Wasabi (Eutrema japonicum; family: Brassicaceae) is native to Japan, South Korea, and Sakhalin, Russia, and its cultivation is limited because of its specific growth requirements (Nam et al. 2022). Due to unique growth factors and spicy taste, wasabi is distributed expensively as a high value-added product (Miles et al. 2019). Three wasabi plants exhibiting necrosis and yellow circular spots, suggestive of a viral infection, were collected from a greenhouse in Cheorwon, Gangwon-do, Korea. Virus detection by ELISA using a tomato spotted wilt virus (TSWV, genus Orthotospovirus, family Tospoviridae) PathoScreen Kit (Agdia, USA) was positive in all three plants. To confirm the presence of TSWV, RT-PCR was performed using specific primers (TSWV CPfull F2- GCTGCTTTCAAGCAAGTTCTG and TSWV CPfull R2 – CGATCATCATGTCTAAGGT, 792 bp) that amplified more that the entire coat protein (CP) gene. TSWV was detected in all three leaves and PCR amplicons were sequenced (expected size: 792 bp). A blast nucleotide search found 99.7% identity between the TSWV CP sequence from isolate wasabi (TSWV-WGK, GenBank accession number LC733376) and TSWV isolates from chicory (MG593199, Cichorium intybus, USA), eggplant (OM154966, Solanum melongena, China), soybean (MZ736677, Glycine max, South Korea), and plantain (MT951396, Plantago asiatica, South Korea). Spherical virus particles of 50 nm were observed in three sampled leaves by transmission electron microscopy using negative staining. A sap transmission test using Nicotiana benthamiana as an indicator species demonstrated that TSWV-WGK caused leaf curling and atrophy symptoms typical of TSWV in systemic leaves at 14 days after inoculation. TSWV has a wide host range including 1,090 algae, mono- and dicotyledons, and causes annual crop losses of $1 billion worldwide (Kabaş et al. 2021). To our knowledge, this is the first report on TSWV infecting wasabi in Korea.