Abstract
An accurate molecular weight (M r) assignment for a double-strand (ds) DNA determines or greatly restricts the possible number of each of its four bases, while the compositions for its two single-strand (ss) components can also be derived from their M r values. For a ds 64-mer (39 kDa), the ss-M r values (±0.5 Da) of its high-resolution mass spectrum from an electrospray ionization/Fourier transform instrument yield only the correct ds- and ss-base compositions. Literature mass spectra of lower mass accuracy show that such data can also restrict their possible composition assignments, with further discrimination using the abundance vs. base composition of small fragment ions from the dissociation of the ss molecular ions.
Article PDF
References
McLuckey S. A.; Habibi-Goudarzi S. J. Am. Chem. Soc. 1993, 115, 12085–12095.
Pomerantz S. C.; Kowalak J. A.; McCloskey J. A. J. Am. Soc. Mass Spectrom. 1993, 4, 204–209.
Light-Wahl K. J.; Springer D. L.; Winger B. E.; Edmonds C. G.; Camp D. G., II; Thrall B. D.; Smith R. D. J. Am. Chem. Soc. 1993, 115, 803–804.
Ganem B.; Li Y.-T.; Henion J. D. Tetrahedron Lett. 1993, 34, 1445–1448.
Potier N.; Van Dorsselaer A.; Cordier Y.; Roch O.; Bischoff R. Nucleic Acids Res. 1994, 22, 3895–3903.
Gale D. C.; Goodlett D. R.; Light-Wahl K. J.; Smith R. D. J. Am. Chem. Soc. 1994, 116, 6027–6028.
Doktycz M. J.; Habibi-Goudarzi S.; McLuckey S. A. Anal. Chem. 1994, 66, 3416–3422.
Ding J.; Anderegg R. J. J. Am. Soc. Mass Spectrom. 1995, 6 159–164.
Doktycz M. J.; Hurst G. B.; Habibi-Goudarzi S.; McLuckey S. A.; Tang K.; Chen C. H.; Uzeil M.; Jacobson K. B.; Woychik R. P.; Buchanan M. V. Anal. Biochem. 1995, 230, 205–214.
Naito Y.; Ishikawa K.; Koga Y.; Tsuneyoshi T.; Terunuma H.; Arakawa R. Rapid Commun. Mass Spectrom. 1995, 9, 1484–1486.
Wunschel D. S.; Fox K. F.; Fox A.; Bruce J. E.; Muddiman D. C.; Smith R. D. Rapid Commun. Mass Spectrom. 1996, 10, 29–35.
Little D. P.; Chorush R. A.; Speir J. P.; Senko M. W.; Kelleher N. L.; McLafferty F. W. J. Am. Chem. Soc. 1994, 116, 4893–4897.
Chen R.; Cheng X.; Mitchell D. W.; Hofstadler S. A.; Wu Q.; Rockwood A. L.; Sherman M. G.; Smith R. D. Anal. Chem. 1995, 67, 1159–1163.
Little D. P.; McLafferty F. W. J. Am. Chem. Soc. 1995, 117, 6783–6784.
Little D. P.; Aaserud D. J.; Valaskovic G. A.; McLafferty F. W. J. Am. Chem. Soc. 1996, 118, 9352–9359.
Little D. P.; Thannhauser T. W.; McLafferty F. W. Proc. Natl. Acad. Sci. USA 1995, 92, 2318–2322.
Beu S. C.; Senko M. W.; Quinn J. P.; Wampler F. M. III; McLafferty F. W. J. Am. Soc. Mass Spectrom. 1993, 4, 557–565.
McLafferty F. W. Acc. Chem. Res. 1994, 27, 379–386.
Clegg G. A.; Dole M. Biopolymers 1971, 10, 821–826.
Fenn J. B.; Mann M.; Meng C. K.; Wong S. F.; Whitehouse C. M. Science 1989, 246, 64–71.
Marshall A. G.; Comisarow M. B. Chem. Phys. Lett. 1974, 25, 282–283.
Marshall A. G.; Grosshans P. B. Anal. Chem. 1991, 63, 215A-229A.
Wood T. D.; Chen L. H.; Kelleher N. L.; Little D. P.; Kenyon G. L.; McLafferty F. W. Biochemistry 1995, 34, 16251–16254.
Kelleher N. L.; Costello C. A.; Begley T. P.; McLafferty F. W. J. Am. Soc. Mass Spectrom. 1995, 6, 981–984.
Speir J. P.; Senko M. W.; Little D. P.; Loo J. A.; McLafferty F. W. J. Mass Spectrom. 1995, 30, 39–42.
The 64-mer CTGGCACGACAGGTITCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAG (ss1) and its complement synthesized by the Cornell Peptide/DNA Synthesis Facility were annealed in aqueous 5 mM piperidine solution at 95 °C for 5 min, slowly cooled to 25 °C, and diluted to 5 µM in 3:l CH3CN:H2O (2.5 mM in piperidine) [18]. This solution was introduced at 1 µL/min into a previously described 6 T ESI/FIMS system [11], with noncovalent ion adducts minimized by 20 ms of infrared photodissociation (25 W Synrad CO2 laser, 35% duty cycle) [19].
Greig M.; Griffey R. H. Rapid Commun. Mass Spectrom. 1995, 9, 97–102.
Little D. P.; McLafferty F. W. J. Am. Soc. Mass Spectrom. 1996, 7, 209–210.
Here, M r is the mass of the most abundant isolopic peak, which differs by <20 ppm from the M r value based on natural isotopic abundances. Variations in the latter affect only the abundance, not the mass, of an isotopic peak [11]. The number of 13C atoms, n, in the most abundant isotopic peak is given in italics following the mass value; M r0 = M r − n(1.0034).
Senko M. W.; Beu S. C.; McLafferty F. W. J. Am. Soc. Mass Spectrom. 1995, 6, 229–233.
Zubarev R. A.; Bondarenko P. V. Rapid Commun. Mass Spectrom. 1991, 5, 276–277.
Author information
Authors and Affiliations
Rights and permissions
About this article
Cite this article
Aaserud, D.J., Kelleher, N.L., Little, D.P. et al. Accurate base composition of double-strand DNA by mass spectrometry. J Am Soc Mass Spectrom 7, 1266–1269 (1996). https://doi.org/10.1016/S1044-0305(96)00194-8
Revised:
Accepted:
Issue Date:
DOI: https://doi.org/10.1016/S1044-0305(96)00194-8