BMC Genomics

, 19:226 | Cite as

Combining QTL-seq and linkage mapping to fine map a wild soybean allele characteristic of greater plant height

Open Access
Research article
Part of the following topical collections:
  1. Plant genomics

Abstract

Background

Plant height (PH) is an important agronomic trait and is closely related to yield in soybean [Glycine max (L.) Merr.]. Previous studies have identified many QTLs for PH. Due to the complex genetic background of PH in soybean, there are few reports on its fine mapping.

Results

In this study, we used a mapping population derived from a cross between a chromosome segment substitution line CSSL3228 (donor N24852 (G. Soja), a receptor NN1138–2 (G. max)) and NN1138–2 to fine map a wild soybean allele of greater PH by QTL-seq and linkage mapping. We identified a QTL for PH in a 1.73 Mb region on soybean chromosome 13 through QTL-seq, which was confirmed by SSR marker-based classical QTL mapping in the mapping population. The linkage analysis showed that the QTLs of PH were located between the SSR markers BARCSOYSSR_13_1417 and BARCSOYSSR_13_1421 on chromosome 13, and the physical distance was 69.3 kb. RT-PCR and sequence analysis of possible candidate genes showed that Glyma.13 g249400 revealed significantly higher expression in higher PH genotypes, and the gene existed 6 differences in the amino acids encoding between the two parents.

Conclusions

Data presented here provide support for Glyma.13 g249400 as a possible candidate genes for higher PH in wild soybean line N24852.

Keywords

Plant height Wild soybean QTL-seq Linkage mapping Candidate gene 

Abbreviations

ANOVA

Analysis of variance

BSA

Bulked-segregant analysis

CSSLs

Chromosome segment substitution lines

HPH-pool

Higher plant height pool

LPH-pool

Lower plant height pool

NGS

Next-generation sequencing

PCR

Polymerase chain reaction

PH

Plant height

QTL

Quantitative trait locus

RT-qPCR

Real-time quantitative PCR

SSR

Simple sequence repeats

Background

Soybean (Glycine max (L.) Merr.) is an important economic crop and provides most of the plant protein and oil used for human consumption. It is vital to increase world-wide soybean production and seed/pod yield potential [1]. The ideal plant type is the genetic basis of high yield potential. PH is one of the most important traits of plant type and is positively related to yield under the lodging resistance condition in soybean [2]. Wild soybean (Glycine soja Sieb. et Zucc.) with the characteristic of greater PH is a valuable genetic resource for improving cultivated soybean [3, 4, 5]. However, most of the yield-related traits in soybean, such as PH and days to flowering, are complex quantitative traits governed by multiple major or minor genes/QTLs (quantitative trait loci) and affected by the environment. Thus, identification and fine mapping/map-based cloning of the genes underlying these important agronomic traits have been the most effective approaches for molecular breeding [1, 6].

Over the past few decades, rapid progress in DNA markers and their linkage maps has facilitated the identification, localization, and dissection of loci conferring PH and its related trait DTF(Days to flowering), and numerous QTLs for both traits have been identified in soybean with primary mapping populations (F2, F2:3, RILs, etc.) [7, 8]. According to the SoyBase database (http://www.soybase.org/), a total of 255 PH QTLs have been detected in soybean, distributed among 20 linkage groups [9]. Based on the information on these QTLs, the mapping accuracy is not high, and all of them were mapped in large genomic regions due to the genetic background noise [10, 11] and limited recombination in the primary mapping population. Meanwhile, the method of QTL mapping is also highly time-consuming and laborious. QTL mapping is difficult to accurately identify minor QTL and epistasis QTL. Hence, it will affect subsequent QTL fine mapping, cloning and molecular breeding. Therefore, it is necessary to develop a new secondary mapping population and to fully detect polymorphic markers between parents in the target region, which is of great significance for QTL mapping and related gene cloning.

Chromosome segment substitution lines (CSSLs) are ideal materials for genome research, particularly for QTL mapping and cloning. Using the secondary mapping population derived from CSSLs and a recurrent parent, many important trait QTLs were fine mapped and map-based cloned in a crop [12, 13, 14]. For example, Dt1 and Dt2, regulating stem growth habit, and GmILPA1, affecting the leaf petiole angle, have been breakthroughs of fine mapping and map-based cloning in soybean [15, 16]. However, the QTL of PH is still not fine mapped in soybean, which limits its use in marker-assisted breeding. To facilitate the fine mapping of complex quantitative traits, we constructed a CSSL population. An elite cultivar NN1138–2 was used as a recipient parent, and a wild soybean N24852 was used as a donor parent. Backcrossing for 2–5 times, two or more generations of selfing and two applications of marker-assisted selection were constructed [17].

QTL mapping is labor-intensive, time-consuming and sometimes costly [18]. Bulked-segregant analysis (BSA) provides a simple and effective alternative to identify molecular markers linked to target genes or QTLs affecting a trait of interest by genotyping only a pair of bulked DNA samples from two sets of individuals with distinct or opposite extreme phenotypes [19]. With the rapid development of next-generation sequencing (NGS) technologies, new strategies have been proposed to take advantage of the power of BSA and NGS-aided high-throughput genotyping, which have been demonstrated to identify major QTLs in yeast [20, 21], Arabidopsis thaliana [22], rice [23, 24], and sunflower [25]. More recently, Takagi et al. described the QTL-seq approach for the rapid mapping of QTLs in rice by whole genome resequencing of DNA bulks of phenotypic extremities [26].

In the present study, to analyze the genetic difference between a higher PH CSSL3228 and its recipient parent NN1138–2 with lower PH, a secondary mapping population was first constructed. Secondly, QTL-seq was carried out by whole genome re-sequencing of DNA bulks of phenotypic extremities, and a genomic region harboring the major PH QTLs was detected, which was confirmed and fine mapped using classical linkage mapping. Thirdly, the expression pattern of the genes in the mapping regions were investigated through quantitative RT-PCR. The results from the study provide preliminary evidence that a 69.3 kb region on chromosome 13 harbored major QTLs of PH and that Glyma.13 g249400 is a possible candidate gene.

Results

The performance of CSSL3228, NN1138–2 and their derived populations

The PH was evaluated for the tested material, F2:3 and F2:4 families derived from each of the 349 F2 plants, in 2015 and 2016, in Nanjing and Anhui, respectively, along with their two parents, CSSL3228 (P1) and NN1138–2 (P2). The frequency distributions of PH in the mapping population are shown in Fig. 1b–d, continuous variations were detected among the mapping populations, with PH ranges of 43.30–92.30 cm, 40.42–66.42 cm and 37.00–60.44 cm in the environments of 2015 Nanjing (2015NJ), 2016 Nanjing (2016NJ), and 2016 Anhui (2016AH), respectively. As shown in Table 1, stable and significant differences were observed in PH between P1 and P2 and among their derived populations of 349 F2:3 families and 349 F2:4 families across the 3 environments. The heritability of PH was 88.97% in 2016NJ and 85.24% in 2016AH, which suggests that genetic variation accounted for a major part of the phenotypic variance in the populations. A joint ANOVA (Analysis of Variance) of the data from multiple environments showed that the variations among genotypes, environments, and genotype × environment interactions were all significant (Additional file 1: Table S1). Therefore, QTL mapping was performed separately based on individual environments.
Fig. 1

Frequency distribution of plant height (PH) among 349 F2:3 and F2:4 families along with two parents. a represents the chromosome segment substitution line CSSL3228 and its recurrent parent NN1138-2; b represents the distribution of plant height (PH) among 349 F2:3 families in the environment of 2015NJ; and c and d represent the distribution of PH among 349 F2:4 families in the environments of 2016NJ and 2016AH, respectively

Table 1

Statistical measures of PH estimated in parental phenotype and 349 families of mapping population (CSSL3228 × NN1138-2) in 3 environments

Env.

Mapping population

Parents

Mean ± S.D.

Range

CV (%)

h 2 (%)

CSSL3228

NN1138-2

2015NJ

F2:3 families

70.50 ± 1.71

53.33 ± 1.11

61.27 ± 7.87

43.30–92.30

-

-

2016NJ

F2:4 families

54.00 ± 0.82

44.17 ± 0.90

49.22 ± 3.95

37.00–60.44

8.49

88.97

2016AH

F2:4 families

57.00 ± 1.29

46.17 ± 1.07

50.72 ± 3.59

40.42–66.42

8.18

85.24

Env. represents environment, in which 2015NJ, 2016NJ and 2016AH represent the three environments that were used to evaluate the phenotype of the mapping populations; CV represents the coefficient of variation; and h 2 represents heritability

QTL-seq identified a major PH QTL on chromosome 13

Based on phenotyping data of PH among the F2:3 mapping population, two extreme pools were prepared and subjected to the QTL-seq. A total of 20 F2 plants with greater PH, ranging from 58.67 cm to 88.33 cm, and 20 F2 plants with lesser PH, ranging from 35.00 cm to 64.67 cm, were selected and referred to as HPH and LPH, respectively.

A SNP-index was calculated for each identified SNP. SNP-index values across the genome were computed at a 1 Mb interval using a 1 kb sliding window and were plotted for the HPH-pool (Fig. 2a) and LPH-pool (Fig. 2b). By combining the information on SNP-index in the HPH-pool and LPH-pool, Δ (SNP-index) was calculated and plotted against the genome positions (Fig. 2c). At the 95% statistical level, only one genomic region of 1.73 Mb on chromosome 13 from 34.20 to 35.93 Mb had a Δ (SNP-index) value that was significantly different from 0 (Fig. 2c). These results indicated that there was a major QTL related to PH at the 1.73 Mb region of chromosome 13, named qPH13.1.
Fig. 2

Identification of PH QTL qPH13.1 at the 34.20–35.93 Mb region on chromosome 13 by QTL-seq. a, b and c represent the single nucleotide polymorphism (SNP)-index plots of HPH-pool and LPH-pool, Δ (SNP-index) plot of 20 soybean chromosomes (left) and 32.5–39.0 Mb region on chromosome 13 (right), respectively, based on QTL-seq analysis. Y-axis represents the SNP-index calculated based on a 1 Mb interval with a 1 kb sliding window. The Δ (SNP-index) graph was plotted with statistical confidence intervals under the null hypothesis of no QTL (P < 0.05, blue and red), and one candidate major genomic interval (34.20–35.93 Mb) (marked by one rectangle in the left and bordered by two vertical black lines in the right) harboring a PH QTL (qPH13.1) was defined using the criteria of SNP-index near to 1 and 0 in HPH and LPH, respectively

Narrowing down qPH13.1 to a 69.3 kb interval by linkage analysis

To confirm and narrow down the PH QTLs detected by QTL-seq, we conducted classical bi-parental QTL analysis with 349 F2 plants and their derived F2:3 and F2:4 families. Among 112 SSR markers in the target major QTL region detected by QTL-seq, 8 polymorphic SSR markers were between CSSL3228 and NN1138–2 (Table 2). The 8 SSR markers were applied to genotype the 349 F2 plants. For a combination of genotypes and their PH values, linkage mapping was carried out using ICIM mapping software. A major QTL for PH was physically located in a region of 69.3 kb between the SSR markers BARCSOYSSR_13_1417 and BARCSOYSSR_13_1421 on chromosome 13 across the 3 environments (Table 3, Fig. 3), and the allele from wild soybean had a positive effect on PH. Days to flowering was also used to complete QTL mapping in the target region in the mapping population, as there was a difference between the two parents. However, no QTL was detected (Additional file 2: Figure S1). These QTL mapping results support a major QTL for PH in the genomic interval of 69.3 kb on chromosome 13.
Table 2

The 8 polymorphic markers used to narrow down the PH QTLs detected by QTL-seq

Marker

Chr.

Starta

End

Primer sequence

BARCSOYSSR_13_1410

Gm13

35508707

35508744

U: GCGTATTCCCTTAACAAAATTAAAGTTTCAC

L: GCGCGTCAGCCTAACAAAAAGAATAAAAT

BARCSOYSSR_13_1417

Gm13

35668210

35668255

U: CAAAAGAAACCTCATTCCTGC

L: AACGTTAATGCGTGGAGATT

BARCSOYSSR_13_1419

Gm13

35698358

35698407

U: ACGAAGGTGGAATGAGGATG

L: TCTCATTCGTGCCCTGTAGT

BARCSOYSSR_13_1421

Gm13

35737431

35737464

U: TCTCAAGTCATTTTAATTACCGC

L: AAAATTTTCATTCACTTGGATTTT

BARCSOYSSR_13_1422

Gm13

35738647

35738680

U: TGAATTTAATAGTCATGCACGGA

L: CCCAAAAATCATAGTTGGTTG

BARCSOYSSR_13_1425

Gm13

35791995

35792026

U: TTTCTCCCCATGTCAAATTGT

L: TCTCCTCAAATTCCAACTTTTG

BARCSOYSSR_13_1426

Gm13

35797040

35797063

U: CTCCACCCTGCGGTAATAAA

L: TTTGGGGATAGCCAAAGAAA

BARCSOYSSR_13_1429

Gm13

35848793

35848826

U: CCTCAATGTTTTGAGCGATTC

L: GGTTCAAATTGGCGGTTTTA

aLocation in draft genome assembly of Glyma 2.0

Table 3

QTL mapping of plant height on chromosome 13 in 3 environments

Env.

Chr.

Interval

Position(bp)

LOD

R2(%)

Additive effect

Dominant effect

2015NJ

13

SSR_13_1417-SSR_13_1421

35668210-35737464

8.11

10.31

3.26

1.02

2016AH

13

SSR_13_1417-SSR_13_1421

35668210-35737464

11.86

14.67

1.86

0.04

2016NJ

13

SSR_13_1417-SSR_13_1421

35668210-35737464

14.35

14.94

2.03

0.38

Chr. chromosome

Fig. 3

Validation of PH QTLs detected by QTL-seq through linkage mapping. a represents the linkage map of the target region detected by QTL-seq constructed by the Join Map v4.0 software, and b represents the distribution of the LOD scores for plant height over the target region detected by QTL-seq on chromosome 13. LOD scores were calculated independently by ICIM for the three environments. The LOD score for 2015NJ is in blue, 2016NJ is in green, and 2016AH is in red

Analysis of the candidate genes of qPH13.1 through RT-qPCR

According to the Williams 82 reference genome sequence [27] (Version Glyma 2.0), a total of 12 genes were contained in the genomic region of qPH13.1, which was narrowed down to a 69.3 kb interval by QTL fine mapping (Table 4). To identify the candidate gene for qPH13.1, the expression patterns of the 12 annotated genes were tested in three tissues (leaf, stem and shoot apical meristem) of NN1138–2 and CSSL3228, at four growth developmental stages—V1(Fully developed leaves at unifoliolate nodes), V3(Three nodes on the main steam with fully developed leaves beginning with the unifoliolate nodes), R1(One open flower at any node on the main stem) and R2(Open flower at one of the two uppermost nodes on the main stem with a fully developed leaf)—through RT-qPCR [28].
Table 4

The function annotation of the 12 genes contained in the interval of qPH13.1

Gene ID

Position (bp)

Function annotation

Glyma.13g248600

35666896..35668024

Late embryogenesis abundant protein

Glyma.13g248700

35668869..35672143

S-locus Lectin Protein Kinase

Glyma.13g248800

35677452..35681265

S-locus Lectin Protein Kinase

Glyma.13g248900

35685233..35690583

receptor kinase 3

Glyma.13g249000

35692094..35696834

S-locus lectin protein kinase

Glyma.13g249100

35700102..35701373

Unknown

Glyma.13g249200

35701896..35706080

receptor kinase 3

Glyma.13g249300

35712020..35716076

S-locus lectin protein kinase

Glyma.13g249400

35719291..35721124

plant U-box 8

Glyma.13g249500

35721467..35721860

Unknown

Glyma.13g249600

35726229..35729214

Quinone reductase family protein

Glyma.13g249700

35731494..35733559

Quinone reductase family protein

As shown in Fig. 4 and Additional file 3: Table S2, a total of five annotated genes, Glyma.13 g248800, Glyma.13 g249000, Glyma.13 g249300, Glyma.13 g249400 and Glyma.13 g249600, displayed strongly different expressions of more than two-fold in at least one of the three tissues, including leaf (LE), stem (ST) and shoot apical meristem (SAM), during the four different growth stages. Among them, Glyma.13 g248800, Glyma.13 g249000, Glyma.13 g249300, Glyma.13 g249400 and Glyma.13 g249600, showed different expressions between NN1138–2 and CSSL3228 at a significance level of P = 0.01. During all four tested growth stages, there was pronounced differentially expressed in ST and SMA of higher PH parental genotype CSSL3228 and lower PH genotype NN1138–2. Therefore, the differential expression of these genes in two parents (CSSL3228 and NN1138–2) provides a strong support for their possible use as candidate genes for plant height.
Fig. 4

Expression of 12 candidate genes in leaves, stems and shoot apical meristems of NN1138-2 and CSSL3228 at four growth developmental stages. a-l represent the expression patterns of 12 candidate genes in three tissues of NN1138-2 and CSSL3228, including leaf (LE), stem (ST) and shoot apical meristem (SAM), at four growth developmental stages of V1, V3, R1, and R2, respectively; Asterisks on the top of bars indicate statistically significant differences (p < 0.01) between NN1138-2 and CSSL3228 within the pair of comparison of the combination of tissue and growth developmental stage

Candidate genes sequence analysis

In order to further clarify the sequence differences of the five candidate genes (Glyma.13 g248800, Glyma.13 g249000, Glyma.13 g249300, Glyma.13 g249400 and Glyma.13 g249600), we sequenced the genes in P1 (CSSL3228) and P2 (NN1138–2) (Fig. 5a, Additional file 4: Figure S2, Additional file 5: Figure S3 and Additional file 6: Figure S4). Because the sequence of Glyma.13 g249000 has continuous structure and poly structure, which leads to disorder of sequencing results, and sets of peaks, the study did not find the Glyma.13 g249000 in the parent sequence. We found that there was only one different sequence between the two parents in the gene Glyma.13 g249400, which existed 6 differences in the amino acids encoding between the two parents (Fig. 5a). Therefore, among the four genes obtained, Glyma.13 g249400 is most likely to be involved in the regulation of plant height in soybean. To analyze the genetic mechanism of plant height in soybean, we still need to further study these two genes.
Fig. 5

Multiple sequence alignment depicting the amino acid sequence conservation of Glyma.13g249400. a represent multiple sequence alignment depicting the amino acid sequence conservation of P1(CSSL3228) Glyma.13g249400 gene with P2(NN1138-2) gene (Glyma.13g249400) in soybean, b represent multiple sequence alignment depicting the amino acid sequence conservation of soybean Glyma.13g249400 gene with its orthologous gene (AtPUB8) in Arabidopsis thaliana (At)

Discussion

Soybean was domesticated in China approximately 6000–9000 years ago [29]. Due to bottlenecks and human selection, cultivated soybean has much lower genetic diversity than its wild counterpart [4, 5]. Wild soybean (Glycine soja Sieb. et Zucc.), with characteristics of high reproductivity, high number of pods, high protein content, adaptability to various stresses, etc., is acknowledged to be the wild progenitor of the cultivated soybean (Glycine max (L.) Merr.) [30]. One of the important goals of genomic and genetic studies in crops is to identify the favorable alleles or genes from unique germplasm resources, such as wild accessions, that can be used to improve agronomic traits and thereby agricultural productivity. In cultivated soybean, some excellent genes in wild soybean have been detected and used for genetic improvement [31]. For example, a total of 142 (times) QTLs for 22 morphological and yield-related traits were reported by using eight inter-specific mapping populations, including A81–356022 × PI468916, NN1138–2 × N24852 (Additional file 7: Table S3), containing the wild positive alleles in protein concentration [32], increased seed yield [33] etc. A total of 64 (times) QTLs were detected for the six seed quality traits (Additional file 8: Table S4), among which approximately 30 G. soja alleles had associated positive effects. Although wild soybean is associated with low oil content, G. soja alleles, which could improve oil content, have been detected in wild soybean N24852 [34]. A total of 25 QTLs for resistance to diseases and pests and tolerance to stress traits were detected in wild soybean (Additional file 9: Table S5). Among them, 14 G. soja alleles had associated positive effects. These results demonstrate the potential of identifying positive alleles in the exotic germplasm of soybean.

PH is an important agronomic trait with yield contribution in soybean [2]. Wild soybean, with a characteristic of greater PH, might contain positive alleles. Previous research has identified many PH QTLs in cultivated soybean by using primary populations, which promotes our comprehensive understanding of the genetic basis. However, it is difficult to fine map and map-based clone a QTL by using a primary population, such as F2 and RILs, due to whole genome segregant in these populations [35, 36, 37]. Therefore, the development of new sub-populations, such as mapping near-isogenic lines (NILs) and chromosome segment substitution lines (CSSLs), is necessary. In our research, a set of CSSL populations were developed by using wild soybean as a donor parent to mine its excellent genes. In the population, a CSSL with greater PH was found. To explore the wild allele of greater PH, a secondary mapping population was developed using the greater PH CSSL and recurrent parent NN1138–2. Subsequently, a major QTL of PH was detected, conformed and fine mapped into a 69.3 kb region on chromosome 13. Regarding previous research, QTLs were also reported by Gai et al. [37] but were mapped into a large region by an RIL population derived from NN1138–2 and Kefeng No.1. Meanwhile, the major PH QTLs were found to be pleiotropic and associated with plant height, which explained the strong correction of phenotype between them [38].

A combination of QTL and linkage mapping could effectively detect and fine map the QTL of interest. In the present study, major PH QTLs were identified and mapped into a 69.3 kb genomic region on chromosome 13 by using an F2 secondary mapping population via whole-genome NGS-based high-throughput QTL-seq. The QTL-seq-detected PH QTLs based on SNP-index were further validated by SSR marker-based traditional QTL mapping (at higher LOD > 14) (Fig. 3) and were mapped between the SSR markers BARCSOYSSR_13_1417 and BARCSOYSSR_13_1421, which suggests the validity and robustness of QTL-seq as a strategy for quick and efficient scanning of major QTLs on a genome-wide scale in soybean. The advantages of QTL-seq vis-a-vis other available traditional QTL mapping approaches [39, 40, 41] to identify major QTLs governing seedling vigor, blast resistance and flowering time in crops, including rice and cucumber, have been recently reported [42, 43]. This method took advantage of the high-throughput whole genome resequencing and bulked-segregant analysis (BSA). In addition, the use of a SNP-index allowed accurate quantitative evaluation of the frequencies of the parental alleles as well as the genomic contribution from the two parents to F2 individuals. These features of QTL-seq make it a quicker and more efficient method to identify genomic regions harboring major QTLs of the target gene.

In the present paper, the major PH QTLs were delimited into a 69.3 kb physical interval on chromosome 13 (Table 3) with the strategy of combining QTL-seq and classical QTL analysis. There were 12 predicted genes in this region. Among the 12 genes, the function annotation (Table 4) and expression pattern (Additional file 3: Table S3, Fig. 1a) of the Glyma.13 g249000 and Glyma.13 g249400 genes suggested that it could be a candidate gene for qPH13.1. According to the functional annotation, Glyma.13 g249000 belongs to S-locus lectin protein kinase family protein gene, which can be involved in signal transduction, anti-retrogradation reaction and pathogen reaction in plants, which is of great significance to plants. There are currently no reports related to plant growth and development [44]. In addition, sequence analysis also found that there were 6 amino acid differences in the gene Glyma.13 g249400 between the two parents (Fig. 5a). Glyma.13 g249400 shared 53% amino acid sequence identity with AtPUB8, and the expression level of Glyma.13 g249400 in CSSL3228 plants was higher than that in NN1138–2 plants (Figs. 4i and 5b). There are three go functional annotation results of Glyma.13 g249400, GO:0000151 (ubiquitin ligase complex), GO:0004842 (ubiquitin-protein ligase activity) and GO:0016567 (protein ubiquitination). Collectively, this gene is ubiquitin ligase-related, and is currently not commented on KEGG pathway. U-box ubiquitin ligases belong to a ubiquitin ligase. Plant U-box (PUB) proteins are a small family of proteins with the U-box motif [45, 46, 47, 48]. The U-box comprises ca. 70 amino acids and resembles a modified RING finger that forms a similar structure stabilized by salt-bridges and hydrogen bonds [46]. PUBs have E3 activity [49, 50]. PUB E3s are involved in diverse biological processes such as development, self-incompatibility, and response to hormones. They are widely connected with plant stress response [50, 51, 52, 53]. Therefore, it is reasonable to postulate that Glyma.13 g249400 is the candidate gene for PH in soybean. However, further evidence is needed to functionally validate this hypothesis.

Conclusions

In this study, we identified a QTL for PH in a 1.73 Mb region on soybean chromosome 13 through QTL-seq, which was confirmed by SSR marker-based classical QTL mapping in the mapping population. The linkage analysis showed that the QTLs of PH were located between the SSR markers BARCSOYSSR_13_1417 and BARCSOYSSR_13_1421 on chromosome 13, and the physical distance was 69.3 kb. To identify the candidate gene for qPH13.1, the expression patterns of the 12 annotated genes were tested in three tissues (leaf, stem and shoot apical meristem) of NN1138–2 and CSSL3228, at four growth developmental stages—V1, V3, R1 and R2—through RT-qPCR. A total of five annotated genes, Glyma.13 g248800, Glyma.13 g249000, Glyma.13 g249300, Glyma.13 g249400 and Glyma.13 g249600, displayed strongly different expressions of more than two-fold in at least one of the three tissues, including leaf (LE), stem (ST) and shoot apical meristem (SAM), during the four different growth stages. According to candidate genes sequencing analysis, in which Glyma.13 g249000 was not included, only Glyma.13 g249400 had sequence differences in the two parents among other four genes, and there are six differences in the amino acids encoding. Therefore, Glyma.13 g249400 and Glyma.13 g249000 may play a positive role in the formation of plant height in soybean.

Methods

Plant materials and phenotypic evaluation

CSSL3228 is a chromosome segment substitution line developed in a previous study by introgressing a few chromosomal segments of a wild soybean (Glycine soja Sieb. et Zucc.) N24852 in maturity group (MG) III into an elite cultivar in MG III. The genetic background of NN1138–2 includes three generations of backcrossing and four generations of selfing [17]. The CSSL3228 showed significantly higher PH than the recurrent parent NN1138–2 based on over 2 years’ phenotypic evaluations in Nanjing, China (N 31.2, E 118.4) (Fig. 1a).

To uncover the genetic basis of PH, an F2 population composed of 349 plants was constructed by using CSSL3228 as the male parent and NN1138–2 as the female parent. The F2 population and F2:3 families derived from each of the 349 F2 plants, along with their parents, were grown in June 2014 and 2015 in Nanjing, respectively, in a single plot without replication and in a complete randomized block design with three replications, one row per plot, 20 plants per row, 10 cm between plants within each row and 50 cm between rows. Then, the F2:4 families derived from each of the 349 F2 plants, along with their parents, were planted at two different geographical locations, Nanjing and Anhui, in June 2016. The planting manner of each plot was the same as that of the F2 population and F2:3 families previously described. The field management was under normal soybean production conditions.

In the present paper, PH was measured as the length from the ground to the terminal bud of a plant at maturity. For phenotyping the F2 population, five plants were selected at random from each of the F2:3 and F2:4 families, and the mean of the F2:3 and F2:4 families was representative of the phenotype of the F2 plants. The diverse statistical attributes, including the coefficient of variation (CV), broad-sense heritability (h 2 ), frequency distribution, correlation coefficient and analysis of variance (ANOVA) of PH in the mapping population, were analyzed using IBM SPSS software (https://www.ibm.com/analytics/us/en/technology/spss/) and following the methods of Kujur et al. [54, 55].

DNA extraction and QTL-seq analysis

Fresh leaves of the CSSL3228, NN1138–2 and 349 F2 individuals were collected and ground up in liquid nitrogen. DNA was extracted using the CTAB method [56] with minor modifications and was used for both QTL-seq and molecular marker analysis. For QTL-seq, two DNA pools, higher plant height pool (HPH-pool) and lower plant height pool (LPH-pool), were constructed, respectively, by mixing an equal amount of DNA from 20 higher PH (PH = 58.67–88.33 cm) and 20 lower PH (PH = 35.00–64.67 cm) F2 individuals according to the average PH of the F2:3 families from the 2015 experiment [57]. Pair-end sequencing libraries (read length 100 bp) with insert sizes of approximately 350 bp were prepared for sequencing with an Illumina HiSeq™ PE150 machine. The short reads from the HPH-pool and the LPH-pool were aligned to the Williams 82 reference genome using BWA software [58]. SNP-calling was performed using the SAM tools software [59]. Low-quality SNPs with a base quality value < 20 were excluded because these SNPs may be false positives due to a genomic repeat sequence or sequencing or alignment errors. Two parameters, SNP-index and Δ (SNP-index) [23, 26], were calculated to identify candidate genomic regions related to PH. The SNP-index is the proportion of reads harboring the SNP that are different from the reference sequence. Δ (SNP-index) was obtained by subtraction of the SNP-index of the HPH-pool from that of the LPH-pool. Thus, SNP-index = 0 if the entire short reads contain genomic fragments from NN1138–2; SNP-index = 1 if all the short reads were from N24852.

An average SNP-index of the SNPs in each genomic interval was calculated using a sliding window analysis with a 1 Mb window size and 1 kb increment. The SNP-index graphs for the HPH-pool and LPH-pool and corresponding Δ (SNP-index) Manhattan graph were plotted. The Δ (SNP-index) value should not be significantly different from 0 in a genomic region with no major QTLs of the target gene. We calculated statistical confidence intervals of Δ (SNP-index) for all SNP positions with given read depths under the null hypothesis of no QTLs and plotted them along with Δ (SNP-index). For each read depth, 95% confidence intervals of Δ (SNP-index) were obtained following [59].

By using Illumina high-throughput sequencing, a total of 207,558,487 and 195,789,024 short reads (150 bp in length) were generated for the HPH-pool (10× depth coverage or 98.44% coverage) and LPH-pool (10× depth coverage or 98.27% coverage), respectively. These short reads were aligned to the Williams 82 reference genome with a size of 978,495,272 bp, and the match rates were between 98.04–98.44% of the reference genome (excluding the N region) among samples covering an average depth of between 9.51× − 29.23 ×, with 1× coverage (at least one covering basis) in more than 94.68%. To identify the candidate genomic region affecting PH, a total of 20,084 polymorphic markers were selected to calculate the SNP-index of HPH and LPH based on the genotyping results. The SNP-index represents the frequencies of parental alleles in the population of bulked individuals. In this case, the NN1138–2 genome was used as the reference, where a SNP-index = 1 indicated that reads in the population were derived only from the NN1138–2 genome and a SNP-index = 0 indicated that the reads were derived only from another parent. A SNP-index of 0.5 indicated an equal genome contribution from both parents. A significant deviation from a SNP-index of 0.5 could indicate the contribution of that SNP to the phenotypic difference observed in the bulks [23].

SSR marker analysis and QTL verification and fine mapping

To validate and fine map the higher PH QTLs identified by QTL-seq, traditional QTL mapping was carried out. A total of 112 SSR markers in the predicted region on chromosome 13 were selected to survey the polymorphism between the two parental lines according to the integrated soybean genetic linkage map. Among them, 8 polymorphic SSR markers were applied to genotype the F2 population. Polymerase chain reaction (PCR) was conducted according to Panaud et al. (1996) with minor modifications. PCR products were separated by 8% PAGE gel to detect polymorphisms [60].

The JoinMap v4.0 software [61] was used to construct the linkage map. To determine the marker order within a linkage group (LG), the JoinMap parameters were set at Rec = 0.40 at different LOD values for different groups. Map distance was converted to centiMorgans (cMs) using the Kosambi mapping function. The linkage map was drawn using Map Chart software [62]. QTL analysis was conducted using the software IciMapping 2.0 using the RSTEP-LRT-ADD model (ICIM mapping) procedure [63, 64, 65].

Expression analysis of candidate genes

To analyze the candidate genes related to PH, we investigated the expression pattern of the genes in the overlap region of QTL-seq and mapping of PH by using real-time quantitative PCR (RT-qPCR). In the summer of 2016, leaf (LE), stem (ST) and shoot apical meristem (SAM) samples at four growth stages—V1, V3, R1 and R2—were collected from P1 and P2. Total RNA for all the samples was extracted using the EasyPure Plant RNA Kit (TranGen Biotech, Beijing, China). Reverse transcription was conducted by Transcript two-step gDNA Removal, and cDNA was synthesized using the Prime Script™ RT Reagent Kit (TaKaRa, Japan) using a standard protocol. The soybean β-tubulin gene (Tubulin) was used as an internal control (forward, 5′- GGAGTTCACAGAGGCAGAG’, and reverse, 5′- CACTTACGCATCACATAGC-3′). Tubulin was used as a positive control to ensure the quality of the RNA and cDNA previously. Each step was repeated three times (technical replications). Average relative expression levels for P1 and P2 were calculated. T tests were performed to test the significance of differences in expression levels among different samples. The primers for qRT-PCR were designed by Primer Premier 5.0. To ensure specific amplification, the primer sequences were blasted on the Phytozome v12.1 database (http://www.phytozome.net/soybean). The oligo nucleotides of the RT-qPCR primers are listed in Additional file 10: Table S6.

Sequence analysis of candidate genes

In order to clarify the mutation of the differentially expressed genes in the two parents in the quantitative analysis, we sequenced the CDS sequence of this five candidate genes(Glyma.13 g248800, Glyma.13 g249000, Glyma.13 g249300, Glyma.13 g249400 and Glyma.13 g2496000). Total RNA was extracted by using the EasyPure Plant RNA Kit (TranGen Biotech, Beijing, China) from leaves of P1(CSSL3228) and P2(NN1138–2). Reverse transcription was conducted by Transcript two-step gDNA Removal, and cDNA was synthesized by using the Prime Script™ RT Reagent Kit (TaKaRa, Japan). The primers for qRT-PCR were designed by Primer Premier 5.0. The target gene was subjected to PCR by using Phanta® Max Super-Fidelity DNA Polymerase from Vazyme, and sent to Kingsley for sequencing (Additional file 11: Table S7) after agarose gel electrophoresis. Amino acid homology alignment using DNAMAN software.

Notes

Acknowledgements

Not applicable

Funding

This work was supported by National Key R&D Program of China(2017YFD0102002, 2017YFD0101500), the National Natural Science Foundation of China (Grant No.31301343), Modern Agro-industry Technology Research System of China (CARS-004-PS10), Jiangsu Collaborative Innovation Center for Modern Crop Production (JCIC-MCP). The funding bodies had no role in the design of the study and collection, analysis and interpretation of data and in writing the manuscript.

Availability of data and materials

All data generated or analysed during this study were included in this published article and the additional files.

Authors’ contributions

JMZ and HX conceived and designed the experiments. XLZ performed the experiments and analyzed the data. XLZ, WBW, NG, YYZ, YPB conducted the molecular experiments and collected samples. XLZ wrote the paper. JMZ, HX and XLZ revised the paper. All authors read and approved the final manuscript.

Ethics approval and consent to participate

Wild soybeans used in this study were collected from southern China by Nanjing Agricultural University (NJAU) and cultivated soybean were cultivated by Nanjing Agricultural University (NJAU). All these samples were permitted to do scientific research. The experimental research on soybean was complied with China’s legislation and field studies was in accordance with legislation of Nanjing Agricultural University. All the experiments were not involved in any endangered or protected species.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary material

12864_2018_4582_MOESM1_ESM.xlsx (10 kb)
Additional file 1: Table S1. Variance analysis for plant height in 2 environments. (XLSX 10 kb)
12864_2018_4582_MOESM2_ESM.pdf (37 kb)
Additional file 2: Figure S1. Distribution of the LOD scores for days to flowering in the target region detected by QTL-seq. (PDF 37 kb)
12864_2018_4582_MOESM3_ESM.xlsx (23 kb)
Additional file 3: Table S2. Relative expression level of 12 annotated genes in leaves, stems and shoot apical meristems of NN1138–2 and CSSL3228 at four growth developmental stages. (XLSX 22 kb)
12864_2018_4582_MOESM4_ESM.pdf (242 kb)
Additional file 4: Figure S2. Multiple sequence alignment depicting the amino acid sequence conservation of P1 (CSSL3228) Glyma.13 g248800 gene with P2 (NN1138–2) gene (Glyma.13 g248800) in soybean. (PDF 242 kb)
12864_2018_4582_MOESM5_ESM.pdf (303 kb)
Additional file 5: Figure S3. Multiple sequence alignment depicting the amino acid sequence conservation of P1 (CSSL3228) Glyma.13 g249300 gene with P2 (NN1138–2) gene (Glyma.13 g249300) in soybean. (PDF 303 kb)
12864_2018_4582_MOESM6_ESM.pdf (96 kb)
Additional file 6: Figure S4. Multiple sequence alignment depicting the amino acid sequence conservation of P1 (CSSL3228) Glyma.13 g249600 gene with P2 (NN1138–2) gene (Glyma.13 g249600) in soybean.. (PDF 96 kb)
12864_2018_4582_MOESM7_ESM.xlsx (13 kb)
Additional file 7: Table S3. QTL conferring morphological and yield-related traits detected by linkage. (XLSX 12 kb)
12864_2018_4582_MOESM8_ESM.xlsx (13 kb)
Additional file 8: Table S4. QTL conferring seed quality traits detected by linkage mapping. LA concentration represents linolenic acid concentration, and ALA represents Alpha-linolenic acid. (XLSX 12 kb)
12864_2018_4582_MOESM9_ESM.xlsx (12 kb)
Additional file 9: Table S5. Resistances to diseases and pests, tolerance to stresses and physiological traits. RDT2 represents root distribution in thickness classification 2 (0.5–1.0 mm), and RDL3 represents root distribution in length. (XLSX 11 kb)
12864_2018_4582_MOESM10_ESM.xlsx (11 kb)
Additional file 10: Table S6. The oligo nucleotides of the RT-qPCR primers for candidate genes. (XLSX 10 kb)
12864_2018_4582_MOESM11_ESM.xlsx (10 kb)
Additional file 11: Table S7. The oligo nucleotides of the cloning primers for candidate genes. (XLSX 10 kb)

References

  1. 1.
    Das S, Upadhyaya HD, Bajaj D, Kujur A, Badoni S, Laxmi,et al. Deploying QTL-seq for rapid delineation of a potential candidate gene underlying major trait-associated QTL in chickpea. DNA Res. 2015;22(3):193–203.Google Scholar
  2. 2.
    Gowda CLL, Upadhyaya HD, Dronavalli N, Singh Sube. Identification of large-seeded high-yielding stable Kabuli chickpea germplasm lines for use in crop improvement. Crop Sci. 2011;51(1):198–209.Google Scholar
  3. 3.
    Kim MY, Lee S, Van K, Kim TH, Jeong SC, Choi IY, et al. Whole-genome sequencing and intensive analysis of the undomesticated soybean (Glycine soja Sieb. and Zucc.) genome. Proc Natl Acad Sci. 2010;107(51):22032.Google Scholar
  4. 4.
    Lam HM, Xu X, Liu X, Chen W, Yang G, Wong FL, et al. Resequencing of 31 wild and cultivated soybean genomes identifies patterns of genetic diversity and selection. Nat Genet. 2010;42(12):1053–1059.Google Scholar
  5. 5.
    Hyten DL, Song Q, Zhu Y, Choi IY, Nelson RL, Costa JM, et al. Impacts of genetic bottlenecks on soybean genome diversity. Proc Natl Acad Sci. 2006;103(45):16666–16671.Google Scholar
  6. 6.
    Robertson DS. A possible technique for isolating genic DNA for quantitative traits in plants. J Theor Biol. 1985;117(1):1–10.Google Scholar
  7. 7.
    Li DM, Sun MM, Han YP, Teng WL, Li WB. Identification of QTL underlying soluble pigment content in soybean stems related to resistance to soybean white mold (Sclerotinia sclerotiorum). Euphytica. 2010;172(1):49–57.Google Scholar
  8. 8.
    Yao D, Liu ZZ, Zhang J, Liu SY, Qu J, Guan SY, et al. Analysis of quantitative trait loci for main plant traits in soybean. Genet Mol Res. 2015;14(2):6101–6109.Google Scholar
  9. 9.
    Lee S, Jun TH, Michel AP, Mian MAR. SNP markers linked to QTL conditioning plant height, lodging, and maturity in soybean. Euphytica. 2015;203(3):521–532.Google Scholar
  10. 10.
    Tanksley SD, Nelson JC. Advanced backcross QTL analysis: a method for the simultaneous discovery and transfer of valuable QTLs from unadapted germplasm into elite breeding lines. Theor Appl Genet. 1996;92(2):191–203.Google Scholar
  11. 11.
    Bernacchi DBT, Emmatty D, Eshed Y, Inai S, Lopez J, Petiard V, et al. Advanced back-cross QTL analysis of tomato. II. Evaluation of near-isogenic lines carrying single-donor introgressions for desirable wild QTL-alleles derived from Lycopersicon hirsutum and L. pimpinellifolium. Theor Appl Genet. 1998;97(2):170–180.Google Scholar
  12. 12.
    Furuta T, Uehara K, Angeles-Shim RB, Shim J, Ashikari M, Takashi T. Development and evaluation of chromosome segment substitution lines (CSSLs) carrying chromosome segments derived from Oryza rufipogon in the genetic background of Oryza sativa L. Breeding Sci. 2014;63(5):468–475.Google Scholar
  13. 13.
    He Q, Yang H, Xiang S, Wang W, Xing G, Zhao T, et al. QTL mapping for the number of branches and pods using wild chromosome segment substitution lines in soybean [Glycine max (L.) Merr.]. Plant Genet Resour. 2014;12(S1):S172–S177.Google Scholar
  14. 14.
    Wan X, Weng J, Zhai H, Wang J, Lei C, Liu X, et al. Quantitative Trait Loci (QTL) analysis for Rice grain width and fine mapping of an identified QTL allele gw-5 in a recombination hotspot region on chromosome 5. Genetics. 2008;179(4):2239–2252.Google Scholar
  15. 15.
    Ping J, Liu Y, Sun L, Zhao M, Li Y, She M, et al. Dt2 is a gain-of-function MADS-domain factor gene that specifies semideterminacy in soybean. Plant Cell. 2014;26(7):2831–2842.Google Scholar
  16. 16.
    Gao J, Yang S, Cheng W, Fu Y, Leng J, Yuan X, et al. GmILPA1, encoding an anaphase-promoting complex-like protein, affects leaf petiole angle. Plant Physiol. 2017;174(2):1167–1176.Google Scholar
  17. 17.
    Wang W, He Q, Yang H, Xiang S, Zhao T, Gai J. Development of a chromosome segment substitution line population with wild soybean ( Glycine soja Sieb. et Zucc.) as donor parent. Euphytica. 2013;189(2):293–307.Google Scholar
  18. 18.
    Salvi S, Tuberosa R. To clone or not to clone plant QTLs: present and future challenges. Trends Plant Sci. 2005;10(6):297–304.Google Scholar
  19. 19.
    Michelmore RW, Paran I, Kesseli RV. Identification of markers linked to disease-resistance genes by bulked segregant analysis: a rapid method to detect markers in specific genomic regions by using segregating populations. Proc Natl Acad Sci U S A. 1991;88(21):9828–9832.Google Scholar
  20. 20.
    Ehrenreich IM, Noorossadat T, Yue J, Jonathan K, Stephen M, Shapiro JA, et al. Dissection of genetically complex traits with extremely large pools of yeast segregants. Nature. 2010;464(7291):1039–1042.Google Scholar
  21. 21.
    Swinnen S, Schaerlaekens K, Pais T, Claesen J, Hubmann G, Yang Y, et al. Identification of novel causative genes determining the complex trait of high ethanol tolerance in yeast using pooled-segregant whole-genome sequence analysis. Genome Res. 2012;22(5):975–984.Google Scholar
  22. 22.
    Schneeberger K, Ossowski S, Lanz C, Juul T, Petersen AH, Nielsen KL, et al. SHOREmap: simultaneous mapping and mutation identification by deep sequencing. Nat Methods. 2009;6(8):550–551.Google Scholar
  23. 23.
    Abe A, Kosugi S, Yoshida K, Natsume S, Takagi H, Kanzaki H, et al. Genome sequencing reveals agronomically important loci in rice using MutMap. Nat Biotechnol. 2012;30(2):174–178.Google Scholar
  24. 24.
    Yang Z, Huang D, Tang W, Zheng Y, Liang K, Cutler AJ, et al. Mapping of quantitative trait loci underlying cold tolerance in Rice seedlings via high-throughput sequencing of pooled extremes. PLoS One. 2013;8(7):670–692.Google Scholar
  25. 25.
    Livaja M, Wang Y, Wieckhorst S, Haseneyer G, Seidel M, Hahn V, et al. BSTA: a targeted approach combines bulked segregant analysis with next- generation sequencing and de novo transcriptome assembly for SNP discovery in sunflower. BMC Genomics. 2013;14(1):1–10.Google Scholar
  26. 26.
    Takagi H, Abe A, Yoshida K, et al. QTL‐seq: rapid mapping of quantitative trait loci in rice by whole genome resequencing of DNA from two bulked populations[J]. Plant Journal for Cell & Molecular Biology, 2013, 74(1):174.Google Scholar
  27. 27.
    Schmutz J, Cannon SB, Schlueter J, Ma J, Mitros T, Nelson W, et al. Genome sequence of the palaeopolyploid soybean. Nature. 2010;463(7278):178–183.Google Scholar
  28. 28.
    Fehr WR, Caviness CE. Stages of soybean development. Special Report. 1977. 87.Google Scholar
  29. 29.
    Dashiell K. SOYBEANS: improvement, production, and uses. Third edition : Boerma, H.R., Specht, J.E. (Eds), American Society of Agronomy, crop science Society of America, soil science Society of America, Madison, Wisconsin, USA. Agric Syst. 2005;83(1):110–111.Google Scholar
  30. 30.
    Broich SL, Palmer RG. A cluster analysis of wild and domesticated soybean phenotypes. Euphytica. 1980;29(1):23–32.Google Scholar
  31. 31.
     Qi X, Li MW, Xie M, Liu X, Ni M, Shao G, et al. Identification of a novel salt tolerance gene in wild soybean by whole-genome sequencing. Nat Commun. 2014;5(5):4340.Google Scholar
  32. 32.
     Sebolt AM, Shoemaker RC, Diers BW. Analysis of a quantitative trait locus allele from wild soybean that increases seed protein concentration in soybean. Crop Sci. 2000;40(5):1438–1444.Google Scholar
  33. 33.
    Concibido V, Vallee BL, Mclaird P, Pineda N, Meyer J, Hummel L, et al. Introgression of a quantitative trait locus for yield from Glycine soja into commercial soybean cultivars. Theor Appl Genet. 2003;106(4):575–582.Google Scholar
  34. 34.
    Wang W, He Q, Yang H, Xiang S, Xing G, Zhao T, et al. Identification of QTL/segments related to seed-quality traits in G. Soja using chromosome segment substitution lines. Plant Gene Resour Characterizat Utilization. 2014;12:S65–S69.Google Scholar
  35. 35.
     Peng J, Richards DE, Hartley NM, Murphy GP, Devos KM, Flintham JE, et al. Green revolution genes encode mutant gibberellin response modulators. Nature. 1999;400(6741):256–261.Google Scholar
  36. 36.
     Moongkanna J, Nakasathien S, Novitzky WP, Kwanyuen P, Sinchaisri P, Srinives P. SSR markers linking to seed traits and total oil content in soybean. Thai J Agric Sci. 2011;44(4):233–241.Google Scholar
  37. 37.
     Chen Q, Zhang Z, Liu C. QTL analysis of major agronomic traits in soybean. J Integr Agric. 2007;6(4):399–405.Google Scholar
  38. 38.
    Gai J, Wang Y, Wu X, Chen S. A comparative study on segregation analysis and QTL mapping of quantitative traits in plants—with a case in soybean. Front Agric China. 2007;1(1):1–7.Google Scholar
  39. 39.
    Tuinstra MR, Ejeta G, Goldsbrough PB. Heterogeneous inbred family (HIF) analysis: a method for developing near-isogenic lines that differ at quantitative trait loci. Theor Appl Genet. 1997;95(5):1005–1011.Google Scholar
  40. 40.
    Monforte AJ, Tanksley SD. Development of a set of near isogenic and backcross recombinant inbred lines containing most of the Lycopersicon hirsutum genome in a L. esculentum genetic background: a tool for gene mapping and gene discovery. 2000;43(5):803–813.Google Scholar
  41. 41.
     Loudet O, Gaudon V, Trubuil A, Danielvedele F. Quantitative trait loci controlling root growth and architecture in Arabidopsis thaliana confirmed by heterogeneous inbred family. Theor Appl Genet. 2005;110(4):742–753.Google Scholar
  42. 42.
    Jaganathan D, Thudi M, Kale S, Azam S, Roorkiwal M, Gaur PM, et al. Genotyping-by-sequencing based intra-specific genetic map refines a “QTL – hotspo” region for drought tolerance in chickpea. Mol Gen Genomics. 2015;290(2):559–571.Google Scholar
  43. 43.
     Liu H, Bayer M, Druka A, Russell JR, Hackett CA, Poland J, et al. An evaluation of genotyping by sequencing (GBS) to map the Breviaristatum-e (ari-e) locus in cultivated barley. BMC Genomics. 2014;15(1):1–11.Google Scholar
  44. 44.
    Sakamoto T, Deguchi M, Brustolini OJ, Santos AA, Silva FF, Fontes EP. The tomato RLK superfamily: phylogeny and functional predictions about the role of the LRRII-RLK subfamily in antiviral defense. BMC Plant Biol. 2012;12(1):229.Google Scholar
  45. 45.
    Chen L, Hellmann H. Plant E3 ligases: flexible enzymes in a sessile world. Mol Plant. 2013;6(5):1388–1404Google Scholar
  46. 46.
     Wiborg J, O´Shea C, Skriver K. Biochemical function of typical and variant Arabidopsis thaliana U-box E3 ubiquitin-protein ligases. Biochem J. 2008;413(3):447–457.Google Scholar
  47. 47.
    Andersen P, Kragelund BB, Olsen AN, Larsen FH, Chua NH, Poulsen FM, et al. Structure and biochemical function of a prototypical Arabidopsis U-box domain. J Biol Chem. 2004;279(38):40053–40061.Google Scholar
  48. 48.
    Azevedo C, Santos-Rosa MJ, Shirasu K. The U-box protein family in plants. Trends Plant Sci. 2001;6(8):354–358.Google Scholar
  49. 49.
    Aravind L, Koonin EV. The U box is a modified RING finger - a common domain in ubiquitination. Curr Biol. 2000;10(4):R132–R134.Google Scholar
  50. 50.
    Stone SL. The role of ubiquitin and the 26S proteasome in plant abiotic stress signaling. Front Plant Sci. 2014;5(5):135.Google Scholar
  51. 51.
    Lyzenga WJ, Stone SL. Abiotic stress tolerance mediated by protein ubiquitination. J Exp Bot. 2012;63(2):599–616.Google Scholar
  52. 52.
    Duplan V, Rivas S. E3 ubiquitin-ligases and their target proteins during the regulation of plant innate immunity. Front Plant Sci. 2014;5(3):42.Google Scholar
  53. 53.
    Yee D, Goring DR. The diversity of plant U-box E3 ubiquitin ligases: from upstream activators to downstream target substrates. J Exp Bot. 2009;60(4):1109–1121.Google Scholar
  54. 54.
     Kujur A, Bajaj D, Saxena MS, Tripathi S, Upadhyaya HD, Gowda CL, et al. Functionally relevant microsatellite markers from chickpea transcription factor genes for efficient genotyping applications and trait association mapping. DNA Res. 2013;20(4):355–374.Google Scholar
  55. 55.
    Kujur A, Bajaj D, Saxena MS, Tripathi S, Upadhyaya HD, Gowda CLL, et al. An efficient and cost-effective approach for genic microsatellite marker-based large-scale trait association mapping: identification of candidate genes for seed weight in chickpea. Mol Breed. 2014;34(1):241–265.Google Scholar
  56. 56.
    Doyle J. Isolation of plant DNA from fresh tissue. Focus. 1990;12:13–15.Google Scholar
  57. 57.
     Velikkakam JG, Vipul P, Nordström Karl JV, Klasen JR, Salomé PA, Detlef W, Korbinian S. User guide for mapping-by-sequencing inArabidopsis. Genome Biol. 2013;14(6):R61.Google Scholar
  58. 58.
    Li H, Durbin R. Fast and accurate short read alignment with burrows–wheeler transform. Oxford University Press. 2009, 25(14):1754–1760.Google Scholar
  59. 59.
    Li H, Durbin R. Fast and accurate long-read alignment with burrows–wheeler transform. Bioinformatics. 2010, 25(5):1754–1760.Google Scholar
  60. 60.
    Panaud O, Chen X, Mccouch S R. Development of microsatellite markers and characterization of simple sequence length polymorphism (SSLP) in rice (Oryza sativa L.). Mol Gen Genet, 1996, 252(5):597-607Google Scholar
  61. 61.
    Van Ooijen J: JoinMap® 4, Software for the calculation of genetic linkage maps in experimental populations. Kyazma BV, Wageningen 2006, 33:10.1371.Google Scholar
  62. 62.
    Voorrips RE. MapChart: software for the graphical presentation of linkage maps and QTLs. J Hered. 2002;93(1):77–78.Google Scholar
  63. 63.
    Li H, Ye G, Wang J. A Modified Algorithm for the improvement of composite interval mapping. Genetics. 2007;175(1):361–374.Google Scholar
  64. 64.
    Li H, Ribaut JM, Li Z, Wang J. Inclusive composite interval mapping (ICIM) for digenic epistasis of quantitative traits in biparental populations. Theor Appl Genet. 2008;116(2):243–260.Google Scholar
  65. 65.
    Panaud O, Chen X, Mccouch S R. Development of microsatellite markers and characterization of simple sequence length polymorphism (SSLP) in rice (Oryza sativa L.). Mol Gen Genet, 1996;252(5):597–607.Google Scholar

Copyright information

© The Author(s). 2018

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors and Affiliations

  1. 1.Soybean Research Institute, National Center for Soybean Improvement, Key Laboratory of Biology and Genetic Improvement of Soybean (General, Ministry of Agriculture), State Key Laboratory of Crop Genetics and Germplasm Enhancement, Jiangsu Collaborative Innovation Center for Modern Crop Production Nanjing Agricultural University, Nanjing 210095, ChinaNanjing Agricultural UniversityNanjingChina

Personalised recommendations