Asp305Gly mutation improved the activity and stability of the styrene monooxygenase for efficient epoxide production in Pseudomonas putida KT2440
Abstract
Background
Styrene monooxygenase (SMO) catalyzes the first step of aromatic alkene degradation yielding the corresponding epoxides. Because of its broad spectrum of substrates, the enzyme harbors a great potential for an application in medicine and chemical industries.
Results
In this study, we achieved higher enzymatic activity and better stability towards styrene by enlarging the ligand entrance tunnel and improving the hydrophobicity through error-prone PCR and site-saturation mutagenesis. It was found that Asp305 (D305) hindered the entrance of the FAD cofactor according to the model analysis. Therefore, substitution with amino acids possessing shorter side chains, like glycine, opened the entrance tunnel and resulted in up to 2.7 times higher activity compared to the wild-type enzyme. The half-lives of thermal inactivation for the variant D305G at 60 °C was 28.9 h compared to only 3.2 h of the wild type SMO. Moreover, overexpression of SMO in Pseudomonas putida KT2440 with NADH regeneration was carried out in order to improve biotransformation efficiency for epoxide production. A hexadecane/buffer (v/v) biphasic system was applied in order to minimize the inactivation effect of high substrate concentrations on the SMO enzyme. Finally, SMO activities of 190 U/g CDW were measured and a total amount of 20.5 mM (S)-styrene oxide were obtained after 8 h.
Conclusions
This study offers an alternative strategy for improved SMO expression and provides an efficient biocatalytic system for epoxide production via engineering the entrance tunnel of the enzyme’s active site.
Keywords
Styrene monooxygenase Biocatalysis Site-saturation mutagenesis EpoxideAbbreviations
- epPCR
error-prone PCR
- CDW
cells dry weight
- KP buffer
potassium phosphate buffer
Background
Chiral epoxides are a class of high value-added synthons or intermediates with a broad scope of market demand and application in the production of pharmaceuticals, agrochemicals, as well as versatile fine chemicals. Conventionally, epoxides are produced by chemical catalysis. However, this approach presents many shortcomings such as harsh reaction conditions, low selectivity, and many by-products, thus causing significant environmental pollution. Considerable efforts and several enzymatic approaches have been designed by synthetic chemists to overcome these challenges and thus find environmentally friendly alternatives [1, 2, 3].
Styrene monooxygenase (SMO, EC: 1.14.14.11), a flavin-dependent enzyme complex consisting of two components (an oxygenase subunit of StyA and a reductase subunit of StyB) [4], was found in several Pseudomonas species and has been used successfully to catalyze styrene to (S)-styrene oxide, a valuable chiral intermediate for synthesizing some important pharmaceuticals, such as cilastatin and levamisole [5, 6]. The SMO, which is naturally involved in the upper catabolic pathway of styrene degradation, shows excellent enantioselectivity in the epoxidation of styrene to (S)-styrene epoxide with > 99% ee [7]. This has attracted many efforts to the synthesis of chiral epoxides [8, 9, 10]. For example, SMOs from Pseudomonas fluorescens ST and Pseudomonas sp. VLB120 have been used to convert conjugated styrene derivatives as well as aromatic sulfides [11, 12]. Therefore, recombinant SMO expression in E. coli for use in biocatalysis has been investigated by several studies [13].
However, low substrate solubility, low enzyme activity and the consumption of redox equivalents by the SMO are the primary factors restricting its application for epoxide biosynthesis. Several approaches have been developed to solve this problem during the past few decades [14, 15, 16]. Wu et al. produced (S)-vicinal diols with more than 99% ee in recombinant E. coli using 10% ethanol as cosolvent [7]. Furthermore, Hu et al. used a biphasic n-hexanol buffer system to improve the epoxide hydrolase-catalyzed kinetic resolution [15]. The use of a biphasic system in tissue-mediated biotransformation was mainly aimed at overcoming the low water solubilities of substrates and inhibitory effects of products [17, 18].
Moreover, the strategies for screening high enzyme activity variants and exploring the efficient biotransformation are also essential. Therefore, Gursky et al. previously undertook the random-library screening approach based on color (indigo) formation [4]. However, this method cannot be easily adapted to detect changes in the substrate preferences of SMOs [19]. Another study on the engineering of the SMO from P. putida CA-3 has been performed by screening an error-prone PCR (epPCR) library using the indigo assay [4]. However, the method carries the risk of generating mutants with increased activity only towards the analog substrate indigo, but not the target substrate styrene [20]. Assays based on the reaction of 1,2-diols or on the reaction of epoxides with 4-nitrobenzyl-pyridine might be suitable for this purpose [19, 21]. The NBP assay provides a sensitive method for detection on paper and thin-layer chromatograms and for quantitative colorimetric analysis of many epoxides of biological, chemical and environmental significance [22]. In this study, a new high throughput screening method based on NBP assay and error prone PCR was established for improved screening of high enzyme activity mutants. Such mutants harbor a great potential for an application in epoxide biosynthesis.
Scheme of the tunable multi enzyme coordinated biocatalytic system with cofactor regeneration for the one-pot conversion of olefins and aromatic compounds to (S)-epoxide using recombinant Pseudomonas putida KT2440
Results and discussion
Screening for high enzyme activity mutants from epPCR library
The styAB gene (Gene ID: DQ177365.1) encoding for SMO from Pseudomonas putida SN1 CGMCC1.2309 was used as a template. The enzyme activity of the SMO derived from Pseudomonas putida SN1 was low, with a particularly poor thermostability [24]. In order to improve the SMO activity and thermostability of the enzyme expressed in E. coli as well as to attenuate its degree of inactivation in the reaction, a new approach was developed in 96-deep well plates to screen high enzyme activity variants based on color rendering between the epoxide and 4-nitrobenzyl pyridine (4-NBP) from a random mutagenesis library containing more than 2000 SMO mutants [19]. Approximately 56 positive clones with improved color formation on the 96-well plates were identified. However, there were only two mutants with confirmed improved catalytic activity (121% and 195%) compared to the wild type enzyme. At this stage, the mutant with the highest enzyme activity was selected for further optimization. This mutant contained three substitutions D305V, V53G and S189I, defined as A (D305V/V53G/S189I). The new variant with three-site mutations was used as the template for the second round of epPCR. Screening of more than 1000 colonies yielded no positive colonies with improved enzyme activity when compared to those from the first round of epPCR.
Biotransformation of styrene by the wild type and the mutations. The whole cell biotransformation with the recombinant cells of BL21/pET-28a-styAB-fdh and its variants were carried out in 50 mL flasks with 10 mL of the KP buffer (200 mM, pH 8.0) containing 26 mM of substrate styrene and 1.0 g cell (dry cell weight) with addition of 50% (v/v) hexadecane at 30 °C and 220 rpm on a rotatory shaker for 15 min. The organic phases were combined, dried with anhydrous sodium sulfate, and subjected to the reverse phase HPLC analysis on a Luna C18 column (flow rate: 0.8 mL/min, methanol–water mixture at a ratio of 75:25). Activities were normalized as percentages of the activity of the wild type. 100% corresponds to an initial activity of 72 ± 10 U/g CDW. The variant of A depicts mutation of V53G/S189I/D305V derived by site-directed mutagenesis of the epPCR library. The mutation of V53G, S189I and D305V were derived by site-directed mutagenesis. All assays were performed in triplicate and the standard deviations of the biological replicates are represented by error bars
Site-saturation mutagenesis at residue D305 and discussion of the results by structural docking analysis
The orientation of FAD docked into the putative active site of SMO (PDB ID: 3IHM). a The structure of wild-type SMO (Residue D305G is shown in red of the circle). b The structure of the D305G mutant. c The channel that interacts with FAD. d The channel of residues in the internal structure. The positions of residues predicted to interact with FAD are shown in yellow (the residues Leu45, Val48, Val170, Val211, Leu269, Glu271, Glu272, Glu271, Glu272, Glu213, and Pro302). FAD is shown in orange by the stick mode. The figure was generated using Autodock 4.0 and displayed by Pymol. The number of Autodock 4GA runs was increased from 20 to 40, the docking grids were set as 20 × 22 × 22 Å for styrene and 27 × 30 × 28 Å for flavine adenine dinucleotide
Biotransformation of styrene by the wild type and the site-saturation mutations at D305. The whole cell biotransformation was conducted by the recombinant cells of BL21/pET-28a-styABD305X-fdh and its wild type (X = V, A, G). The reaction was carried out in 50 mL flasks with 10 mL of KP buffer (200 mM, pH 8.0) containing 26 mM of substrate styrene and 1.0 g cell of dry weight with addition of 50% (v/v) hexadecane at 30 °C and 220 rpm on a rotatory shaker for 15 min. After incubation, the product was withdrawn and subjected to the reverse phase HPLC analysis. The reaction mixture was used to determine specific epoxidation activities. The enzyme activity of wild type was set to 100%, corresponding to the initial activity of 72 ± 10 U/g CDW. All assays were performed in triplicate and the standard deviations of the biological replicates are represented by error bars
Expression and purification of wild type and mutant enzymes
SDS-PAGE analysis of the overexpression of StyA, StyB and FDH in different hosts. The following samples and markers are shown: M, protein marker; Blank, whole cell protein of control E. coli; Lane 1, whole cell protein of E. coli-pET28a- styA; Lane 2, purified proteins of E. coli-pET28a-styA; Lane 3, whole cell protein of E. coli-pET28a-styB; Lane 4, purified proteins of E. coli-pET28a-styB; Lane 5, whole cell protein of E. coli-pET28a-fdh; Lane 6, purified proteins of E. coli-pET28a-fdh; Lane 7, whole cell protein of Pseudomonas putida KT2440/pJB861-styAB-fdh
Enzyme characterization of SMO
Enzymatic stability for wild type SMO and its variants in E. coli expression host. Thermal stabilities of the enzymes were carried out by purified enzyme incubation in KP (potassium phosphate) buffer (200 mM, pH 8.0) for 12 h at a range of temperatures from 30 to 65 °C. Afterwards, the residual activity of the pre-incubated SMOs was tested in the following reaction system: 0.8 U/mL purified SMOA, 1.6 U/mL of purified SMOB, 1.7 U/mL formate dehydrogenase, 0.2 M sodium formate, 0.3 mM NADH, 1 mM NAD+, 0.05 mM FAD, and 200 mM styrene (from a 200-fold stock in ethanol). And the pH stability of the wild type and variants was determined by purified enzyme incubation at 30 °C for 12 h in the following buffer system: 0.05 M acetate buffer (pH 3.0–6.0), 0.05 M phosphate buffer (pH 6.0–8.0), and 0.05 M glycine–NaOH buffer (pH 8.0–11.0). After incubation, their residual enzyme activities were measured at 30 °C in KP buffer (200 mM, pH 8.0). a Enzyme inactivation assay at different temperatures for 12 h. b Time courses of thermal inactivation at 60 °C. c Enzyme inactivation assay at different pH for 12 h. The initial activity before incubation was set to 100%, 100%-value corresponds to an initial activity of 5.6 ± 0.21 U/mg. All assays were performed in triplicate and the standard deviations of the biological replicates are represented by error bars
Kinetic analysis of the variants and the wild type enzyme towards the substrate styrene
The kinetic parameters of mutants screened from site-saturation mutagenesis at position 305 compared to the wild type
Mutations | Km (mM) | kcat (s−1) | kcat/Km (mM−1 s−1) |
---|---|---|---|
Wild type | 0.85 ± 0.12 | 1.08 ± 0.03 | 1.27 ± 0.15 |
D305V | 0.54 ± 0.08 | 1.43 ± 0.03 | 2.65 ± 0.17 |
D305A | 0.46 ± 0.11 | 1.53 ± 0.02 | 3.33 ± 0.21 |
D305G | 0.36 ± 0.14 | 1.70 ± 0.02 | 4.72 ± 0.33 |
Screening of water-miscible and water-immiscible organic solvents for the application in a SMO-catalyzed biotransformation
An appropriate biphasic system could be used to improve the biocatalytic efficiency by enhancing the enzyme tolerance to toxic substrate or product [16]. Therefore, biocompatibility of the D305G variant expressed in Pseudomonas putida KT2440 was taken into consideration in order to screen the appropriate organic solvents for the enzyme reaction [36]. Four commonly used water-miscible organic solvents were then selected to determine their effects on SMO at different concentrations (shown in Additional file 2: Figure S2a). The results indicated that 10% (v/v) concentration of the four solvents (ethanol, isoamylalcohol, DMSO, isopropanol) had a minimal effect on SMO activity as the enzyme retained more than 87% of its initial activity. However, when the concentration of the organic solvent was increased, the enzyme activity of the SMO was significantly reduced. When 30% of the water-miscible organic solvent was added, the SMO retained 0–12% of the initial enzyme activity. This phenomenon was probably due to the fact that such polar solvents tend to denature proteins and thus led to the loss of the enzyme activity. The least toxic effect on the SMO activity was observed when 15% of isoamylalcohol was used in the reaction with the enzyme retaining 90% of the initial activity in this solvent.
Biotransformation of styrene to (S)-styrene oxide by whole cells of recombinant Pseudomonas putida KT2440 in different solvents. The whole cell biotransformation was conducted by Pseudomonas putida KT2440/pJB861-styABD305G-fdh toward styrene. The reaction was carried out in 50 mL flasks with 10 mL of KP buffer (200 mM, pH 8.0) containing 26 mM of the substrate styrene and biomass with a cell dry weight of 1.0 g, incubated at 30 °C for 8 h. And the reaction system was substituted with different water-miscible (10%, v/v) and water-immiscible (1:1, v/v) solvents. The product was withdrawn periodically and analyzed by reverse phase HPLC on a Luna C18 column at a flow rate of 0.8 mL/min under a methanol–water mixture at a ratio of 75:25. The reaction mixture after 15 min was used to determine specific epoxidation activities. All assays were performed in triplicate; each column represents the mean of triplicate assays
Expression of SMO in recombinant Pseudomonas putida KT2440 and application for epoxidation
Substrate conversion and enantiomeric excess for the bioepoxidation of styrene, 3,3-dimethyl-1-butene, 3-allyl chloride and 2-chlorostyrene using the recombinant cells of Pseudomonas putida KT2440 (wild type and mutants) of SMO
Mutant | ||||||||
---|---|---|---|---|---|---|---|---|
Conversion (%) | ee (%) | Conversion (%) | ee (%) | Conversion (%) | ee (%) | Conversion (%) | ee (%) | |
Wild type | 85 | > 99 (S,S) | 58 | 71 (S,S) | 42 | 52 (S,S) | 76 | > 99 (S,S) |
D305A | 93 | > 99 (S,S) | 67 | 70 (S,S) | 51 | 48 (S,S) | 86 | > 99 (S,S) |
D305V | 91 | > 99 (S,S) | 62 | 72 (S,S) | 48 | 50 (S,S) | 81 | > 99 (S,S) |
D305G | 95 | > 99 (S,S) | 71 | 70 (S,S) | 54 | 53 (S,S) | 97 | > 99 (S,S) |
Conclusions
In conclusion, the enzymatic activity of SMO from Pseudomonas sp. SN1 was enhanced by screening and engineering some crucial residues adjacent to its flavine adenine dinucleotide (FAD) binding pocket. A new method for screening high-activity mutants from a random mutant library was designed. Using this method, a three-site mutant with 1.9-fold increased enzymatic activity than that of wild type was obtained. The variant with D305V mutation was the most active one after analyzing the results of site-directed mutagenesis yielding 1.9-fold higher activities than the wild type. Moreover, the docking results showed that the residue D305 was located at the FAD-binding cavity and its large side chain blocked FAD from accessing the cavity and thus played a key role in coenzyme interaction with the active site. Site-saturation mutagenesis at this position 305 resulted in two more mutants (D305A and D305G) with better specific activities (2.3- and 2.7-times, respectively), and higher half-live times during thermal inactivation compared to the wild type. The engineered SMO was also successfully expressed with high yields in Pseudomonas putida KT2440 and E. coli. Finally, aromatic as well as other substrates were transformed with an established hexadecane/buffer biphasic system, and the results indicated decreased substrate toxicity and product inhibition for the mutants. Finally, the average product conversion rate reached 2.56 mM/h using the mutant D305G, which was 2.7 times higher than that of Pseudomonas putida CA-3 (0.95 mM/h) [4].
Materials and methods
Strains, plasmids and chemicals
Primers used in this work
Primers | Sequences 5′–3′ |
---|---|
N46S F | TGGTCTGCGTTTACTGAGCACAGTTGCCCACAATG |
V48G F | GCGTTTACTGAATACAGGTGCCCACAATGCCGTGA |
V48Q F | GCGTTTACTGAATACACAGGCCCACAATGCCGTGA |
M186L F | GATTCGCGCAGTGACACTGAGCTTCAGCCCGGGTC |
M186G F | GATTCGCGCAGTGACAGGTAGCTTCAGCCCGGGTC |
L269G F | CAGTTCTTTAGACATCGGTCAAGGTGGCGTTGTGC |
L269V F | CAGTTCTTTAGACATCGTTCAAGGTGGCGTTGTGC |
D305A F | CGTTGATCCGGTTCTGGCCCAAGGTGCCAATATGG |
D305X F | CGTTGATCCGGTTCTGNNNCAAGGTGCCAATATGG |
R | GCCTTACTGGTTAGCAGAATG |
Construction of the mutant library
The mutagenesis library was constructed by error-prone PCR (ep-PCR) according to the manufacturer’s instructions of Gene Morph Random Mutagenesis kit [44]. We moderated the frequency of mutation to 2–4 mutations/kb by adjusting the concentration of the initial template during the PCR reaction. The primers 5′-ATGAAGAAACGCATTGGCATTGT-3′ and 5′-TGCTGCAATGGTCGGTGC-3′ were used to construct epPCR libraries of SMO. The recombinant plasmid pET-28a-styA encoding wild type styrene monooxygenase was used as the template for the first round of epPCR and the most active mutant from the first round of epPCR was used as template for the second round of epPCR.
The fragments of amplified PCR products were purified and digested by NcoI and HindIII at 37 °C for 45 min and then ligated into the vector pET28a, which was also digested with the same endonucleases. Then the products were transformed into E. coli BL21 (DE3), plated on Luria–Bertani (LB) agar containing 50 μg/mL kanamycin then cultured at 37 °C for 12 h.
Screening for high-activity variants
Single colonies from the mutant library were picked from Luria–Bertani (LB) plates containing kanamycin (50 μg/mL) and incubated at 37 °C in 96-well microplates overnight. The overnight bacterial culture (100 μL) was then transferred to fresh 96-deep well plates containing LB liquid medium incubated at 37 °C and 160 rpm for 2 h, induced for enzyme expression with 1 mM IPTG for 2 h then cultured for 12 h. The cells were harvested by centrifugation at 2260×g for 10 min. The supernatant was removed from the 96-deep well plates, then the E. coli cells were suspended to a cell density of 1.0 g cdw/L in KP (potassium phosphate) buffer (0.2 M pH 8.0) containing glucose (2%, w/v) and 40 μL of a substrate stock solution (0.2 M in ethanol) in a 2 mL system. The reaction mixture was incubated at 30 °C for 30 min with 200 rpm shaking [2].
In a stoppered test tube, 200 μL of the reaction mixture was pipetted into a mixed solution containing 800 μL of buffer A (buffer A is a mixture of 50 mM K2HPO4-KH2PO4, pH 7.0) and 400 μL of 10 mM 4-NBP (4-NBP is equimolded with an equal volume of ethylene glycol and acetone; the concentration of the mother liquor is 100 mM) and then reacted at 80 °C for 10 min [45]. Afterwards, the mixture was immediately cooled down by ice bathe for 5 min. In addition, 400 μL of 50% (v/v) trimethylamine-acetone buffer were added into the mixture and the total solution turned blue. The samples were subsequently measured by spectrophotometer at an absorbance–wavelength of 565 nm [46]. The higher specific activity mutants were selected for further studies. E. coli BL21/pET28a-styAB (wild type) was used as a control.
Site-directed and site-saturation mutagenesis
Site-directed and site-saturation mutagenesis of the styAB gene at D305 were carried out using whole-plasmid two-step PCR method [47]. The mutation primers used for this are listed in Table 3. Site-saturation mutagenesis at position D305 was accomplished by the degenerate codon of NNN (N represents A, T, G or C). In addition, the improved fragments of amplified PCR products were purified and digested by NcoI and HindIII at 37 °C for 45 min and then ligated into the vector pET28a, which was also digested with the same endonucleases. The recombinant plasmids were finally transformed into E. coli BL21 (DE3) and sequenced by Sangon Biotech to confirm successful mutations.
Structure simulation and molecular docking studies
The X-ray crystal structure of the oxygenase subunit of P. putida S12 StyA was obtained from the PDB database (PDB ID: 3IHM). The P. putida S12 StyA has 90% amino acid sequence similarity to that from Pseudomonas putida strain SN1 (Additional file 5: Figure S1). The structure models of the wild type SMO were constructed by homology modeling and downloaded from SWISS-MODEL Workspace (http://swissmodel.expasy.org/) [48, 49]. The 3D structure of the styrene ligand and the cofactor flavine adenine dinucleotide (FAD) were downloaded from http://www.chemspider.com/website and prior to docking, all water molecules were removed and non-polar hydrogen atoms added using MGLTools 1.5.4 [50]. AutoDock 4.2 software (Scripps Institute, California, USA) was used for docking. The number of AutoDock 4GA runs was increased from 20 to 40, the docking grids were set as 20 × 22 × 22 Å for styrene and 27 × 30 × 28 Å for flavine adenine dinucleotide (FAD) [50]. The 10 independent runs of the ligand-receptor complex from AutoDock 4.2 were calculated by the energy interaction value using MGLTools 1.5.4 and the best docking pose was chosen and visualized by Pymol.
Expression and purification of recombinant proteins from E. coli
The single colonies were grown overnight at 37 °C in LB media containing 50 μg/mL kanamycin. One milliliter of overnight culture was then inoculated into 100 mL of Luria–Bertani (LB) medium also containing 50 μg/mL kanamycin, then cultured at 37 °C until the OD600 concentration reached 0.4. Isopropyl-d-1-thiogalactopyranoside(IPTG)was added to a final concentration of 0.5 mM in medium to induce protein expression. Afterwards, the cells were cultured at 20 °C for 18 h. The cultures were subsequently harvested by centrifuging at 8000×g for 8 min at 4 °C.
Recombinant E. coli cells (wet weight) treated with lysozyme were lysed by sonication in buffer A, consisting of 0.1 M potassium phosphate (pH 8.0), 20% glycerol (v/v), 1 mM phenylmethyl sulfonylfluoride (PMSF), 0.5 M potassium chloride, 0.1 mM dithiothreitol (DTT) and 5 mM imidazole [51]. The lysate was centrifuged at 8000×g for 20 min, and the supernatant was purified in a 1 mL HisTrapTM HP column on an AKTA purifier system (GE Healthcare, Sweden) with binding buffer (0.02 M Tris–HCl bufer and 0.5 M NaCl, pH 7.4) at a 0.5 mL/min loading rate. The purified protein was eluted at 1 mL/min flow rate against a linear gradient of imidazole concentrations in buffer A ranging from 0 to 0.5 M. Then, the purified enzymes were pooled for SDS-PAGE analysis. A Bradford protein assay kit was used to determined protein concentration [52].
Enzyme assay and HPLC analytics
The enzyme activities and the kinetic parameters were determined using purified enzymes from E. coli by measuring the formation of styrene oxide using HPLC with 2 mL volumes, consisting of 0.2 M KP buffer (pH 8.0), 0.8 U/mL of purified SMOA, 1.6 U/mL of purified SMOB, 1.7 U/mL of purified formate dehydrogenase (FDH: EC 1.2.1.2, from Candida boidinii), 0.2 M sodium formate, 0.3 mM NADH, 1 mM NAD+, 0.05 mM FAD, and varying concentrations of styrene (from a 200-fold stock in ethanol). The reaction mixture was shaken at 200 rpm and 30 °C for 12 h. Furthermore, the mixture was extracted with ether and analyzed with reverse phase HPLC on a Luna C18 (4.6 mm × 150 mm) column at a flow rate of 0.8 mL/min. The mobile phase consisted of a methanol–water mixture at a ratio of 75:25. One unit (U) is defined as the activity that produces 1 μmol of oxide per min.
Specific epoxidation activities were measured using the whole cells and it was calculated as an average activity based on the amount of product formed in given, constant time with the knowledge of the possibility that substrate conversion is not linear to time during the assay period [24, 53]. Experiments were repeated at least three times independently. The recombinant cells of E. coli BL21 or Pseudomonas putida KT2440 with 1.0 g CDW/L were resuspended in 10 mL KP buffer (200 mM, pH 8.0) and 50% (v/v) hexadecane containing 26 mM (in organic solvent) of one of the following substrates: styrene, 2-chlorostyrene, 3,3-dimethyl-1-butene or 3-allyl chloride (Additional file 6: Figure S5). Afterwards, the cultures were incubated at 30 °C for 8 h at 220 rpm on a rotatory shaker and terminated by extraction with ether. The reaction mixture that lasted for 15 min was used to determine the specific epoxidation activities. The combined organic extracts were dried with anhydrous sodium sulfate and subjected to HPLC analysis. Chemical yields were analyzed by reverse-phase HPLC on a Luna C18 column at a flow rate of 0.8 mL/min.
Determination of the SMO enzyme properties and kinetics assays
The optimum temperature of SMO from the E. coli was determined using 200 mM potassium phosphate buffer (pH 8.0) with temperature ranging from 5 to 45 °C. The optimum pH was measured by assaying the enzyme activity at various pH values (0.05 M acetate buffer, pH 3.0–6.0; 0.05 M phosphate buffer, pH 6.0–8.0; 0.05 M glycine–NaOH buffer, pH 8.0–11.0) at 30 °C. In addition, thermal stabilities of the enzymes were carried out by incubation in KP (potassium phosphate) buffer (200 mM, pH 8.0) for 12 h at a range of temperatures from 30 to 65 °C. The residual enzyme activities of the wild type SMO and its variants after incubation were all measured at 30 °C in KP buffer (pH 8.0). Furthermore, the FDH with high stability and activity was used as the coenzyme for SMO. When measuring the residual enzyme activity of SMO, an excess of formate dehydrogenase was added to ensure adequate supply of coenzyme. Moreover, the pH stabilities of the wild type and its variants were determined by purified enzymes incubation at 30 °C for 12 h in different buffers with pH values ranging from 5 to 11. After incubation, their residual activities were measured in KP buffer (0.05 M, pH 8.0) at 30 °C. For the thermal stabilities and pH stabilities, only the SMO was pre-incubated at different temperatures or pH and then the residual enzyme activity was measured at 30 °C and pH 8.0. However, the FDH (EC 1.2.1.2: formate dehydrogenase) was not incubated at different temperature or pH values. The Tm value defined as the temperature, at which half of the initial enzyme activity remained, was determined according to the plots of residual relative activity (%) versus temperature (°C). Activity of wild type SMO and its variants at 30 °C in KP buffer (0.05 M, pH 8.0) without incubation was defined as 100%.
Kinetic parameters of the wild type SMO and variants were determined in KP buffer (0.05 M, pH 8.0) at 30 °C with varied concentration of the substrate styrene (with concentration range from 0.5 mM to 16 mM). Kinetic parameters kcat and Km were obtained with the help of software Origin 8.5 by plotting enzymatic activity versus substrate concentrations and fitting them using the Michaelis–Menten equation. The parameter kcat was then calculated according to the following equation: kcat = Vmax/(E), in which (E) means the molar concentration of the enzymes as shown in Additional file 7: Figure S4 [33].
Construction of recombinant Pseudomonas putida KT2440
One of the improved variants styABD305X (X = V, A, G) or the wild type were cloned, together with fdh, into the expression plasmid pJB861 and the recombinant plasmid pJB861/styABD305X-fdh or pJB861/styAB-fdh was transformed into competent Pseudomonas putida KT2440 cells by electroporation in order to find the optimal system for biotransformation of the olefins and aromatic compounds [54]. All positive clones were sequenced by Sangon Biotech. The single colonies were grown over 24 h at 30 °C in EM medium containing kanamycin (50 μg/mL). One milliliter of the culture was then inoculated into 100 mL of EM medium, then cultured at 30 °C for 24 h to induce the protein expression. The cells were harvested by centrifugation at 8000×g for 8 min at 4 °C.
Screening of organic solvents to construct a biphasic system
Effects of water-miscible and water-immiscible organic solvents on enzyme activity of SMO were determined to select suitable organic solvents for constructing a biphasic system (Additional file 2: Figure S2). The whole cell biotransformation was performed by using Pseudomonas putida KT2440/pJB861-styABD305G-fdh in presence of styrene. The reaction was carried out in 50 mL flasks with 10 mL of KP buffer (200 mM, pH 8.0) containing 26 mM of the substrate styrene and biomass with a cell dry weight of 1.0 g. The cultures were incubated at 30 °C for 8 h. All the study conditions were the same except the presence of 10, 15, 20 or 30% (v/v) of ethanol, isopropanol, cyclodextrin or DMSO [55]. The reaction solution without adding any organic solvent was used as a control. Furthermore, the tolerance of SMO in different water-immiscible organic solvents was additionally tested using hexadecane, bis-(2-ethylhexyl) phthalate (BEHP), n-hexane, toluene, dichloromethane, ethyl acetate, trichloromethane and cyclohexane. The reaction mixture containing KP buffer and one of the water-immiscible organic solvent (1:1, v/v) was incubated at 30 °C for 8 h with shaking at 220 rpm. After incubation, the reaction mixture was terminated by centrifugation. The organic phase was analyzed by HPLC. For the aqueous phase, multiple extractions were performed to ensure complete separation of the product in the organic phase. KP buffer with enzyme, but without any pretreatment of the organic solvent, was used as control. Among all the organic solvents, there are 8 solvents which were used to construct biphasic systems for a biotransformation process at high substrate concentration. Reaction samples (100 μL) was withdrawn periodically and analyzed by reverse phase HPLC on a Luna C18 column at a flow rate of 0.8 mL/min under a methanol–water mixture at a ratio of 75:25.
Notes
Authors’ contributions
CLT, XZ and ZMR conceived and designed the experiments; CLT performed the experiments; MJX, TWY, ZJZ, TO and STY analyzed the data; CLT wrote the paper. All authors read and approved the final manuscript.
Acknowledgements
We thank for the supports by the Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions, Top-notch Academic Programs Project of Jiangsu Higher Education Institutions (TAPP), Ningxia Key Laboratory for Food Microbial-Applications Technology and Safety Control, the 111 Project (111-2-06), and the Jiangsu province “Collaborative Innovation Center for Modern Industrial Fermentation” industry development program. We also would like to thank Vazyme for their excellent technical assistance.
Competing interests
The authors declare that they have no competing interests.
Availability of data and materials
The authors declare that all the data supporting the findings of this study are available within the article and its additional files.
Consent for publication
Not applicable.
Ethics approval and consent to participate
Not applicable.
Funding
This work was funded by the National Natural Science Foundation of China (31500065), Natural Science Foundation of Jiangsu Province (BK20150142), The Fundamental Research Funds for the Central Universities (JUSRP51708A), National first-class discipline program of Light Industry Technology and Engineering (LITE2018-06), Key research and development program of Ningxia hui autonomous region(2017BY069)and The science and technology innovation team foundation of Ningxia hui autonomous region (KJT2017001), the Program of the Key Laboratory of Industrial Biotechnology, Ministry of Education, China (KLIB-KF201703).
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary material
References
- 1.Kuhn D, Kholiq MA, Heinzle E, Bühler B, Schmid A. Intensification and economic and ecological assessment of a biocatalytic oxyfunctionalization process. Green Chem. 2010;12:815–27.CrossRefGoogle Scholar
- 2.Wu S, Chen Y, Xu Y, Li A, Xu Q, Glieder A, Li Z. Enantioselective trans-dihydroxylation of aryl olefins by cascade biocatalysis with recombinant Escherichia coli coexpressing monooxygenase and epoxide hydrolase. ACS Catal. 2014;4:409–20.CrossRefGoogle Scholar
- 3.Zhou Y, Wu S, Li Z. Cascade biocatalysis for sustainable asymmetric synthesis: from biobased l-phenylalanine to high-value chiral chemicals. Angew Chem. 2016;55:11647–50.CrossRefGoogle Scholar
- 4.Gursky LJ, Nikodinovic-Runic J, Feenstra KA, O’Connor KE. In vitro evolution of styrene monooxygenase from Pseudomonas putida CA-3 for improved epoxide synthesis. Appl Microbiol Biotechnol. 2010;85:995–1004.PubMedCrossRefGoogle Scholar
- 5.Clissold SP, Todd PA, Campolirichards DM. Imipenem/cilastatin. A review of its antibacterial activity, pharmacokinetic properties and therapeutic efficacy. Drugs. 1987;33:183–241.PubMedCrossRefGoogle Scholar
- 6.Panke S, Witholt B, Schmid A, Wubbolts MG. Towards a biocatalyst for (S)-styrene oxide production characterization of the styrene degradation pathway of Pseudomonas sp. strain VLB120. Appl Environ Microbiol. 1998;64(66):2032.PubMedPubMedCentralGoogle Scholar
- 7.Wu S, Zhou Y, Wang T, Too HP, Wang DI, Li Z. Highly regio- and enantioselective multiple oxy- and amino-functionalizations of alkenes by modular cascade biocatalysis. Nat Commun. 2016;7:11917.PubMedPubMedCentralCrossRefGoogle Scholar
- 8.Kang LT, Dmytrenko O, Otto K, Schmid A, Schwaneberg U. A p-nitrothiophenolate screening system for the directed evolution of a two-component epoxygenase (StyAB). J Mol Catal B Enzyme. 2008;50:121–7.CrossRefGoogle Scholar
- 9.Park JB, Bühler B, Habicher T, Hauer B, Panke S, Witholt B, Schmid A. The efficiency of recombinant Escherichia coli as biocatalyst for stereospecific epoxidation. Biotechnol Bioeng. 2010;95:501–12.CrossRefGoogle Scholar
- 10.Sello G, Orsini F, Bernasconi S, Gennaro PD. Synthesis of enantiopure 2-amino-1-phenyl and 2-amino-2-phenyl ethanols using enantioselective enzymatic epoxidation and regio and diastereoselective chemical aminolysis. Cheminform. 2006;17:372–6.Google Scholar
- 11.Bestetti G, Gennaro PD, Colmegna A, Ronco I, Galli E, Sello G. Characterization of styrene catabolic pathway in Pseudomonas fluorescens ST. Int Biodeterior Biodegrad. 2004;54:183–7.CrossRefGoogle Scholar
- 12.Hollmann F, Lin PC, Witholt B, Schmid A. Stereospecific biocatalytic epoxidation: the first example of direct regeneration of a FAD-dependent monooxygenase for catalysis. J Am Chem Soc. 2003;125:8209–17.PubMedCrossRefGoogle Scholar
- 13.Zhou Y, Wu S, Li Z. Cascade biocatalysis for sustainable asymmetric synthesis: from biobased l-phenylalanine to high-value chiral chemicals. Angew Chem Int Ed Engl. 2016;128:11819–22.CrossRefGoogle Scholar
- 14.Panke S, Wubbolts MG, Schmid A, Witholt B. Production of enantiopure styrene oxide by recombinant Escherichia coli synthesizing a two-component styrene monooxygenase. Biotechnol Bioeng. 2015;69:91–100.CrossRefGoogle Scholar
- 15.Hu D, Tang CD, Yang BA, Liu JC, Yu T, Deng C, Wu MC. Expression of a novel epoxide hydrolase of Aspergillus usamii E001 in Escherichia coli and its performance in resolution of racemic styrene oxide. J Ind Microbiol Biotechnol. 2015;42:671–80.PubMedCrossRefGoogle Scholar
- 16.Panke SD, De Lorenzo V, Kaiser A, Witholt B, Wubbolts MG. Engineering of a stable whole-cell biocatalyst capable of (S)-styrene oxide formation for continuous two-liquid-phase applications. Appl Environ Microbiol. 1999;65:5619–23.PubMedPubMedCentralGoogle Scholar
- 17.Zhang W, Wu J, Li B, Wu H, Wang L, Hao J, Wu S, Zhou Q. Structure–activity & structure–toxicity relationship study of salinomycin diastereoisomers and their benzoylated derivatives. Org Biomol Chem. 2016;14:2840–5.PubMedCrossRefGoogle Scholar
- 18.Yazu K, Yamamoto Y, Furuya T, Miki K, Ukegawa K. Oxidation of dibenzothiophenes in an organic biphasic system and its application to oxidative desulfurization of light oil. Energy Fuels. 2001;15:1535–6.CrossRefGoogle Scholar
- 19.Zocher F, Bornscheuer UT, Hauer B, Schmid RD, Enzelberger MM. A colorimetric assay suitable for screening epoxide hydrolase activity. Analytica Chimica Acta. 1999;391:345–51.CrossRefGoogle Scholar
- 20.Zhang ZG, Liu Y, Guengerich FP, Matse JH, Chen J, Wu ZL. Identification of amino acid residues involved in 4-chloroindole 3-hydroxylation by cytochrome P450 2A6 using screening of random libraries. J Biotechnol. 2009;139:12–8.PubMedCrossRefGoogle Scholar
- 21.Viviana SF, Denis W, Jean-Louis R. Enzyme assay and activity fingerprinting of hydrolases with the red-chromogenic adrenaline test. Nat Protoc. 2008;3:1270–7.CrossRefGoogle Scholar
- 22.Cheung S, Mccarl V, Holmes AJ, Coleman NV, Rutledge PJ. Substrate range and enantioselectivity of epoxidation reactions mediated by the ethene-oxidising Mycobacterium strain NBB4. Appl Microbiol Biotechnol. 2013;97:1131–40.PubMedCrossRefGoogle Scholar
- 23.Ukaegbu UE, Kantz A, Beaton M, Gassner GT, Rosenzweig AC. Structure and ligand binding properties of the epoxidase component of styrene monooxygenase. Biochemistry. 2010;49:1678–88.PubMedPubMedCentralCrossRefGoogle Scholar
- 24.Park MS, Bae JW, Han JH, Lee EY, Lee SG, Park S. Characterization of styrene catabolic genes of Pseudomonas putida SN1 and construction of a recombinant Escherichia coli containing styrene monooxygenase gene for the production of (S)-styrene oxide. J Microbiol Biotechnol. 2006;16:1032–40.CrossRefGoogle Scholar
- 25.Ratnayake ND, Liu N, Kuhn LA, Walker KD. Ring-substituted α-arylalanines for probing substituent effects on the isomerization reaction catalyzed by an aminomutase. ACS Catal. 2015;4:3077–90.CrossRefGoogle Scholar
- 26.Lin H, Tang DF, Ahmed AAQ, Liu Y, Wu ZL. Mutations at the putative active cavity of styrene monooxygenase: enhanced activity and reversed enantioselectivity. J Biotechnol. 2012;161:235–41.PubMedCrossRefGoogle Scholar
- 27.Ramon-Maiques S, Fernandez-Murga ML, Gil-Ortiz F, Vagin A, Fita I, Rubio V. Structural bases of feed-back control of arginine biosynthesis, revealed by the structures of two hexameric N-acetylglutamate kinases, from Thermotoga maritima and Pseudomonas aeruginosa. J Mol Biol. 2006;356:695–713.PubMedCrossRefGoogle Scholar
- 28.Ballou DP, Entsch B, Cole LJ. Dynamics involved in catalysis by single-component and two-component flavin-dependent aromatic hydroxylases. Biochem Biophys Res Commun. 2005;338:590–8.PubMedCrossRefGoogle Scholar
- 29.Van Berkel WJH, Kamerbeek NM, Fraaije MW. Flavoprotein monooxygenases, a diverse class of oxidative biocatalysts. J Biotechnol. 2006;124:670–89.PubMedCrossRefGoogle Scholar
- 30.Chaloupkova R, Sykorova J, Prokop Z, Jesenska A, Monincova M, Pavlova M, Tsuda M, Nagata Y, Damborsky J. Modification of activity and specificity of haloalkane dehalogenase from Sphingomonas paucimobilis UT26 by engineering of its entrance tunnel. J Biol Chem. 2003;278:52622–8.PubMedCrossRefGoogle Scholar
- 31.Hiromoto T, Fujiwara S, Hosokawa K, Yamaguchi H. Crystal structure of 3-hydroxybenzoate hydroxylase from Comamonas testosteroni has a large tunnel for substrate and oxygen access to the active site. J Mol Biol. 2006;364:878–96.PubMedCrossRefGoogle Scholar
- 32.Smeulders MJ, Barends TRM, Pol A, Scherer A, Zandvoort MH, Udvarhelyi A, Khadem AF, Menzel A, Hermans J, Shoeman RL, et al. Evolution of a new enzyme for carbon disulphide conversion by an acidothermophilic archaeon. Nature. 2011;478:412.PubMedCrossRefGoogle Scholar
- 33.Zhou J, Wang Y, Chen J, Xu M, Yang T, Zheng J, Zhang X, Rao Z. Rational engineering of Bacillus cereus leucine dehydrogenase towards α-keto acid reduction for improving unnatural amino acid production. Biotechnol J. 2018. https://doi.org/10.1002/biot.201800253 PubMedCrossRefGoogle Scholar
- 34.Zheng J, Yang T, Zhou J, Xu M, Zhang X, Rao Z. Elimination of a free cysteine by creation of a disulfide bond increases the activity and stability of Candida boidinii formate dehydrogenase. Appl Environ Microbiol. 2017;83:e02624.PubMedGoogle Scholar
- 35.Kantz A, Chin F, Nallamothu N, Nguyen T, Gassner GT. Mechanism of flavin transfer and oxygen activation by the two-component flavoenzyme styrene monooxygenase. Arch Biochem Biophys. 2005;442:102.PubMedCrossRefGoogle Scholar
- 36.Lotter J, Botes AL, van Dyk MS, Breytenbach JC. Correlation between the physicochemical properties of organic solvents and their biocompatibility toward epoxide hydrolase activity in whole-cells of a yeast Rhodotorula sp. Biotechnol Lett. 2004;26:1191–5.PubMedCrossRefGoogle Scholar
- 37.Nelson KE, Weinel C, Paulsen IT, et al. Complete genome sequence and comparative analysis of the metabolically versatile Pseudomonas putida KT2440. Environ Microbiol. 2002;4:799–808.PubMedCrossRefGoogle Scholar
- 38.Abdel-Mawgoud AM, Lepine F, Deziel E. A stereospecific pathway diverts beta-oxidation intermediates to the biosynthesis of rhamnolipid biosurfactants. Chem Biol. 2014;21:156–64.PubMedCrossRefGoogle Scholar
- 39.Banat IM, Franzetti A, Gandolfi I, Bestetti G, Martinotti MG, Fracchia L, Smyth TJ, Marchant R. Microbial biosurfactants production, applications and future potential. Appl Microbiol Biotechnol. 2010;87:427–44.PubMedCrossRefGoogle Scholar
- 40.Sarney DB, Vulfson EN. Application of enzymes to the synthesis of surfactants. Trends Biotechnol. 1995;13:164.PubMedCrossRefGoogle Scholar
- 41.Al-Tahhan RA, Sandrin TR, Bodour AA, Maier RM. Rhamnolipid-induced removal of lipopolysaccharide from Pseudomonas aeruginosa: effect on cell surface properties and interaction with hydrophobic substrates. Appl Environ Microbiol. 2000;66:3262.PubMedPubMedCentralCrossRefGoogle Scholar
- 42.Puchalka J, Oberhardt MA, Godinho M, Bielecka A, Regenhardt D, Timmis KN, Papin JA, dos Santos VAM. Genome-scale reconstruction and analysis of the Pseudomonas putida KT2440 metabolic network facilitates applications in biotechnology. PLoS Comput Biol. 2008;4:e1000210.PubMedPubMedCentralCrossRefGoogle Scholar
- 43.Iwasaki K, Uchiyama H, Yagi O, Kurabayashi T, Ishizuka K, Takamura Y. Transformation of Pseudomonas putida by electroporation. Biosci Biotechnol Biochem. 1994;58:851–4.PubMedCrossRefGoogle Scholar
- 44.Li Y, Yang H, Xu F. Identifying and engineering a critical amino acid residue to enhance the catalytic efficiency of Pseudomonas sp. methyl parathion hydrolase. Appl Microbiol Biotechnol. 2018;102:6537–45.PubMedCrossRefGoogle Scholar
- 45.Agarwal SC, Duuren BL, Van Kneip TJ. Detection of epoxides with 4-(p-nitrobenzyl) pyridine. Bull Environ Contam Toxicol. 1979;23:825.PubMedCrossRefGoogle Scholar
- 46.Coleman NV, Yau S, Wilson NL, Nolan LM, Migocki MD, Ly MA, Crossett B, Holmes AJ. Untangling the multiple monooxygenases of Mycobacterium chubuense strain NBB4, a versatile hydrocarbon degrader. Environ Microbiol Rep. 2011;3:297–307.PubMedCrossRefGoogle Scholar
- 47.Sanchis J, Fernandez L, Carballeira JD, Drone J, Gumulya Y, Hobenreich H, Kahakeaw D, Kille S, Lohmer R, Peyralans JJ, et al. Improved PCR method for the creation of saturation mutagenesis libraries in directed evolution: application to difficult-to-amplify templates. Appl Microbiol Biotechnol. 2008;81:387–97.PubMedCrossRefGoogle Scholar
- 48.Biasini M, Bienert S, Waterhouse A, Arnold K, Studer G, Schmidt T, Kiefer F, Cassarino TG, Bertoni M, Bordoli L, Schwede T. SWISS-MODEL: modelling protein tertiary and quaternary structure using evolutionary information. Nucleic Acids Res. 2014;42:W252–8.PubMedPubMedCentralCrossRefGoogle Scholar
- 49.Simard JR, Getlik M, Grutter C, Pawar V, Wulfert S, Rabiller M, Rauh D. Development of a fluorescent-tagged kinase assay system for the detection and characterization of allosteric kinase inhibitors. J Am Chem Soc. 2009;131:13286–96.PubMedCrossRefGoogle Scholar
- 50.Morris GM, Goodsell DS, Halliday RS, Huey R, Hart WE, Belew RK, Olson AJ. Automated docking using a Lamarckian genetic algorithm and an empirical binding free energy function. J Comput Chem. 1998;19:1639–62.CrossRefGoogle Scholar
- 51.Lin H, Qiao J, Liu Y, Wu ZL. Styrene monooxygenase from Pseudomonas sp. LQ26 catalyzes the asymmetric epoxidation of both conjugated and unconjugated alkenes. J Mol Catal B Enzym. 2010;67:236–41.CrossRefGoogle Scholar
- 52.Zhou-Pan XR, Sérée E, Zhou XJ, Placidi M, Maurel P, Barra Y, Rahmani R. Involvement of human liver cytochrome P450 3A in vinblastine metabolism: drug interactions. Cancer Res. 1993;53:5121.PubMedGoogle Scholar
- 53.Bae JW, Raj SSM, Song EL, Lee SG, Jeong YJ, Park S. Construction and characterization of a recombinant whole-cell biocatalyst of Escherichia coli expressing styrene monooxygenase under the control of arabinose promoter. Biotechnol Bioprocess Eng. 2008;13:69–76.CrossRefGoogle Scholar
- 54.Cho JH, Kim EK, So JS. Improved transfomation of Pseudomonas putida KT2440 by electroporation. Biotechniques. 1995;9(1):41–4.Google Scholar
- 55.Hu D, Wang R, Shi XL, Ye HH, Wu Q, Wu MC, Chu JJ. Kinetic resolution of racemic styrene oxide at a high concentration by recombinant Aspergillus usamii epoxide hydrolase in an n-hexanol/buffer biphasic system. J Biotechnol. 2016;236:152–8.PubMedCrossRefGoogle Scholar
Copyright information
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.