Advertisement

The activity of commercial antimicrobials, and essential oils and ethanolic extracts of Olea europaea on Streptococcus agalactiae isolated from pregnant women

  • Munyaradzi MukesiEmail author
  • Benson C. Iweriebor
  • Larry C. Obi
  • Uchechukwu U. Nwodo
  • Sylvester R. Moyo
  • Anthony I. Okoh
Open Access
Research article
Part of the following topical collections:
  1. Basic Research

Abstract

Background

Streptococcus agalactiae also known as Group B Streptococcus (GBS) is a major cause of disease in pregnant women and new born babies where it causes early and late onset disease characterised by sepsis, pneumonia and meningitis. Ten to 37 % of pregnant women in the world are colonised with GBS while intrapartum antibiotic prophylaxis has led to significant reduction in early onset disease. The increase in drug resistant microorganisms has become a major threat. Development of vaccines is still in progress so there is need for new and safer alternatives to treatment.

Methods

Benzyl penicillin, Ampicillin, Cefotaxime, Ceftriaxone, Levofloxacin, Erythromycin, Clindamycin, Linezolid, Vancomycin, Tetracycline and Cotrimoxazole, Olea europaea leaf extracts and essential oil were tested against GBS isolates from South Africa and Namibia.

Results

The isolates showed 100% sensitivity to benzyl penicillin, ampicillin, ceftriaxone, levofloxacin, linezolid, vancomycin, O. europaea leaf extracts and essential oils. Only one isolate (0.6%) was resistant to cefotaxime and 23.4 and 10.4% were resistant to clindamycin and erythromycin respectively.

Conclusion

GBS isolates showed sensitivity to O. europaea extracts at low minimum inhibitory concentrations. Β lactams are still the drugs of choice for treatment of GBS disease but O. europaea extracts potent as an alternative source of antimicrobials.

Keywords

Olea europaea Streptococcus agalactiae Antimicrobial β Lactams 

Abbreviations

AEMREG

Applied and Environmental Microbiology Research Group

AIDS

Acquired immunodeficiency syndrome

ATCC

American Type Culture Collection

CDC

Centers for Disease Control and Prevention

CLSI

Clinical Laboratory Standards Institute

DMSO

Dimethyl Sulfoxide

GBS

Group B Streptococcus

GC-MS

Gas Chromatography-Mass Spectrometry

GMRDC

Govan Mbeki Research & Development Centre

HIV

Human immunodeficiency virus

IAP

Intrapartum Antibiotic prophylaxis

MH

Meuller hinton

MIC

Minimum inhibitory concentration

NCRST

National Commission of Research Science and Technology

NRF

National Research Fund

TBE

Tris/Borate/EDTA

UFH

University of Fort Hare

USA

United States of America

WHO

World Health Organization

Background

Antibiotic resistance has existed since the beginning of the antibiotic era. The increase in the frequency of drug resistant and invasive bacteria, a reduction in the development and approval of new drugs and projections of an imminent post antibiotic era threaten human health worldwide. Current practices of Intrapartum Antibiotic prophylaxis (IAP) against S. agalactiae involve the administration of β-lactam antibiotics penicillin and ampicillin. The alternatives to penicillin include: cefazolin, clindamycin, erythromycin and vancomycin however, these alternative drugs have not been assessed in clinical trials and data on their concentration levels in amniotic fluid, foetal blood and tissue are limited [1, 2].

There is an increasing prevalence of multidrug resistant microorganisms and these bacterial pathogens are a major threat to existing antibacterial therapeutic options [3]. GBS is generally sensitive to β-lactams antibiotics but isolates with reduced minimum inhibitory concentrations (MICs) have been described from as far back as 1995 [1] while MIC changes of cefazolin to GBS have been described from 1999 [2]. In a recent study in Italy, outright resistance to GBS was noted for the first time where out of 65 GBS isolates recovered in the study, 12.07% were resistant to benzyl penicillin [4].

Antibiotic resistance can arise due to the expression of genes that confer resistance to drugs in an organism. The most clinically significant genes are those that code for enzymes responsible for hydrolysis of β-lactams (bla genes). These genes confer high level bacterial resistance to β-lactam antibiotics like cephalosporins (including 4th generation cephalosporins), penicillins and monobactams (except cefamycins) [5]. The bla genes can be borne on plasmids or transposons which are transferable and this facilitates horizontal spread of antibiotic resistance [6].

While erythromycin and clindamycin were indicated as alternative therapy to GBS IAP, there has been increasing resistance of GBS to these drugs and in the United States of America (USA), clindamycin and erythromycin resistance have been recorded at 13–20% and 25–35% respectively [2]. Across the world, resistance has been estimated at 14.5–70% and 8.2–70% for erythromycin and clindamycin respectively [1]. The CDC guidelines removed erythromycin as a second line prophylactic antibiotic in women with penicillin allergy due to the high resistance of GBS to it while clindamycin is still acceptable but only after susceptibility testing [7].

The increasing resistance of GBS to empiric antibiotics has led to the administration of expensive drugs and those previously considered as very toxic [3]. While the development of vaccines is still in progress, there is need for new and safe alternatives to GBS treatment [1]. The World Health Organization (WHO) suggests the use of safe and effective medicinal plants; and in both developing and developed countries, herbal medicine has become an integral part of primary health care due to its low cost and availability [8]. The antimicrobial activities of several natural plant products against GBS that have been documented indicate them as potential alternatives to IAP. Essential oils from various plants have been shown to have antibacterial, antiviral, anti-leishmanial, antioxidant, analgesic and anti-inflammatory properties [1, 3]. One such plant which is widely used for its medicinal properties is Olea europaea species of the genus Olea and subspecies Africana which is known as umNquma in the Eastern Cape, South Africa.

O. europaea is known to contain a wide range of phytochemical components with medicinal properties from as far back as 1854 and a number of phytochemical components have been isolated from different parts of O. europaea. The bark, fruits, seeds, leaves, olive oil and wood contain phenolic compounds, flavonoids and secoridoids. Due to the presence of many compounds in different parts of the plant, it has an array of uses including control of plasma concentrations of glucose, cholesterol and urate [9].

Leaf extracts and essential oils from O. europaea have been reported to have antimicrobial activities against many microorganisms including bacteria, viruses, fungi and parasites. While research has shown that the plant does not have broad spectrum antimicrobial activity it has been shown to be potent against some Gram positive and Gram negative bacteria such as Staphylococcus aureus and Escherichia coli respectively [10]. Antimicrobial activity has also been shown against fungi such as Candida albicans and Cryptococcus neoformans while other researches have reported the antimicrobial activity of the plant against Helicobacter pylori, Campylobacter jejuni, Bacillus subtilis and Pseudomonas aeruginosa [9].

This study therefore documents the antibiotic susceptibility profiles of S. agalactiae isolates. It also seeks to determine the antimicrobial susceptibility of these isolates to leaf extracts and essential oils from O. europaea collected from the Cala community in the Eastern Cape, South Africa.

Methods

GBS culture, isolation and identification

A rectal and a vaginal swab were collected from each participant who were between 35 and 37 weeks gestation by a registered nurse. In South Africa (Eastern Cape), 100 participants were included in the study while in Namibia (Windhoek), 588 participants took part in the study. All swabs collected in South Africa were processed at the AEMREG laboratory, University of Fort Hare, Alice while samples in Namibia were processed at the Namibia University of Science and Technology, Microbiology Laboratory.

Samples were inoculated onto Columbia blood agar and Todd Hewitt broth (Rochelle Chemicals and Laboratory Equipment, Johannesburg, South Africa) and incubated at 37 °C for 24 h. Inoculums in Todd Hewitt broth were subcultured onto blood agar and incubated at 37 °C for 24 h and the cultures were checked for colonies exhibiting β-haemolysis on the blood agar. The colonies were tested for the catalase reaction and catalase negative colonies were further screened using the Lancefield grouping antisera (Becton Dickinson, New Jersey, USA). Colonies which tested positive for the latex agglutination assay were presumptively identified as GBS isolates and were confirmed using the Vitek 2 and by molecular techniques. All presumptive isolates were stored in glycerol stocks at − 80 °C until further analyses.

Molecular confirmation of isolates

Glycerol stocks were inoculated in Muller Hinton broth for 24 h at 37 °C and streaked on Columbia blood agar. GBS isolates were confirmed by molecular techniques using a pair of primers specific for the scpB gene. A single colony of GBS was picked from Columbia blood agar containing 5% horse blood and suspended into 160 μL of nucleic acid free water in a 2 mL conical tube that was placed on a heating block and allowed to boil at 100 °C for 15 min. The mixture was centrifuged and the supernatant containing GBS DNA was transferd in a clean 1.5 mL microcentrifuge tube and stored at − 80 °C. The amplification reactions were performed using the One Taq® Master Mix (New England Biolabs, United Kingdom) according to the manufacturer’s recommendations. Thus, the reactions were performed in a final volume of 25 μL containing 12 μL of Master mix, 6 μL of purified DNA, 10 pmol of scpBF (5’ACAACGGAAGGCGCTACTGTTC3’) and scpBR (5’ACCTGGTGTTTGACCTGAACTA3’) primers as adapted from Elbaradie et al., 2009 [11] and deionized water to adjust the final volume.

The cycling conditions were as follows: an initial denaturation at 94 °C for 4 min followed by 35 cycles of: denaturation at 93 °C for 1 min, annealing at 57 °C for 1 min and extension at 72 °C for 1 min. A final elongation step of 72 °C for 7 min was followed by a hold at 4 °C. S. agalactiae ATCC reference strain BAA-2670 was used as positive control. Amplicons were loaded on 1% agarose gel stained with 10 μL ethidium bromide and electrophoresed for 45 mins at 110 V in 0.5X Tris/Borate/EDTA (TBE) buffer and viewed under transilluminator and photographed.

Sensitivity testing using Vitek

Antimicrobial sensitivity testing was performed using Vitek Sensitivity Card (AST-ST01) on the following antibiotics: Benzyl penicillin, Ampicillin, Cefotaxime, Ceftriaxone, Levofloxacin, Erythromycin, Clindamycin, Linezolid, Vancomycin, Tetracycline, Cotrimoxazole and Inducible Clindamycin Resistance (ICR). MICs were determined for each antibiotic on all the isolates and the results were interpreted according to the Clinical Laboratory Standards Institute (CLSI, 2015) guidelines. The results were classified as sensitive (S), intermediate (I) or resistant (R). All isolates were evaluated for inducible clindamycin resistance.

Plant material

O. europaea plant parts were collected in the Cala community, geographical coordinates 31.52.30°S, 27.69.80°E, Eastern Cape Province, South Africa during the winter of 2016. The plant was identified by Cala Traditional Health Practitioners using the vernacular name umNquma and was authenticated by Mr. Tony Dold, a Plant Taxonomist at Selmar Schonland Herbarium, Rhodes University, South Africa. The Voucher (No ADE 2016/2) was deposited in the Giffen Herbarium, University of Fort Hare.

Preparation of plant extracts

Leaves were harvested from the plants and washed in water to remove dust. The leaves were rinsed in distilled water to cleanse them of impurities and were dried in air for 3 days. The leaves were pulverized as previously described by Darsanaki et al., 2012. Fifty grams of leaf powder was mixed with one litre of ethanol and placed on a shaker to solve and thereafter, the solution was filtered and the solvent dried to obtain a crude ethanol extract of the O. europaea. For the extraction of essential oils, 200 g of dried pulverized leaves was mixed with 200 mL of water and the mixture placed in a modified hydro distiller or a Clevenger’s type apparatus and allowed to hydro distillate for 3 h for complete extraction of the essential oils from the leaves. The procedure was repeated thrice to obtain adequate essential oil for experimental assays and the extracted essential oil was dried using anhydrous sodium sulphate and extracts stored at − 20 °C in actinic bottles from which working solutions were prepared with Dimethyl Sulfoxide (DMSO) for use in experiments.

Gas chromatography-mass spectrometry (GC-MS) analysis

The GCMS analysis of essential oil was performed on the Agilent 5977A MSD and 7890B GC system, Chemetrix; Agilent Technologies, DE (Germany) with a Zibron-5MS column. GC grade helium at 2 mL/min flow rate and spitless 1 mL injection was used and temperatures were set at 280 °C (Injector), 280 °C (Source) and 70 °C (oven) while the ramp settings were set as follows and held for 3 min; 15 °C/min to 120 °C, followed by 10 °C/min to 180 °C and finally 20 °C/min to 270 °C.

Preparation of plant extracts for antimicrobial activity

Plant extract and essential oils were diluted with 10% DMSO using serial dilution methods to make 300 mg/mL of essential oil and 0.5 mg/mL of leaf extract. These solutions were used as stock solutions for all antimicrobial testing.

Agar well diffusion

One hundred microliters of 0.5 McFarland standard of each isolate was prepared using sterile normal saline (0.9% w/v). Twenty microliters of each 0.5 McFarland preparation was inoculated onto Mueller Hinton agar and spread for a lawn growth of the bacteria on the agar. Standard bores of eight millimetres in diameter were made in the agar plates using a sterile cork-borer. Ten percent DMSO was used as a negative control while 5 μg of ciprofloxacin served as a positive control. One hundred microliters each of the ethanolic leaf extracts (0.5 mg/ml), essential oils (300 mg/ml), positive control and negative control were put in labelled wells and allowed to stand for 1 h and culture plates incubated at 37 °C for 24 h. The test extracts were compared to the negative and positive control to determine the antimicrobial activity of the extracts on the isolates. Ten isolates each from both South Africa and Namibia were selected by systematic sampling and used in the experiment.

Minimum inhibitory concentration (MIC) determination

Four hundred microliters of broth was put in each of four sterile tubes and serial dilutions were made using 100 μL of extract creating four dilutions of each extract. The final extract concentration in each tube for the extracts is presented in Table 1.
Table 1

Concentrations of plant extracts after dilution

Tube number

1

2

3

4

Concentration of essential oil (mg/ml)

33.3

3.7

0.4

0.05

Concentration of leaf extract (mg/ml)

0.1

0.02

0.004

0.0008

Broth was used as a negative control while 5 μg of ciprofloxacin was used as a positive control. One hundred microliters of broth was placed in six labelled tubes for each experiment. One hundred microliters each of broth (negative control), 5 μg ciprofloxacin (positive control) and each of the dilutions for both essential oil and plant extract were put in a respective labelled tube and 20 μL of 0.5 McFarland of the test isolate was inoculated in each tube and incubated at 37 °C for 24 h. Thereafter, the test tubes were checked for turbidity and compared to the negative and positive control to establish the antimicrobial activity of the different concentrations of the extracts. Tubes without apparent growth were regarded as concentrations where the extract had growth inhibitory activities.

For the concentrations of the extract which showed antimicrobial effect against the bacteria it was determined if the extract had bactericidal or bacteriostatic effect. This was performed by inoculating 20 μL from each of the tubes above onto Mueller Hinton agar and the culture plates were incubated at 37 °C for 24 h. Absence of growth in the broth and agar plate was assumed as the extract having bactericidal effect while absence of growth in broth and bacterial growth on solid agar plates, indicates bacteriostatic effect of the extract.

Results

Results of antimicrobial sensitivity testing of antibiotics against GBS and susceptibility to plant extracts are presented below. Twenty GBS isolates (10 from South Africa and 10 from Namibia) were employed in antibacterial activities of testing of plant extracts using the Minimum Inhibitory Concentration (MIC) approach. The antibiotic sensitivity patterns of the GBS isolates are presented in Table 2.
Table 2

Antibiotic sensitivity patterns of GBS isolates

Antibiotic

MIC (μg/mL)

Frequency (%)

Susceptible

Intermediate

Resistant

Benzyl penicillin (P)

≤ 0.12

154 (100.0)

0 (0.0)

0 (0.0)

Ampicillin (Amp)

≤ 0.25

154 (100.0)

0 (0.0)

0 (0.0)

Cefotaxime (CTX)

≤ 0.5

153 (99.4)

0 (0.0)

1 (0.6)

Ceftriaxone (CRO)

≤ 0.5

154 (100.0)

0 (0.0)

0 (0.0)

Levofloxacin (Lev)

≤ 2

154 (100.0)

0 (0.0)

0 (0.0)

Erythromycin (E)

≤ 0.25

138 (89.6)

0 (0.0)

16 (10.4)

Clindamycin (CD)

≤ 0.25

118 (76.6)

0 (0.0)

36 (23.4)

Linezolid (Li)

≤ 2

154 (100.0)

0 (0.0)

0 (0.0)

Vancomycin (Va)

≤ 1

154 (100.0)

0 (0.0)

0 (0.0)

Tetracycline (T)

≤ 2

6 (3.9)

0 (0.0)

148 (96.1)

Cotrimoxazole (SXT)

≤ 2

137 (89.0)

0 (0.0)

17 (11.0)

Inducible clindamycin

   

7 (4.5)

S. agalactiae isolates were sensitive to B lactam antibiotics but some showed resistance to other antibiotics such as tetracycline, cotrimoxazole, erythromycin and clindamycin.

Table 3 shows the chemical composition of the essential oils of Olea europaea obtained after GC-MS analysis.
Table 3

Chemical composition of essential oils of Olea europaea

S/N

Chemical constituents

Chemical formula

RT

Area %

1

2-Butenal, 2-ethenyl-

C6H8O

3.255

1.56

2

2-Hexenal, (E)-

C6H10O

3.292

2.95

3

1-Hexanol

C6H14O

3.365

0.75

4

Heptanal

C7H14O

3.638

1.00

5

(1S)-2,6,6-trimethylbicyclo[3.1.1] hept-2-ene

C10H16

3.975

1.89

6

Pyridine, 3-ethenyl-

C7H7N

4.204

2.21

7

2,4-Heptadienal, (E,E)-

C2H5CH

4.412

1.58

8

Octanal

C8H16O

4.450

0.77

9

alpha-Phellandrene

C10H16

4.530

1.72

10

4-Carene

C10H10

4.729

0.79

11

2-Octenal, (E)-

C8H14O

4.908

0.50

12

1-Octanol

C8H18O

4.972

1.87

13

Pyridine, 5-ethenyl-2-methyl-

C8H9N

5.198

0.88

14

Nonanal

C9H18O

5.271

10.57

15

1,6-heptadiene,2,5,5-trimethyl

C10H18

5.674

0.73

16

Acetaldehyde, (3,3dimethylcyclohexylidene),(E)

C10H18O

5.720

1.07

17

1-Methylpentyl cyclopropane

C9H18

5.772

0.80

18

Decanal

C10H20O

6.059

2.23

19

3-Isopropylidene-5-methyl-hex-4-en-2-one

C10H16O

6.278

0.99

20

Octane, 1-iodo-

C8H17I

6.347

0.57

21

2,6-Octadien-1-ol, 3,7-dimethyl-(Z)-

C10H18O

6.418

0.39

22

2-Decenal, (E)-

C10H18O

6.485

2.78

23

2,4-Decadienal

C10H16O

6.724

0.76

24

4-tert-Butylcatechol, dimethyl ether

C12H18O2

6.809

4.63

25

9-Oxabicyclo [4.2.1] non-7-en-3-one

C8H12O

6.892

1.80

26

1-Oxaspiro [4.5] dec-6-ene, 2,6,10,10-tetramethyl-

C13H22O

6.995

1.10

27

2-Undecenal

C11H20O

7.206

0.78

28

cis-beta-Farnesene

C15H24

7.422

0.60

29

1-(3,6,6-trimethyl-1,6,7,7a-tetrahydrocyclopenta [c] pyran-1-yl) ethanone

C13H18

7.510

0.72

30

2-Buten-1-one,1-(2,6,6-trimethyl-1-cyclohexen-1-yl)-

C13H20O

7.631

0.50

31

Caryophyllene

C15H24

7.751

2.04

32

5,9-Undecadien-2-one, 6,10-dimethyl-

C13H22O

7.798

2.91

33

1H-Inden-1-one, 2,4,5,6,7,7a-hexahydro-4,4,7a-trimethyl-

C12H18O

7.931

0.46

34

1,4,7,-Cycloundecatriene, 1,5,9,9-tetramethyl-, Z,Z,Z-

C15H24

7.974

0.44

35

trans-beta-Ionone

C13H20O

8.093

2.39

36

21.xi-methyl-17-isocholest-16-en-3beta-ol

C27H46O

8.150

0.47

37

Naphthalene, 1,2,3,4,4a,5,6,8a-octahydro-4a,8-dimethyl-2- (1-methylethenyl)-,[2R-(2 alpha, 4a alpha, 8a beta)]

C15H24

8.232

0.69

38

Naphthalene, 1,2,4a,5,6,8a-hexahydro-4,7-dimethyl-1-(1-methylethyl)-

C15H34

8.323

2.91

39

1,6,10-Dodecatrien-3-ol,3711,trimethyl-, [S-(Z)]-

C15H26O

8.508

1.82

40

Benzoic acid, nonadecyl ester

C26H44O2

8.631

0.79

41

1H_Cycloprop[e] azulen-7-ol, decahydro-1,1,7-trimethyl-4-methylene-,[1ar-(1aalpha, 4a alpha, 7 beta, 7a beta, 7b alpha)]-

C15H24O

8.750

0.80

42

Caryophyllene

C15H24O

8.809

1.49

43

4,2,8-Ethanylylidene-2H-1-benzopyran, octahydro-4-methyl-

C14H22O

8.923

0.55

44

1,4-Methano-1H-indene, octahydro-1,7a-dimethyl-4-(1-methylethenyl)-[1S-(1 alpha, 3a beta, 4 alpha, 7a beta)]-

C15H24

8.961

0.52

45

Bicyclo[4.4.0]dec-1-ene, 2-isopropyl-5-methyl-9-methylene

C15H24

9.089

5.65

46

Heptadecane

C17H36

9.250

0.39

47

7-epi-cis-sesquisabinene hydrate

C15H26O

9.281

0.94

48

2,6,10-Dodecatrien-1-ol, 3,7,11,trimethyl

C15H26O

9.424

0.46

49

2-Pentadecanone, 6,10,14-trimethyl

C18H36O

10.058

1.66

50

1,2-Benzenedicarboxylic acid, bis(2-methylpropyl) ester

C16H22O4

10.235

0.72

51

Eicosane

C20H42

10.312

0.47

52

2,6,10,14,18-Pentamethyl-2,6,10,14,18-eicosapentaene

C25H42

10.467

0.97

53

Dibutyl phthalate

C16H22O4

10.713

0.43

54

Eicosane

C20H42

10.810

0.42

55

Isopropyl palmitate

C19H38O2

10.930

0.29

56

Heptasiloxane, 1,1,3,3,5,5,7,7,9,9,11,11,13,13-tetradecamethyl-

C14H44

11.235

0.09

57

Octadecane

C18H38

11.286

1.03

58

2-Myristynoyl-glycinamide

C16H31BrN2O2

11.336

0.77

59

Phytol

C20H40O

11.388

6.40

60

1H-Indole-2-carboxylic acid, 6-(4-ethoxyphenyl)-3-methyl-4-oxo-4,5,6,7-tetrahydro-, isopropyl ester

C21H25

11.741

0.55

61

Nonadecane

C19H40

12.174

1.09

62

Cyclotrisiloxane, hexamethyl

C6H18O3Si3

12.593

0.34

63

Heptasiloxane, 1,1,3,3,5,5,7,7,9,9,11,11,13,13-tetradecamethyl

C14H44O6Si7

12.994

0.98

64

Octasiloxane, 1,1,3,3,5,5,7,7,9,9,11,11,13,13,15,15-hexadecamethyl

C16H48O7Si8

13.779

1.81

65

Tetrasiloxane, decamethyl-

C10H30O3Si4

14.201

0.37

66

Silicic acid, diethyl bis (trimethylsilyl) ester

C10H28O4Si3

14.201

0.20

67

Heneicosane

C21H44

14.659

3.37

68

Tris (tert-butyldimethylsilyloxy) arsane

C18H45AsO3Si3

15.741

1.94

The GC-MS analysis of the plant extract showed that the plant contained flavonoids, flavonones, biophenols, benzoic acid derivatives, sterols and secoiridoids.

Essential oils and leaf extracts exhibited antimicrobial activity against GBS isolates and leaf extracts showed bigger zones of inhibition compared to essential oils.

Discussion

In this study 117 isolates from Namibia and 37 isolates from South Africa were analyzed and they were confirmed as GBS based on the scpB gene. All the isolates showed absolute sensitivity to benzyl penicillin, ampicillin, ceftriaxone, levofloxacin, linezolid and vancomycin with only one isolate (0.6%) showing resistance to cefotaxime as shown in Table 2. In reports from other studies done in other African countries, such as in Malawi [12], Ethiopia [13], Zimbabwe [14], South Africa [15] and Nigeria [16], GBS has not shown resistance to the β lactams. In a study in Brazil, GBS also exhibited no resistance to β lactams [17]. However, resistance to β lactam group of antibiotics has been evolving as noted in reduced MICs for more than a decade and recently an Italian study recorded outright resistance by some GBS isolates to penicillin [4].

Thirty six isolates (23.4%) and sixteen isolates (10.4%) were resistant to clindamycin and erythromycin respectively and the results of this study are comparable to a report from a recent study in Pretoria, South Africa where GBS isolates had 17.2 and 21.16% resistance to clindamycin and erythromycin respectively [15]. The results also fall within world statistics of clindamycin resistance (8.2–70%) and erythromycin resistance (14.5–70%) [1]. However, studies in Brazil have recorded low GBS resistance to clindamycin (3.0%) and erythromycin (4.1%) [17].

There was high resistance of GBS to tetracycline (96.1%) and this appears consistent with other studies which have reported high GBS resistance to tetracycline (86.7%) in South Africa [15] and in Brazil [17] and this could be due to the indiscriminate use of tetracycline and its availability as a non-prescription drug. Tetracycline is commonly used at farms as a growth promoter and for treatment purposes. Resistance to the drug could spread through the environment due to agricultural runoff and contaminated effluent while antibiotic residue in farm produce like meat is another serious concern which perpetuates drug resistance as low levels of drugs in farm produce exert persistent selection pressure on bacteria thus giving rise to the emergence of resistant strains [18].

Resistance to cotrimoxazole was low in this study (11.0%) contrary to its reported high resistance level among GBS isolates from other studies in other African countries like Ethiopia (29.0%) [19]. In Tanzania, just like many other sub Saharan African countries burdened by human immunodeficiency virus (HIV) infection, cotrimoxazole is used for prophylactic purposes in all acquired immunodeficiency syndrome (AIDS) patients including pregnant women before 36 weeks gestation. Resistance to cotrimoxazole in Tanzania ranges from 56.0% in Escherichia coli to 87.5% in Pseudomonas aeruginosa with no difference in prevalence among patients on cotrimoxazole prophylaxis and those not on it. The high resistance to cotrimoxazole could be attributed to the excessive use of the drug for prophylactic purposes in HIV positive patients. In a South African study, 85.7% of E. coli isolated from HIV infected children was resistant to cotrimoxazole [20] while another South African study showed a significant increase in resistance to cotrimoxazole by organisms from 1999 to 2002 [21]. The World Health Organization noted that although cotrimoxazole is a broad spectrum antibiotic, increased use of the drug for prophylactic purposes would spur development of drug resistance which could ultimately render the drug ineffective when applied to common community pathogens [22, 23].

This current study found that the essential oils were made up of 68 compounds and the main components were nonanal (10.57%), phytol (6.40%), bicyclo[4.4.0]dec-1-ene, 2-isopropyl-5-methyl-9-methylene (5.65%), 4-tert-Butylcatechol, dimethyl ether (4.63%), 2-hexanol (2.95%), 5,9-Undecadien-2-one, 6,10-dimethyl- (2.91%) and naphthalene, 1,2,4a,5,6,8a-hexahydro-4,7-dimethyl-1-(1-methylethyl)- (2.91%) as shown in Table 3. The findings of this study are different from those of a similar study done by Boukhebti et al., (2015) in Algeria in which the essential oils were composed of 38 components. In the study palmitic acid (14.71%), z-nerolidol (9.45%), octacosane (6.32%), ceryophyllene oxide (4.77%), tetracosane (4.06%) and 4-hydroxy-4-methy-2-pentane (4.04%) were the main components of the essential oils [24].

A study by Upadhyay (2014) in India reported O. europaea plants to contain 24 compounds with the main components being 2-propanone (8.80%), 2,4imidazolidinedione (14.92%) and z-(13,14,-Epoxy) tetra dec-11-en-1-ol acetate (7.77%) [25]. Different studies in Tunisia reported differences in phytochemical composition of Olea extracts. Plant extracts have variations in total phenols, colour, composition of polysaturated fatty acids and water content [26, 27, 28]. The variation in chemical composition is attributed to differences in climatic conditions under which the plant grew or cultivation conditions such as irrigation and the ripening stage of the plant [26, 29]. Water content affects activity of enzymes responsible for synthesis of phytochemicals like phenols and increased water supply to plants increases the content of phenolic components, alcohols and esters such as (E)-2-hexanol [26].

Extracts from O. europaea had antimicrobial activity against GBS isolates from both South Africa and Namibia as shown in Table 4 and other studies have shown that O. europaea has antimicrobial activity against other bacteria although the extracts do not have broad spectrum antimicrobial activity [9]. While Olea has been shown to have antimicrobial properties in several countries including Spain, Israel, Palestine, plants in different geographical locations exhibit varying phytochemical constitutions therefore resulting in different properties and thus ethno botanical uses of the same plant [9, 30].
Table 4

Screening for antimicrobial activities of plant extracts against GBS isolates

Extract (Concentration)

Zone of inhibition on MH (Mean diameter)

Essential oil (300 mg/ml)

Present 25 mm

Leaf extract (0.5 mg/ml)

Present 28 mm

5 μg Ciprofloxacin (Positive control)

Present 35 mm

10% DMSO (Negative control)

Not present 0 mm

O. europaea essential oils showed bactericidal activity against GBS at 33.3 mg/mL as shown in Table 5 and studies have shown that essential oils have antimicrobial activity against a wide range of bacteria [9, 10]. Extracts from the leaves exhibited bactericidal activity at very low concentration (0.02 mg/mL) as presented in Table 6 and the antimicrobial activity could be attributed to phytochemical components present in the Olea plant extract such as flavonoids, iridoids, secoiridoids, biophenols and benzoic acid derivatives [1, 3, 9].
Table 5

MIC for essential oils against GBS isolates

Concentration (mg/mL)

 

0.05

0.4

3.7

33.3

MIC

Isolates

A

B

C

A

B

C

A

B

C

A

B

C

Essential oils

GBS in broth

+

+

+

+

+

+

+

33.3

GBS on MH

+

+

+

+

+

+

+

33.3

Key: A = Essential oil, B = 10% DMSO, C = Ciprofloxacin, + = Growth, − = no growth

Essential oils showed antibacterial activity to GBS at an MIC of 33.3 mg/mL and had bactericidal effect on the isolates at that concentration

Table 6

MIC for leaf extracts against GBS isolates

Concentration (mg/mL)

 

0.0008

0.004

0.02

0.1

MIC

Isolates

A

B

C

A

B

C

A

B

C

A

B

C

Leaf extracts

GBS in broth

+

+

+

+

+

+

0.02

GBS on MH

+

+

+

+

+

+

0.02

Key: A = Leaf extracts, B = 10% DMSO, C = Ciprofloxacin, + = Growth, − = no growth

Leaf extracts showed antibacterial activity to GBS at an MIC of 0.02 mg/mL and had bactericidal effect on the isolates at that concentration

Conclusions

GBS isolates from South Africa and Namibia did not exhibit a lot of resistance to antibiotics and they showed sensitivity to Olea europaea essential oils and plant extracts. With the increasing resistance of bacteria to antibiotics in the world, Olea plant extracts and essential oils could potent as alternative therapy to GBS infection.

Notes

Acknowledgements

The authors would like to express their gratitude to the National Research Fund (NRF) of South Africa and the National Commission of Research Science and Technology (NCRST), Namibia.

Funding

The authors are grateful to the NRF, SA and NCRST, Namibia for funding the research.

Availability of data and materials

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

Authors’ contributions

MM conceptualized the research, carried experimental work and wrote the manuscript. BCI conceptualized the research, supervised the research and experimental work and prepared manuscript, LCO conceptualized the research and supervised, UUU conceptualized the research and supervised the research, SRM conceptualized the research and supervised and AIO conceptualized the research and supervised. All the authors read and approved the manuscript.

Ethics approval and consent to participate

Ethical approval was granted by Govan Mbeki Research & Development Centre (GMRDC), University of Fort Hare (UFH) and consent was approved by Cala Traditional Health Practitioners. Ethical clearance for the research was granted by the Ministry of Health and Social Services (Namibia) and the Department of Health, Eastern Cape (South Africa). Informed written consent was obtained from each study participant prior to sample collection which was carried out by qualified midwives.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  1. 1.
    Biasi-Garbin RP, Otaguiri ES, Morey AT, da Silva MF, Morquette AEB, Lancheros CAC, et al. Effect of eugenol against Streptococcus agalactiae and synergistic interaction with biologically produced silver nanoparticles. Evidence Based Complementary and Alternative Medicine. 2015.  https://doi.org/10.1155/2015/861497.
  2. 2.
    CDC. Prevention of Perinatal Group B Streptococcal Disease Revised Guidelines from CDC. 2010; November 19, 2010 / Vol. 59 / No. RR-10. https://www.cdc.gov/groupbstrep/about/symptoms.html. Retrieved 21 September 2017.
  3. 3.
    Marasini BP, Baral P, Aryal P, Ghimire KR, Neupane S, Dahal N, et al. Evaluation of antibacterial activity of some traditionally used medicinal plants against human pathogenic Bacteria. Biomed Res Int. 2015.  https://doi.org/10.1155/2015/265425.
  4. 4.
    Matani C, Trezzi M, Matteini A, Catalani C, Messeri D, Catalani C. Streptococcus agalactiae: prevalence of antimicrobial resistance in vaginal and rectal swabs in Italian pregnant women. Le Infezioni in Medicina. 2016;3:217–21.Google Scholar
  5. 5.
    Adesoji AT, Ogunjobi AA, Olatoye IO. Molecular characterization of selected multidrug resistant Pseudomonas from water distribution systems in southwestern Nigeria. Ann Clin Microbiol Antimicrob. 2015;14:39.  https://doi.org/10.1186/s12941-015-0102-4.CrossRefPubMedPubMedCentralGoogle Scholar
  6. 6.
    Ojdana D, Sacha P, Wieczorek P, Czaban S, Michalska A, Jaworowska J, et al. The occurrence of blaCTX-M, blaSHV, and blaTEM genes in extended-Spectrum β-lactamase-positive strains of Klebsiella pneumoniae, Escherichia coli, and Proteus mirabilis in Poland. International Journal of Antibiotics. 2014.  https://doi.org/10.1155/2014/935842.
  7. 7.
    Back EE, O’Grady EJ, Back JD. High rates of perinatal group B Streptococcus clindamycin and erythromycin resistance in an upstate New York hospital. Antimicrob Agents Chemother. 2011;56(2):739–42.CrossRefGoogle Scholar
  8. 8.
    Maroyi A, Cheikhyoussef A. A comparative study of medicinal plants used in rural areas of Namibia and Zimbabwe. Indian J Tradit Knowl. 2014;14(3):401–6.Google Scholar
  9. 9.
    Hashmi MA, Khan A, Hanif M, Farooq U, Perveen S. Traditional uses, Phytochemistry, and pharmacology of Olea europaea (olive). Evid Based Complement Alternat Med. 2015.  https://doi.org/10.1155/2015/541591.
  10. 10.
    Darsanaki RK, Aliabadi MA, Rokhi ML, Nourbakhsh M, Raeisi G. Antimicrobial activity of olive leaf aqueous extract. Ann Biol Res. 2012;3(8):4189–91.Google Scholar
  11. 11.
    Elbaradie SMY, Mahmoud M, Farid M. Maternal and neonatal screening for group B streptococci by SCP B gene based PCR: a preliminary study. Indian J Med Microbiol. 2009;27(1):17–21.PubMedGoogle Scholar
  12. 12.
    Gray KJ, Bennett SL, French N, Phiri AJ, Graham SM. Invasive group B streptococcal infection in infants, Malawi. Emerg Infect Dis. 2007;13(2):223–9.CrossRefGoogle Scholar
  13. 13.
    Gebremeskel TK, Zeleke TA, Mihret A, Tikue MD. Prevalence and antibiotic susceptibility pattern of Streptococcus agalactiae among pregnant women at Adigrat zonal hospital and Adigrat health center. J Gynecol Obstet. 2015;3(2):29–35.CrossRefGoogle Scholar
  14. 14.
    Moyo SR, Maeland JA, Munemo ES. Susceptibility of Zimbabwean Streptococcus agalactiae (group B Streptococcus; GBS) isolates to four different antibiotics. Cent Afr J Med. 2001;47(9–10):226–9.PubMedGoogle Scholar
  15. 15.
    Bolukaoto JY, Monyama CM, Chukwu MO, Lekala SM, Nchabeleng M, Maloba MRB, et al. Antibiotic resistance of Streptococcus agalactiae isolated from pregnant women in Garankuwa, South Africa. BMC Res Notes. 2015;20158:364.  https://doi.org/10.1186/s13104-015-1328-0.CrossRefGoogle Scholar
  16. 16.
    Ezeonu IM, Agbo MC. Incidence and anti-microbial resistance profile of group B Streptococcus (GBS) infection in pregnant women in Nsukka, Enugu State. Nigeria Academic J. 2014;8(1):91–5.Google Scholar
  17. 17.
    Dutra VG, Alves VMN, Olendzki AN, Dias CAG, de Bastos AFA, et al. Streptococcus agalactiae in Brazil: serotype distribution, virulence determinants and antimicrobial susceptibility. BMC Infect Dis. 2014;14:323.CrossRefGoogle Scholar
  18. 18.
    Al-Bahry SN, Mahmoud IY, Al-Musharafi SK. The Overuse of Tetracycline Compounds in Chickens and Its Impact on Human Health. 2013 4th International Conference on Food Engineering and Biotechnology IPCBEE vol.50, vol. 50. Singapore: IACSIT Press; 2013. p. 5.  https://doi.org/10.7763/IPCBEE.Google Scholar
  19. 19.
    Mengist A, Kannan H, Abdissa A. Prevalence and antimicrobial susceptibility pattern of anorectal and vaginal group B Streptococci isolates among pregnant women in Jimma, Ethiopia. BMC Res Notes. 2016;9:351.CrossRefGoogle Scholar
  20. 20.
    Madhi SA, Petersen K, Madhi A, Khoosal M, Klugman KP. Increased disease burden and antibiotic resistance of Bacteria causing severe community-acquired lower respiratory tract infections in human immunodeficiency virus type 1-infected children. Clin Infect Dis. 2000;31(1):170–6.CrossRefGoogle Scholar
  21. 21.
    Crewe-Brown HH, Reyneke MP, Khoosal M, Becker PJ, Karstaedt AS. Increase in trimethoprim-sulphamethoxazole (co-trimoxazole) resistance at Chris Hani Baragwanath hospital, Soweto, in the AIDS era. SAMJ. 2000;94 No. 6.Google Scholar
  22. 22.
    Coutsoudis A, Coovadia HM, Kindra G. Time for new recommendations on cotrimoxazole prophylaxis for HIV-exposed infants in developing countries. Bull World Health Organ. 2010;88:949–50.CrossRefGoogle Scholar
  23. 23.
    Marwa KJ, Mushi MF, Konje E, Alele PE, Kidola J, Mirambo MM. Resistance to Cotrimoxazole and other antimicrobials among isolates from HIV/AIDS and non-HIV/AIDS patients at Bugando medical Centre, Mwanza, Tanzania. AIDS Res Treat. 2015.  https://doi.org/10.1155/2015/103874.
  24. 24.
    Boukhebti H, Chaker AN, Lograda T, Ramdani M. Chemical and antimicrobial properties of essential oils of Olea europaea L. Int J Pharmacol Toxicol. 2015;5(1):42–6.Google Scholar
  25. 25.
    Upadhyay RK. Evaluation of Antibacterial and Antifungal Activities of Olive (Olea Europaea) Essential Oil. International Journal of Green Pharmacy. 2014; 8(3). doi.org/10.22377/:gp:v8i3.38
  26. 26.
    Chehab H, Issaoui M, Flamini G, Mechri B, Attia F, Luigi CP, et al. Oil quality and aroma composition of ‘Chemlali’ olive trees (Olea europaea L.) under three irrigation regimes. Afr J Agric Res. 2013;8(48):6291–9.  https://doi.org/10.5897/AJAR2013.7972.CrossRefGoogle Scholar
  27. 27.
    Brahmi F, Flamini G, Mechri B, Dhibi M, Hammami M. Antioxidant activity of the leaf volatile oil and extracts of Olea europaea l.cv. Chetoui from Northern Tunisia. J Food Nutr Disord. 2015;4:3.  https://doi.org/10.4172/2324-9323.1000171.CrossRefGoogle Scholar
  28. 28.
    Dabbou S, Dabbou S, Selvaggini R, Urbani S, Taticchi A, Servili M, Hammami M. Comparison of the chemical composition and the organoleptic profile of virgin olive oil from two wild and two cultivated Tunisian Olea europaea. Chem Biodivers. 2011;8:189–202.  https://doi.org/10.1002/cbdv.201000086.CrossRefPubMedGoogle Scholar
  29. 29.
    Gómez-Rico A, Salvador MD, La Greca M, Fregapane G. Phenolic and volatile compounds of extra virgin olive oil (Olea europaea L. cv. Cornicabra) with regard to fruit ripening and irrigation management. J Agric Food Chem. 2006;54(19):7130–6.  https://doi.org/10.1021/jf060798r.CrossRefPubMedGoogle Scholar
  30. 30.
    Wadood A, Ghufran M, Jamal SB, Naeem M, Khan A, Ghaffar R, et al. Phytochemical Analysis of Medicinal Plants Occurring in Local Area of Mardan. Biochem Anal Biochem. 2013;2:4.  https://doi.org/10.4172/2161-1009.1000144.CrossRefGoogle Scholar

Copyright information

© The Author(s). 2019

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors and Affiliations

  • Munyaradzi Mukesi
    • 1
    • 2
    • 3
    Email author
  • Benson C. Iweriebor
    • 1
    • 2
  • Larry C. Obi
    • 4
  • Uchechukwu U. Nwodo
    • 1
    • 2
  • Sylvester R. Moyo
    • 3
  • Anthony I. Okoh
    • 1
    • 2
  1. 1.SAMRC Microbial Water Quality Monitoring CentreUniversity of Fort HareAliceSouth Africa
  2. 2.Applied and Environmental Microbiology Research Group (AEMREG), Department of Biochemistry and MicrobiologyUniversity of Fort HareAliceSouth Africa
  3. 3.Department of Health Sciences, Faculty of Health and Applied SciencesNamibia University of Science and TechnologyWindhoekNamibia
  4. 4.Academic and Research DivisionUniversity of Fort HareAliceSouth Africa

Personalised recommendations