infected on weeds, and this needs further confirmation. Notably, Hainan is the mainly vegetable production and breeding center especially for breeding tomato and cucumber in China. In winter season, vegetables in Hainan are transported to all of the north provinces of China because of the low temperature in north provinces. Therefore, the break out of these two viruses may cause fast transmission of ToCV and CCYV to other places via infected seed or viruliferous whiteflies.
Conclusion
This report firstly shows ToCV and CCYV detected in the same area with a high incidence in Hainan province, with a high viruliferous rate of Q on infected leaves. Furthermore, the virus dynamic shows a close relationship with the weed nearby, and the weed is infected by both ToCV and CCYV. Hainan is an extremely important vegetable production and seed breeding center in China. If the whitefly can carry these two viruses concurrently, co-infection in their mutual host plants can lead to devastating losses in the near future. Further research should be done to investigate the role of weed in the transmission of virus.
Notes
Acknowledgments
Not applicable.
Funding
This work was supported by the Special Fund for Agro-scientific Research in the Public Interest (No. 201303028), the National Natural Science Foundation of China (No. 31501643, 31571982 and 31571981), and the Agriculture Research System of China (CARS-25-B-05). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Availability of data and materials
The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.
Authors’ contributions
XT, XBS, XGZ and YL designed the experiments. XT and XBS performed the experiments. XT analyzed the data. XT and XBS wrote the manuscript. DYZ, FL, FY and YJZ contributed reagents/materials. All authors read and approved the final manuscript.
Ethics approval and consent to participate
Not applicable.
Consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Wintermantel WM, Wisler GC. Vector specificity, host range, and genetic diversity of Tomato chlorosis virus. Plant Dis. 2006;90:814–9.CrossRefGoogle Scholar
- 2.Brault V, Uzest M, Monsion B, Jacquot E, Blanc S. Aphids as transport devices for plant viruses. C R Biol. 2010;333:524–38.PubMedCrossRefGoogle Scholar
- 3.Pinheiro PV, Kliot A, Ghanim M, Cilia M. Is there a role for symbiotic bacteria in plant virus transmission by insects? Curr Opin Insect Sci. 2015;8:69–78.CrossRefGoogle Scholar
- 4.Whitfield AE, Rotenberg D. Disruption of insect transmission of plant viruses. Curr Opin Insect Sci. 2015;8:79–87.CrossRefGoogle Scholar
- 5.Wintermantel WM. Transmission efficiency and epidemiology of criniviruses. In Bemisia: bionomics and management of a global pest. Springer. 2009; 319–331.Google Scholar
- 6.Navas-Castillo J, Fiallo-Olivé E, Sánchez-Campos S. Emerging virus diseases transmitted by whiteflies. Annu Rev Phytopathol. 2011;49:219–48.PubMedCrossRefGoogle Scholar
- 7.Wisler G, Duffus J, Liu HY, Li R. Ecology and epidemiology of whitefly-transmitted closteroviruses. Plant Dis. 1998;82:270–80.CrossRefGoogle Scholar
- 8.De Barro PJ, Liu SS, Boykin LM, Dinsdale AB. Bemisia tabaci: a statement of species status. Annu Rev Entomol. 2011;56:1–19.PubMedCrossRefGoogle Scholar
- 9.Pan H, Chu D, Yan W, Su Q, Liu B, Wang S, Wu Q, Xie W, Jiao X, Li R, et al. Rapid spread of Tomato yellow leaf curl virus in China is aided differentially by two invasive whiteflies. PLoS One. 2012;7:e34817.PubMedPubMedCentralCrossRefGoogle Scholar
- 10.Pan H, Chu D, Liu B, Shi X, Guo L, Xie W, Carriere Y, Li X, Zhang Y. Differential effects of an exotic plant virus on its two closely related vectors. Sci Rep-UK. 2013;3:2230.CrossRefGoogle Scholar
- 11.Shi X, Pan H, Zhang H, Jiao X, Xie W, Wu Q, Wang S, Fang Y, Chen G, Zhou X. Bemisia tabaci Q carrying Tomato yellow leaf curl virus strongly suppresses host plant defenses. Sci Rep-UK. 2014;4:5230.CrossRefGoogle Scholar
- 12.Wintermantel WM, Wisler GC, Anchieta AG, Liu HY, Karasev AV, Tzanetakis IE. The complete nucleotide sequence and genome organization of Tomato chlorosis virus. Arch Virol. 2005;150:2287–98.PubMedCrossRefGoogle Scholar
- 13.Orfanidou C, Pappi P, Efthimiou K, Katis N, Maliogka V. Transmission of Tomato chlorosis virus (ToCV) by Bemisia tabaci biotype Q and evaluation of four weed species as viral sources. Plant Dis. 2016;100:2043–9.PubMedCrossRefGoogle Scholar
- 14.Fortes IM, Navas-Castillo J. Potato, an experimental and natural host of the crinivirus Tomato chlorosis virus. Eur J Plant Pathol. 2012;134:81–6.CrossRefGoogle Scholar
- 15.García-Cano E, Navas-Castillo J, Moriones E, Fernández-Muñoz R. Resistance to Tomato chlorosis virus in wild tomato species that impair virus accumulation and disease symptom expression. Phytopathology. 2010;100:582–92.PubMedCrossRefGoogle Scholar
- 16.Wisler GC, Li RH, Liu HY, Lowry DS, Duffus JE. Tomato chlorosis virus: a new whitefly-transmitted, phloem-limited, bipartite closterovirus of tomato. Phytopathology. 1998;88:402–9.PubMedCrossRefGoogle Scholar
- 17.Navas-Castillo J, Camero R, Bueno M, Moriones E. Severe yellowing outbreaks in tomato in Spain associated with infections of Tomato chlorosis virus. Plant Dis. 2000;84:835–7.CrossRefGoogle Scholar
- 18.Gharsallah C, Halima AB, Fakhfakh H, Gorsane F. Insights into the genetic diversity and the phylogenetic analysis of Tunisian isolates of Tomato chlorosis virus. Phytoparasitica. 2014;43:87–96.CrossRefGoogle Scholar
- 19.Moodley V, Gubba A, Mafongoya P. Occurrence of Tomato chlorosis virus (ToCV) on Datura stramonium near tomato crops (Solanum lycopersicum) in South Africa. Plant Dis. 2016;Google Scholar
- 20.Kil EJ, Lee YJ, Cho S, Auh CK, Kim D, Lee KY, Kim MK, Choi HS, Kim CS, Lee S. Identification of natural weed hosts of Tomato chlorosis virus in Korea by RT-PCR with root tissues. Eur J Plant Pathol. 2015;142:419–26.CrossRefGoogle Scholar
- 21.Zhao LM, Li G, Gao Y, Liu YJ, Sun GZ, Zhu XP. Molecular detection and complete genome sequences of Tomato chlorosis virus isolates from infectious outbreaks in China. J Phytopathol. 2014;162:627–34.CrossRefGoogle Scholar
- 22.Guevara-Coto JA, Barboza-Vargas N, Hernandez-Jimenez E, Hammond RW, Ramirez-Fonseca P. Bemisia tabaci biotype Q is present in Costa Rica. Eur J Plant Pathol. 2011;131:167.CrossRefGoogle Scholar
- 23.Tsai W, Shih S, Green S, Hanson P, Liu H. First report of the occurrence of Tomato chlorosis virus and Tomato infectious chlorosis virus in Taiwan. Plant Dis 2004; 88:311–311.Google Scholar
- 24.Zheng HX, Xia JX, Zhou XM, Zhang YJ. Be on alert of rapid diffusion of Toamto chlorosis virus transmitted by whitefly in China. China Vegetables. 2016; 22–26 (Chinese with English abstrct).Google Scholar
- 25.Abrahamian PE, Abou-Jawdah Y. Whitefly-transmitted criniviruses of cucurbits: current status and future prospects. Virus disease. 2014;25:26–38.PubMedCrossRefGoogle Scholar
- 26.Orfanidou C, Maliogka V, Katis N. First report of Cucurbit chlorotic yellows virus in cucumber, melon, and watermelon in Greece. Plant Dis 2015; 99:734–734.Google Scholar
- 27.Okuda M, Okazaki S, Yamasaki S, Okuda S, Sugiyama M. Host range and complete genome sequence of Cucurbit chlorotic yellows virus, a new member of the genus crinivirus. Phytopathology. 2010;100:560–6.PubMedCrossRefGoogle Scholar
- 28.Zeng R, Dai FM, Chen WJ, Lu JP. First report of Cucurbit chlorotic yellows virus infecting melon in China. Plant Dis 2011; 95:354–354.Google Scholar
- 29.Hamed K, Menzel W, Dafalla G, Gadelseed AMA, Winter S. First report of Cucurbit chlorotic yellows virus infecting muskmelon and cucumber in Sudan. Plant Dis 2011; 95:1321–1321.Google Scholar
- 30.Orfanidou C, Maliogka VI, Katis NI. First report of Cucurbit chlorotic yellows virus in cucumber, melon, and watermelon in Greece. Plant Dis 2014; 98:1446–1446.Google Scholar
- 31.Bananej K, Menzel W, Kianfar N, Vahdat A, Winter S. First report of Cucurbit chlorotic yellows virus infecting cucumber, melon, and squash in Iran. Plant Dis 2013; 97:1005–1005.Google Scholar
- 32.Chu D, Wan FH, Zhang YJ, Brown JK. Change in the biotype composition of Bemisia tabaci in shandong province of China from 2005 to 2008. Environ Entomol. 2010;39:1028–36.PubMedCrossRefGoogle Scholar
- 33.Brown JK, Czosnek H. Whitefly transmission of plant viruses. Adv Bot Res. 2002;36:65–76.CrossRefGoogle Scholar
- 34.Liu B, Preisser EL, Chu D, Pan H, Xie W, Wang S, Wu Q, Zhou X, Zhang Y. Multiple forms of vector manipulation by a plant-infecting virus: Bemisia tabaci and Tomato yellow leaf curl virus. J Virol. 2013;87:4929–37.PubMedPubMedCentralCrossRefGoogle Scholar
- 35.Shi X, Pan H, Xie W, Wu Q, Wang S, Liu Y, Fang Y, Chen G, Gao X, Zhang Y. Plant virus differentially alters the plant's defense response to its closely related vectors. PLoS One. 2013;8:e83520.PubMedPubMedCentralCrossRefGoogle Scholar
- 36.Fang Y, Jiao X, Xie W, Wang S, Wu Q, Shi X, Chen G, Su Q, Yang X, Pan H. Tomato yellow leaf curl virus alters the host preferences of its vector Bemisia tabaci. Sci Rep-UK. 2013;3:2876.CrossRefGoogle Scholar
- 37.Ning W, Shi X, Liu B, Pan H, Wei W, Zeng Y, Sun X, Xie W, Wang S, Wu Q. Transmission of Tomato yellow leaf curl virus by Bemisia tabaci as affected by whitefly sex and biotype. Sci Rep-UK. 2015;5:10744.CrossRefGoogle Scholar
- 38.Lu SH. Li JH, Wang XL, Song DY, Bai R, Shi Y, Gu QS, Kuo YW, Falk BW. Yan FM A semipersistent plant virus differentially manipulates feeding behaviors of different sexes and biotypes of its whitefly vector Viruses. 2017;9:4.Google Scholar
Copyright information
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.