Monocyte Modulation by Liposomal Alendronate Improves Cardiac Healing in a Rat Model of Myocardial Infarction

Abstract

The ischemic injury in acute myocardial infarction (AMI) activates the innate immunity response in two consecutive phases. Classical monocytes (CM) accumulate in the inflammatory phase (first 3 days), and non-classical monocytes (NCM) accumulate in the reparatory phase (4–7 days). We hypothesized that inhibition of monocytes at the second phase post-AMI will lead to better healing by reducing myocardial damage and consequently improve heart function. We examined the effect of monocyte modulation on cardiac healing following MI injury in rats by nano-sized alendronate liposomes (LipAln) treatment. Rats were treated with intravenous (IV) LipAln, on days 5, 7, and 9 after ligation of the left anterior descending artery (LAD). Circulating monocyte levels were reduced after the first LipAln injection, and two peripheral blood monocyte subsets, CM and NCM, were sequentially mobilized after MI. Two weeks after MI, a reduction in infarct size was observed and cardiac function was improved in LipAln-treated rats (fractional shortening of 32.2% ± 1.9% and 26.0% ± 1.3%, for LipAln and saline treated rats, respectively, p < 0.05). This improvement was further corroborated by increased cardiac anti-inflammatory cytokine expression and reduced levels of pro-inflammatory cytokines. In conclusion, LipAln treatment during the second phase after MI improves cardiac healing.

Lay Abstract

Myocardial infarction (MI) occurs when coronary blood flow decreases, causing damage to the heart muscle. Consequently, the body sends cells called monocytes/macrophages as part of a reparatory-inflammatory response. We hypothesized that altering a specific step in the inflammatory process, which the heart utilizes to heal itself, could result in improved heart function. Using a unique drug delivery system of nano-sized particles called liposomes, in which a molecule (bisphosphonate) that is toxic to monocytes is embedded, we successfully altered the inflammatory process, in a rat model of MI. resulting in improved heart function.

The novel technology reported in this issue celebrating Robert Langer’s birthday is directly linked to my previous work with Bob. As Bob’s postdoc at MIT (1984–1986), our group developed heart valve anti-calcification implantable drug delivery systems, which contain a bisphosphonate. His guidance and mentorship then, and to this day, are of great importance. I am forever grateful for his continued contribution.

Graphical Abstract

Introduction

Acute myocardial infarction (AMI) and heart failure are associated with high morbidity and mortality. Since the adult mammalian heart has negligible regenerative capacity, the infarcted myocardium heals through formation of a collagen scar replacing damaged cardiomyocytes [1, 2]. The loss of viable cardiomyocytes and the formation of a non-shrinkable collagen scar trigger ventricular remodeling characterized by thinning of the infarct wall and dilatation of the ventricle. Therapy aims to prevent cardiac cell death by fast restoration of blood flow to the infarcted area and maintaining cardiac function.

The innate immune system plays a central role in the inflammatory cascade and healing process following myocardial injury [3,4,5]. It has been reported that increased levels of peripheral monocyte counts are associated with extended infarction size and high mortality from MI [6,7,8]. Thus, treatment targeting the innate immunity response may provide important therapeutic strategies to reduce myocardial damage and thus consequently improve cardiac function. Nahrendorf et al. [9, 10] have demonstrated that the myocardium selectively recruits blood monocytes in a biphasic manner following MI. Classical monocytes (CM) dominate the early inflammatory phase (1–4 days following MI), and non-classical monocytes (NCM) govern the late phase in which resolution of inflammation occurs.

Liposomes containing bisphosphonates (such as clodronate and alendronate; LipBPs) deplete circulating monocytes (partially and transiently) and reduce neointimal hyperplasia in animal models of vascular injury [11,12,13,14,15,16]. BPs are a class of drugs, with poor membrane permeability, widely prescribed to treat osteoporosis and other bone-related diseases [17]. The mechanism of action of BPs on osteoclasts, the major cell type responsible for bone resorption, is intracellular following phagocytosis of bone-adsorbed BPs [18]. Inhibition of monocytes and macrophages, which are derived from the same bone marrow progenitor cells as osteoclasts, is accomplished by a particulate delivery system containing a BP (polymeric- and lipoid-based nanoparticles [11,12,13,14, 16, 19,20,21,22]. Charged and not ultra-small liposomes encapsulating BPs have enhanced intracellular internalization of the drugs in circulating monocytes and macrophages. Liposomal alendronate (LipAln) treatment has been shown to transiently modulate circulating monocytes, reducing accumulation of these cells at vascular injury sites and around stent struts, resulting in the therapy of restenosis in animal models of vascular injury (in clinical trials [23, 24]). The unique monocyte-targeting mechanism of action completely spares endothelial cells (EC), and smooth muscle cells (SMC), allowing normal tissue repair with no side effects [13]. Depletion of monocytes during the early phase following MI has been shown to impair cardiac repair following MI [25]. We hypothesized that modulation of monocytes in the second reparatory phase would result in resolution of the inflammatory response. We demonstrate here that LipAln treatment, 5–9 days after MI, results in improved heart functions accompanied by increased cardiac anti-inflammatory cytokines expression.

Materials and Methods

Liposome Preparation and Characterization

LipAln was prepared by the ethanol injection method [12, 21, 22] with 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC, Lipoid, Ludwigshafen, Germany), the negatively charged lipid, distearoyl-phosphatidylglycerol (DSPG, Lipoid), and cholesterol (Sigma-Aldrich). ALN was dissolved in double-distilled water at a concentration of 200 mM, and the pH of the solution was adjusted to 7.2 by 1 N NaOH at 70 °C for 5 min. Lipids (DSPC/DSPG/cholesterol, molar ratio 3:2:1) were dissolved in 16 ml t-butanol/EtOH/H2O (48/48/4) at 70 °C for 5 min, and the lipid solution was injected directly into Aln solution at 70 °C under mixing. The liposome suspension was extruded (thermobarrel extruder; Northern Lipids Inc., Vancouver, Canada) three times through double polycarbonate membranes of 0.4- and 0.2-μm pore sizes, and six additional times through a 0.1-μm filter (Nucleopore, CA, USA). The vesicles were dia-filtered against 5 volumes of PBS buffer to remove residual solvent and un-encapsulated drug (A/G Technology’s, Quiqstand Benchtop Ultrafiltration system) with a sampler hollow fiber ultrafiltration cartridge (0.5-mm lumen diameter, 30,000 MWCO). Formulations were filter-sterilized (Minisart 0.22 μm, Sartorius) and were stored at 4 °C until use.

Lipids and drug content of the liposomes were determined by HPLC as described previously [22, 26], and liposome size and ζ-potential were determined by dynamic light scattering at room temperature following 1:100 dilution with PBS (Zetasizer Nano-ZSP, Malvern Instruments, UK).

Rat MI Model and Treatment

Sprague-Dawley male rats weighing 300 ± 30 g were used in the study. Animals were fed with standard laboratory chow and tap water ad libitum. Animal care and procedures conformed to the standards for care and use of laboratory animals of the Hebrew University of Jerusalem and the National Institutes of Health (NIH, USA).

Study Design

This two-arms study included intact, untreated rats (n = 6), rats treated with LipAln (n = 66), and rats treated with saline (control, n = 68; Fig. 1). In the first arm, 80 rats underwent baseline echocardiographic assessment and were then divided into two groups: LAD ligation (MI) and Sham operation (n = 40 in each group). Rats of each group were randomly assigned to treatments by LipAln and saline after validation of cardiac damage by a second echocardiography measurement. Rats were treated after MI or sham procedures by IV injections (tail vein) of 1.5 mg/kg LipAln or saline at 5, 7, and 9 days after surgery. Blood was drawn for FACS analysis (monocyte subsets) at designated time points, and heart function and infarct size were measured (see below). In the second arm of the study, the MI model and treatments were the same as in the first arm. A subset of animals was sacrificed at baseline (intact), and at 3, 6, 8, and 14 days post-operation (n = 6–8, saline and LipAln, at each time point). The harvested heart of each animal was dissected to ischemic and remote zones (Fig. 1b), and RNA was extracted from the sections. mRNA levels of IL-10, IL-1β, CX3CL1, and IL-6 were analyzed by means of real-time PCR.

Fig. 1
figure1

The study design is shown in a cardiac function measurements by means of echocardiography, and flow cytometry analysis of monocyte and their pro- and anti-inflammatory subsets were performed 7 days before LAD ligation (MI model), and at the specified time points. Validation of cardiac damage was performed 2 days after MI by echocardiography, followed by FACS analysis on day 5 (immediately prior to treatment). The animals were randomly assigned to treatment type of LipAln (1.5 mg/kg BW) or saline, injected IV (tail vein) 5, 7, and 9 days after MI. b Illustration of LV ischemic and remote zones deviation. Cytokines expression was analyzed in the ischemic and remote zones of the LV by means of real-time PCR (mRNA). A separate group of rats was sacrificed at baseline (intact) and 3, 6, 8, and 14 days after MI for histomorphometric and cytokines analyses. See in the “Materials and Methods” section for other arms of the study

Surgical Procedures

Rats were anesthetized with 10% ketamine-2% xylazine (0.85:0.15, 1 ml/kg IP), intubated, and mechanically ventilated with a small animal respirator (Harvard Apparatus respirator, MA, USA). The chest was opened by left thoracotomy, the pericardium was opened, and the LAD artery was permanently ligated using 6-0 silk suture. Coronary occlusion was verified by visual inspection. The chest was closed in layers with uninterrupted sutures. Rats were extubated and lost body fluids were replaced by subcutaneous administration of 5 ml of saline. The sham-operated rats underwent the same procedure excluding LAD occlusion. Four out of 40 rats (10%) in the MI group died within the first 24 h after MI procedure, while all sham-operated rats survived the procedure.

Echocardiography

Heart function was measured by means of echocardiography by operators blinded to the treatment groups and to the type of surgery (MI or sham). Echocardiographic imaging was performed using a GE Vivid 3 platform equipped with a 13-Mhz liner epi-aortic transducer (General Electric, USA). The probe was positioned in a left parasternal position, and two-dimensional imaging of the heart in the short axis was obtained using a high frame rate. This image was used to guide an M-mode cursor down the medial axes of the LV. Measurements were performed in triplicate using the leading-edge convention for myocardial borders. Three consecutive measurements of LV end-diastolic diameter (LVEDD) and LV end-systolic diameter (LVESD) were measured and averaged, and the fractional shortening (FS) was calculated as: %FS = 100 × (LVEDD-LVESD)/LVEDD. Similarly, using B-Mode acquisitions, three repeated measurements of the LV area at the papillary muscles level at the end of diastole and at the end of systole were measured, averaged, and used to calculate the Fractional Area Change (%FAC) using the equation: %FAC = 100 × (LVAd-LVAs)/LVAd (where LVAd denotes left ventricle area at diastole and LVAs denotes left ventricle area at systole) [27]. All Images were acquired with heart rates at 250–350 beats/min.

Infarct Size

Infarct size was determined by means of the Masson’s trichrome (MTC) staining, which stains collagen in blue and myocardial cells in red. Cross sections (paraffin embedded, 5 μm thick) of the left ventricle were used for MTC staining according to the standard protocol (Sigma-Aldrich). Pictures of stained slides were taken, and the myocardial infarction size was calculated as the minimal width of infracted area (cm, blue stain)/total LV area (cm2), using NIH ImageJ software.

Blood Monocytes and Monocyte Subsets

Blood specimens were drawn from the retro orbital sinus by a capillary tube under isoflurane anesthesia and placed in a tube with heparin (BD, Bioscience). One hundred fifty microliters of heparinized blood was used for white bleed cell (WBC) count by means of coulter-counter (BD) in the central laboratories of Hadassah Hospital. Fifty microliters of heparinized blood was used for FACS analysis: The blood was incubated with red blood lysing solution (Erythrolyse, 1:20 dilution, AbD Serotec, UK) for 10 min at room temperature. After washing, the cells were suspended in 1 ml FACS medium (PBS, 1% BSA, 0.02% sodium azide, 0.1% saponin), centrifuged (8000 g for 1 min), and incubated (30 min) in a solution containing Alexa Fluor 647-conjugated anti-ED1, and FITC-conjugated anti-CD43 (AbD Serotec, Oxford, UK). Respective isotype-matched negative controls were used (mouse IgG1 alexa fluor 647 (for ED1) and mouse IgG1 FITC (for CD43)). Total monocytes were classified as ED1high, and their subsets as ED1highCD43high (NCM), and ED1highCD43low (CM).

Data were acquired on an LSRII (BD Biosciences) and analyzed with FCS Express V3 software package. The percentage of monocytes (ED1high) and their subsets (CD43high and CD43low) in total WBC (all viable cells) was calculated. Monocyte concentration was calculated by multiplying the percentage of cells in the absolute number of WBC measured by means of a coulter-counter.

Cytokines Analysis

The left ventricle of the rat’s heart was divided to ischemic and remote zones as illustrated in Fig. 1b. Total RNA and total proteins were extracted from the hearts, and the expression of selected pro- and anti-inflammatory cytokines was analyzed by means of real-time PCR and ELISA.

For quantitative real-time PCR, total RNA was extracted from the ischemic and remote zones of the left ventricle using the guanidium-thiocyanate phenol-chloroform extraction method with Tri® reagent (T-9424, Sigma). First-strand cDNAs were synthesized from 1 μg of RNA using M-MLV reverse transcriptase (# M1701, Promega, WI, USA) and random primers (#C1181, Promega, WI, USA). Real-time PCRs were performed with an ABI prism 7900 (Applied Biosystems, USA). The following primer sets were used: IL-10 forward, 5′ GTTGCCAAGCCTTGTCAGAAA 3′, and reverse, 5′ TTTCTGGGCCATGGTTCTCT 3′; IL-6 forward, 5′ TCCTACCCAACTTCCAATGCTC 3′, and reverse, 5′ TTGGATGGTCTTGGTCCTTAGCC 3′; IL-1β forward, 5′ CACCTCTCAAGCAGAGCACAG 3′, and reverse, 5′ GGGTTCCATGGTGAAGTCAAC 3′; CX3Cl1 (FKN) forward, 5′ AGGAGAAATGGGTCCAAGAC 3′, and reverse, 5′ CGAGGTGATCCTAGGTGTCA 3′; and GAPDH forward, 5′ TCCTGCACCAACTGCTTAG 3′, and reverse, 5′ CAGATCCACAACGGATACATTGG 3′. Primers were designed according to GenBank accession numbers and published sequences using Primer Express software (PE Applied Biosystems). All primers were BLAST to verify target specificity. PCR reaction mixture was prepared using Power SYBR® green PCR master mix (AB Applied Biosystems, USA), cDNA, and primers. Each sample was measured in triplicate. After an initial denaturation step at 95 °C for 10 min, the cDNA products were amplified for 40 cycles, consisting of denaturation at 95 °C for 15 s and a single step of annealing and extension at 60 °C for 1 min.

Statistical Analysis

The results are expressed as mean ± SEM. Comparisons among treatment groups were made by two-way analysis of variance (ANOVA) followed by Tukey test, and unpaired two-tailed test when necessary. Differences were termed statistically significant at p < 0.05.

Results

Liposome Formulation

Spherical, mainly unilamellar liposomes were obtained, having a mean diameter of 85 ± 20 nm, with a zeta potential of − 31.5 ± 1.2 mV, Aln and lipid concentration of 5.2 ± 0.34 and 32.9 ± 1.7 mg/ml, respectively, and an encapsulation yield of 20 ± 3.5%.

Heart Function

Reduced FS was observed in the MI group 2 days after surgery compared to baseline (intact) (31.0% ± 1.7 and 41.2% ± 0.6, respectively, p < 0.05, Fig. 2b) but not in the sham-injured group (37.6% ± 1.1 and 41.2% ± 0.6, respectively, data not shown). As expected, heart function further deteriorated 14 days after MI in the saline-treated rats (26.0% ± 1.3; Fig. 2b). In contrast, FS in the LipAln-treated rats after 14 days was found similar to the FS of untreated animals 2 days post-MI (32.2% ± 1.9 and 31.0 ± 1.7, respectively). Moreover, FAC, 14 days after MI, was found higher in LipAln-treated rats in comparison to the saline group (55.1% ± 3.5 and 39.5% ± 2.9, LipAln and saline treatment, respectively; Fig. 2d). Hypertrophy of the left ventricle (heart to body weight ratio) at 14 days after surgery was similar in LipAln and saline-treated rats (data not shown).

Fig. 2
figure2

LipAln treatment resulted in improved heart function following MI. a Representative images of m-mode echocardiography of intact (before MI) vs. saline-treated rats 14 days after MI. b Bar graph representing fractional shortening (%) of intact rats (before MI), and 2 and 14 days after MI. Treatments (saline or LipAln) were injected IV 5, 7, and 9 days after MI (see Fig. 1 and in the “Materials and Methods” section). c Representative image of the Fractional Area Change (% FAC) measurement of saline-treated rat 14 days post-MI. d Bar graph representing FAC 14 days after MI. Data is presented as the mean ± SEM. *p < 0.05 in comparison to saline treatment

Infarct Size

In accord with the improved heart function observed by the echo measurements (Fig. 2), infarct size was significantly reduced following LipAln treatment 14 days after MI in comparison to the saline-treated group (2.17 ± 0.17 and 2.75 ± 1.7 mm−1, respectively; Fig. 3). Infarct size was evaluated by measuring the minimal width of ischemic zone and normalizing it to left ventricle area. Width measurements were shown to correlate well with cardiac function in similar models. Measurements of infract area were associated with large blinded inter-observer variations and reported before to correlate poorly with post-treatment cardiac function in similar models [25, 28,29,30].

Fig. 3
figure3

LipAln treatment reduces infarct size 14 days after MI. Representative morphometric analysis of left ventricles sections is shown in the photomicrographs, following treatment with saline (left) and LipAln (right). Black arrow points to the infarcted area zone. Collagen is stained in blue, and viable muscle area in pink-red. Masson-trichrome (MTC) staining; n = 12–18 per treatment group; mean ± SEM; *p < 0.05

Circulating Monocytes

Circulating monocyte levels were significantly elevated 5 days after MI to 132 ± 10.5% (Fig. 4). Monocyte levels in saline-treated rats following MI remained high for 9 days returning to baseline levels after 12 days. One day after the first injection of LipAln, circulating monocyte levels were significantly reduced from 177.0 ± 20.0 to 115.0 ± 9.3% (Fig. 4). Monocyte levels were significantly elevated following injections on days 7 and 9 after MI, between 190 ± 25 to 278 ± 45%, days 7 to 14, in comparison to saline-treated animals (111 ± 18–206 ± 14%). No significant differences in monocytes levels were observed between LipAln and saline-treated rats after sham operation (data not shown).

Fig. 4
figure4

LipAln treatment modulates circulating monocyte levels after MI. LipAln or saline were injected IV at 5, 7, and 9 days (arrows) after MI (day 0). Circulating monocyte levels (%ED1high positive) were measured by flow cytometry, and normalized to total WBC count (coulter counter). Monocyte levels depicted in the graph were normalized to untreated rats levels. Data is presented as the mean ± SEM; *p < 0.05 in comparison to saline-treated animals (n = 4–7 at each time point)

The ratio between NCM and CM after MI is presented in the Online Resource, Fig. S1. During the first 5 days after MI, CM subsets were elevated, and consequently, NCM/CM ratio was reduced in both groups. One day after the second injection (day 8 after MI), NCM/CM ratio was reduced in the LipAln-injected group compared to the saline-injected group. No other differences in circulating monocyte subsets ratio were observed between the treatment groups.

Cytokine Expression

Pro-inflammatory cytokines (IL-6, CX3CL1, and IL-1β), and the anti-inflammatory cytokine (IL-10) expression levels, in the ischemic area of the heart, were significantly elevated in response to myocardial infarction (Fig. 5). LipAln treatment resulted in a significantly reduced levels of pro-inflammatory cytokines as well as elevated anti-inflammatory cytokine levels in the ischemic zone of the heart, 14 days after MI (Fig. 5 and see Online Resource, Fig. S2B). Pro- and anti-inflammatory cytokine expression in the remote area of the heart was unaffected by MI or by the treatments (Online Resource, Fig. S2A).

Fig. 5
figure5

LipAln treatment modulates cardiac cytokine expression after MI. Cytokine expression was analyzed in the ischemic zone of the left ventricle by means of real-time PCR (mRNA) in sacrificed rats at baseline (intact), and 3, 6, 8, and 14 days after MI. mRNA expression was analyzed in triplicate and normalized to GAPDH and untreated levels of expression. a IL-10, b IL-1β, c CX3CL1, and d IL-6. Data is presented as the mean ± SEM. *p < 0.05 in comparison to saline-treated rats

Discussion

We demonstrate here that modulation of monocyte levels by LipAln treatment, 5–9 days after MI, results in reduced infract size and improved heart function, and is accompanied by increased anti-inflammatory and reduced pro-inflammatory cytokines expression in the ischemic cardiac zone.

MI triggers mobilization of monocytes from the spleen and progenitor cells from the bone marrow to the ischemic tissue [4, 31, 32]. Recent research assigned monocytes into functionally distinguished subclasses demonstrating considerable heterogeneity with respect to their phenotype and function [33,34,35]. Three subpopulations of monocytes have been identified in humans as (i) classical (CM; CD14++CD16); (ii) intermediate (IM; CD14++ CD16+); and (iii) non-classical monocytes (NCM; CD14++CD16++). Murine monocyte subtypes are characterized by the differential expression of Ly-6C: Ly-6Chigh (CM), Ly-6Cint (IM), and Ly-6Clow (NCM). In rats, used in the current study, two monocyte subsets have been described based on CD43 expression, CD43high monocyte (NCM), and CD43low monocytes (CM) [15, 33, 34, 36]. Monocytes infiltrate the injured myocardium in two consecutive phases [9, 10]: classical monocytes in the early inflammatory phase (0–4 days post-MI), removing necrotic and apoptotic neutrophils; and recruiting additional monocytes to the injured site amplifying the response. Non-classical monocytes in the second reparatory phase (5–9 days post-MI) contribute to inflammation resolution, scar formation by deposition of collagen, myofibroblast proliferation, and neovascularization. We previously demonstrated the two phases of monocyte migration identified in human and mice MI, in rats with vascular injury [15, 16]. We report here that the two peripheral blood monocyte subsets, ED1highCD43low (CM) and ED1highCD43high (NCM), are sequentially mobilized after MI in rats (Online Resource, Fig. S1).

That monocyte infiltration to the injured myocardium, during the early phase after MI, is critical for heart recovery and has been supported by the impaired heart function found following intervention of monocyte depletion during the first inflammatory phase in mice [25]. Thus, we hypothesized that modulation of monocytes in the second reparatory phase would result in resolution of the inflammatory response. Indeed, LipAln treatment during the reparatory phase (5, 7, and 9 days after MI) improved heart function and reduced the infract size following MI (Figs. 2 and 3, respectively). On the other hand, in a recent study by our group, LipAln treatment of carotid-injured rats was found effective in reducing stenosis only if treatment was during the first days after injury [15]. Nevertheless, the different pathophysiologies between the two models could account for the beneficial effect in both models of injury despite the different treatment timeframes. It should be noted that LipAln treatment immediately after MI, in the current study, was found ineffective (data not shown). The importance of intervention timing is further supported by the finding that macrophages injected immediately after MI to the infarcted myocardium of rats resulted in improved heart function [37]. Thus, timing of modulating circulating monocytes is critical for obtaining a therapeutic effect.

As expected, total monocyte levels in the circulation were reduced 24 h after the first LipAln injection (Fig. 4). The mechanism that leads to the observed elevation in circulating monocytes after the second and third LipAln injections (Fig. 4) is unclear. It was shown that the capacity of bone marrow to produce monocytes during acute myocardial infarction is insufficient to meet the increased demand and that the spleen is the main initial monocyte provider during the first 24 h after MI [31, 38]. In addition, the spleen provides monocytes continuously after MI to satisfy the high demand of the injured myocardium [38]. Therefore, it may be suggested that the elevation in circulating monocyte observed after the second and third LipAln injections is due to exaggerated splenic response to the reduced cardiac cytokines (Fig. 5) and/or monocyte levels after the first LipAln injection. Since the inhibitory effect of LipAln treatment on other phagocytic cells is possible, the resultant myocardial healing could be due to indirect effects following circulating monocyte inhibition.

A mechanistic explanation to the observed improved heart function and cardiac repair following LipAln treatment is provided by cytokines levels in the infarcted area. Cytokine levels were altered in favor of increased expression of the anti-inflammatory cytokine (IL-10) as well as reduced pro-inflammatory cytokine levels (IL-6, IL-1β, and CX3CL1; Fig. 5, and see Online Resource, Fig. S2B). It should be highlighted that the elevation in cytokine secretion after MI and the differences between the treatment groups were specific to the infracted area and were not detected in the remote zone (Online Resource, Fig. S2A). The phagocytic clearance of apoptotic cardiomyocytes and neutrophils by CM induces secretion of anti-inflammatory and pro-fibrotic cytokines, such as IL-10 and TGF-β, that suppress inflammation and promote tissue repair [5, 39]. It is suggested that the improved heart function 14 days after MI, observed in LipAln treated rats, resulted from the increased secretion of the anti-inflammatory cytokine (IL-10) and the reduced secretion of pro-inflammatory cytokines (IL-6, IL-1β, Cx3CL1; Fig. 5). IL-10 is a potent anti-inflammatory cytokine, released from macrophages during the second reparatory phase, and has a strong capacity to suppress pro-inflammation [40,41,42]. In addition, Jung et al. has recently demonstrated that infusion of IL-10 reduced inflammation and improved cardiac wound healing in MI mice model [43]. Similarly, decreased levels of IL-10 in the myocardium of mice after MI were indicative of ongoing inflammation, which ultimately resulted in decreased cardiac function [44].

Treatment with LipAln had no significant effects on the ratio between NCM and CM, 24 h after the first LipAln injection, and 12 and 14 days after MI (see Online Resource, Fig. S1). It is plausible to suggest that since the total level of monocytes was elevated in LipAln-treated rats (12 and 14 days after MI, the reparative phase; Fig. 4), the levels of NCM and CM were also increased. NCM levels have been associated with reparative and pro-angiogenic effects [9, 10, 45, 46]. In a mice model with depleted NCM, MI leads to higher mortality, adverse remodeling of the LV, and reduced cardiac function [47]. In contrast, MI patients who did not develop ventricular thrombus formations had higher circulating NCM, further suggesting a protective function of this subset [48]. In a recent study by our group, LipAln treatment in carotid-injured rats resulted in increased NCM levels and reduced stenosis [15]. The differences between the two injury models including pathophysiology and healing process (different traits of cardiomyocytes vs. smooth muscle cells, non-regenerative and proliferative, respectively) could explain the dissimilarities in NCM/CM ratio as well as the difference in the optimal timing for intervention.

Conclusions

Late administration of LipAln to rats after MI resulted in improved heart function and reduced infarct size. Circulating monocyte levels were reduced 24 h after the first injection and were elevated after the second and the third LipAln injections, with significant changes of blood NCM/CM ratio. The specific modulation of circulating monocyte during the second phase after MI (reparatory phase) contributed to improved recovery from myocardial infarction. Further mechanistic support to our hypothesis that cardiac repair can be affected by inflammation modulation was demonstrated by the increased and decreased cardiac anti- and pro-inflammatory cytokines expression, respectively. Our results are in accord with the critical role of monocyte subset synchronization in MI. Disproportionally prolonged, excessive magnitude, or an insufficiently suppressed inflammatory phase, can lead to improper healing of the heart. In contrast, excessive monocyte infiltration during the late phase after MI can interfere with inflammation resolution and reduce cardiac recovery post-MI. Thus, the timing of monocyte modulation is critical for obtaining a therapeutic effect.

References

  1. 1.

    Daskalopoulos EP, Hermans KC, Blankesteijn WM. Cardiac (myo)fibroblast: novel strategies for its targeting following myocardial infarction. Curr Pharm Des. 2014;20(12):1987–2002.

    Article  CAS  Google Scholar 

  2. 2.

    Frangogiannis NG. Pathophysiology of myocardial infarction. Compr Physiol. 2015;5(4):1841–75.

    Article  Google Scholar 

  3. 3.

    Frangogiannis NG. The inflammatory response in myocardial injury, repair, and remodelling. Nat Rev Cardiol. 2014;11:255–65.

    Article  CAS  Google Scholar 

  4. 4.

    Nahrendorf M, Swirski FK. Innate immune cells in ischaemic heart disease: does myocardial infarction beget myocardial infarction? Eur Heart J. 2016;37(11):868–72.

    Article  Google Scholar 

  5. 5.

    Prabhu SD, Frangogiannis NG. The biological basis for cardiac repair after myocardial infarction: from inflammation to fibrosis. Circ Res. 2016;119(1):91–112.

    Article  CAS  Google Scholar 

  6. 6.

    Maekawa Y, Anzai T, Yoshikawa T, Asakura Y, Takahashi T, Ishikawa S, et al. Prognostic significance of peripheral monocytosis after reperfused acute myocardial infarction:a possible role for left ventricular remodeling. J Am Coll Cardiol. 2002;39(2):241–6.

    Article  Google Scholar 

  7. 7.

    Tsujioka H, Imanishi T, Ikejima H, Kuroi A, Takarada S, Tanimoto T, et al. Impact of heterogeneity of human peripheral blood monocyte subsets on myocardial salvage in patients with primary acute myocardial infarction. J Am Coll Cardiol. 2009;54(2):130–8.

    Article  Google Scholar 

  8. 8.

    Ruparelia N, Godec J, Lee R, Chai JT, Dall'Armellina E, McAndrew D, et al. Acute myocardial infarction activates distinct inflammation and proliferation pathways in circulating monocytes, prior to recruitment, and identified through conserved transcriptional responses in mice and humans. Eur Heart J. 2015;36(29):1923–34.

    Article  CAS  Google Scholar 

  9. 9.

    Nahrendorf M, Swirski FK, Aikawa E, Stangenberg L, Wurdinger T, Figueiredo JL, et al. The healing myocardium sequentially mobilizes two monocyte subsets with divergent and complementary functions. J Exp Med. 2007;204(12):3037–47.

    Article  CAS  Google Scholar 

  10. 10.

    Nahrendorf M, Pittet MJ, Swirski FK. Monocytes: protagonists of infarct inflammation and repair after myocardial infarction. Circulation. 2010;121(22):2437–45.

    Article  Google Scholar 

  11. 11.

    Danenberg HD, Fishbein I, Gao J, Monkkonen J, Reich R, Gati I, et al. Macrophage depletion by clodronate-containing liposomes reduces neointimal formation after balloon injury in rats and rabbits. Circulation. 2002;106(5):599–605.

    Article  CAS  Google Scholar 

  12. 12.

    Danenberg HD, Golomb G, Groothuis A, Gao J, Epstein H, Swaminathan RV, et al. Liposomal alendronate inhibits systemic innate immunity and reduces in-stent neointimal hyperplasia in rabbits. Circulation. 2003;108(22):2798–804.

    Article  CAS  Google Scholar 

  13. 13.

    Epstein-Barash H, Gutman D, Markovsky E, Mishan-Eisenberg G, Koroukhov N, Szebeni J, et al. Physicochemical parameters affecting liposomal bisphosphonates bioactivity for restenosis therapy: internalization, cell inhibition, activation of cytokines and complement, and mechanism of cell death. J Control Release. 2010;146(2):182–95.

    Article  CAS  Google Scholar 

  14. 14.

    Gutman D, Golomb G. Liposomal alendronate for the treatment of restenosis. J Control Release. 2012;161(2):619–27.

    Article  CAS  Google Scholar 

  15. 15.

    Grad E, Zolotarevsky K, Danenberg HD, Nordling-David MM, Gutman D, Golomb G. The role of monocyte subpopulations in vascular injury following partial and transient depletion. Drug Deliv Transl Res. 2018;8(4):945–53.

    Article  CAS  Google Scholar 

  16. 16.

    Aizik G, Grad E, Golomb G. Monocyte-mediated drug delivery systems for the treatment of cardiovascular diseases. Drug Deliv Transl Res. 2018;8(4):868–82.

    Article  CAS  Google Scholar 

  17. 17.

    Eriksen EF, Díez-Pérez A, Boonen S. Update on long-term treatment with bisphosphonates for postmenopausal osteoporosis: a systematic review. Bone. 2014;58:126–35.

    Article  CAS  Google Scholar 

  18. 18.

    Rogers MJ, Crockett JC, Coxon FP, Monkkonen J. Biochemical and molecular mechanisms of action of bisphosphonates. Bone. 2011;49(1):34–41.

    Article  CAS  Google Scholar 

  19. 19.

    van Rooijen N, Sanders A, van den Berg TK. Apoptosis of macrophages induced by liposome-mediated intracellular delivery of clodronate and propamidine. J Immunol Method. 1996;193(1):93–9.

    Article  Google Scholar 

  20. 20.

    Danenberg HD, Fishbein I, Epstein H, Waltenberger J, Moerman E, Monkkonen J, et al. Systemic depletion of macrophages by liposomal bisphosphonates reduces neointimal formation following balloon-injury in the rat carotid artery. J Cardiovasc Pharmacol. 2003;42(5):671–9.

    Article  CAS  Google Scholar 

  21. 21.

    Epstein H, Berger V, Levi I, Eisenberg G, Koroukhov N, Gao J, et al. Nanosuspensions of alendronate with gallium or gadolinium attenuate neointimal hyperplasia in rats. J Control Release. 2007;117(3):322–32.

    Article  CAS  Google Scholar 

  22. 22.

    Epstein H, Gutman D, Cohen-Sela E, Haber E, Elmalak O, Koroukhov N, et al. Preparation of alendronate liposomes for enhanced stability and bioactivity: in vitro and in vivo characterization. AAPS J. 2008;10(4):505–15.

    Article  CAS  Google Scholar 

  23. 23.

    Banai S, Finkelstein A, Almagor Y, Assali A, Hasin Y, Rosenschein U, et al. Targeted anti-inflammatory systemic therapy for restenosis: the biorest liposomal alendronate with stenting sTudy (BLAST)-a double blind, randomized clinical trial. Am Heart J. 2013;165(2):234–40 e1.

    Article  CAS  Google Scholar 

  24. 24.

    ClinicalTrials.gov. Phase IIb liposomal alendronate study (blade). 2018. https://clinicaltrials.gov/ct2/show/NCT02645799. Accessed Jan 2019.

  25. 25.

    van Amerongen MJ, Harmsen MC, van Rooijen N, Petersen AH, van Luyn MJ. Macrophage depletion impairs wound healing and increases left ventricular remodeling after myocardial injury in mice. Am J Pathol. 2007;170(3):818–29.

    Article  CAS  Google Scholar 

  26. 26.

    Lang JK. Quantitative determination of cholesterol in liposome drug products and raw materials by high-performance liquid chromatography. J Chromatogr. 1990;507:157–63.

    Article  CAS  Google Scholar 

  27. 27.

    Schiller NB, Shah PM, Crawford M, DeMaria A, Devereux R, Feigenbaum H, et al. Recommendations for quantitation of the left ventricle by two-dimensional echocardiography. American Society of Echocardiography Committee on Standards, Subcommittee on Quantitation of Two-Dimensional Echocardiograms. J Am Soc Echocardiogr. 1989;2(5):358–67.

    Article  CAS  Google Scholar 

  28. 28.

    Takagawa J, Zhang Y, Wong ML, Sievers RE, Kapasi NK, Wang Y, et al. Myocardial infarct size measurement in the mouse chronic infarction model: comparison of area- and length-based approaches. J Appl Physiol (1985). 2007;102(6):2104–11.

    Article  Google Scholar 

  29. 29.

    Chow A, Stuckey DJ, Kidher E, Rocco M, Jabbour RJ, Mansfield CA, et al. Human induced pluripotent stem cell-derived cardiomyocyte encapsulating bioactive hydrogels improve rat heart function post myocardial infarction. Stem Cell Rep. 2017;9(5):1415–22.

    Article  CAS  Google Scholar 

  30. 30.

    Majmudar MD, Keliher EJ, Heidt T, Leuschner F, Truelove J, Sena BF, et al. Monocyte-directed RNAi targeting CCR2 improves infarct healing in atherosclerosis-prone mice. Circulation. 2013;127(20):2038–46.

    Article  CAS  Google Scholar 

  31. 31.

    Swirski FK, Nahrendorf M, Etzrodt M, Wildgruber M, Cortez-Retamozo V, Panizzi P, et al. Identification of splenic reservoir monocytes and their deployment to inflammatory sites. Science. 2009;325(5940):612–6.

    Article  CAS  Google Scholar 

  32. 32.

    Hofmann U, Frantz S. Role of lymphocytes in myocardial injury, healing, and remodeling after myocardial infarction. Circ Res. 2015;116(2):354–67.

    Article  CAS  Google Scholar 

  33. 33.

    Gordon S, Taylor PR. Monocyte and macrophage heterogeneity. Nat Rev Immunol. 2005;5(12):953–64.

    Article  CAS  Google Scholar 

  34. 34.

    Ziegler-Heitbrock L. Reprint of: monocyte subsets in man and other species. Cell Immunol. 2014;291(1–2):11–5.

    Article  CAS  Google Scholar 

  35. 35.

    Vlacil AK, Schuett J, Schieffer B, Grote K. Variety matters: diverse functions of monocyte subtypes in vascular inflammation and atherogenesis. Vasc Pharmacol. 2019;113:9–19.

    Article  CAS  Google Scholar 

  36. 36.

    Yrlid U, Jenkins CD, MacPherson GG. Relationships between distinct blood monocyte subsets and migrating intestinal lymph dendritic cells in vivo under steady-state conditions. J Immunol. 2006;176(7):4155–62.

    Article  CAS  Google Scholar 

  37. 37.

    Leor J, Rozen L, Zuloff-Shani A, Feinberg MS, Amsalem Y, Barbash IM, et al. Ex vivo activated human macrophages improve healing, remodeling, and function of the infarcted heart. Circulation. 2006;114:I94–100.

    Article  Google Scholar 

  38. 38.

    Leuschner F, Rauch PJ, Ueno T, Gorbatov R, Marinelli B, Lee WW, et al. Rapid monocyte kinetics in acute myocardial infarction are sustained by extramedullary monocytopoiesis. J Exp Med. 2012;209(1):123–37.

    Article  CAS  Google Scholar 

  39. 39.

    Shantsila E, Lip GY. Monocytes in acute coronary syndromes. Arterioscler Thromb Vasc Biol. 2009;29(10):1433–8.

    Article  CAS  Google Scholar 

  40. 40.

    Frangogiannis NG. Regulation of the inflammatory response in cardiac repair. Circ Res. 2012;110(1):159–73.

    Article  CAS  Google Scholar 

  41. 41.

    Chen B, Frangogiannis NG. Immune cells in repair of the infarcted myocardium. Microcirculation. 2017;24:1–10.

    Google Scholar 

  42. 42.

    Frangogiannis NG, Smith CW, Entman ML. The inflammatory response in myocardial infarction. Cardiovasc Res. 2002;53(1):31–47.

    Article  CAS  Google Scholar 

  43. 43.

    Jung M, Ma Y, Iyer RP, DeLeon-Pennell KY, Yabluchanskiy A, Garrett MR, et al. IL-10 improves cardiac remodeling after myocardial infarction by stimulating M2 macrophage polarization and fibroblast activation. Basic Res Cardiol. 2017;112(3):33.

    Article  CAS  Google Scholar 

  44. 44.

    Wan E, Yeap XY, Dehn S, Terry R, Novak M, Zhang S, et al. Enhanced efferocytosis of apoptotic cardiomyocytes through myeloid-epithelial-reproductive tyrosine kinase links acute inflammation resolution to cardiac repair after infarction. Circ Res. 2013;113(8):1004–12.

    Article  CAS  Google Scholar 

  45. 45.

    Ryu JC, Davidson BP, Xie A, Qi Y, Zha D, Belcik JT, et al. Molecular imaging of the paracrine proangiogenic effects of progenitor cell therapy in limb ischemia. Circulation. 2013;127(6):710–9.

    Article  CAS  Google Scholar 

  46. 46.

    Thomas G, Tacke R, Hedrick CC, Hanna RN. Nonclassical patrolling monocyte function in the vasculature. Arterioscler Thromb Vasc Biol. 2015;35(6):1306–16.

    Article  CAS  Google Scholar 

  47. 47.

    Hilgendorf I, Gerhardt LM, Tan TC, Winter C, Holderried TA, Chousterman BG, et al. Ly-6Chigh monocytes depend on Nr4a1 to balance both inflammatory and reparative phases in the infarcted myocardium. Circ Res. 2014;114(10):1611–22.

    Article  CAS  Google Scholar 

  48. 48.

    Frantz S, Hofmann U, Fraccarollo D, Schafer A, Kranepuhl S, Hagedorn I, et al. Monocytes/macrophages prevent healing defects and left ventricular thrombus formation after myocardial infarction. FASEB J. 2013;27(3):871–81.

    Article  CAS  Google Scholar 

Download references

Funding

This study was supported in part by Biorest Ltd., Tel Aviv, Israel (GG and HD). GG is grateful to the Woll Sisters and Brothers Chair in Cardiovascular Diseases.

Author information

Affiliations

Authors

Corresponding author

Correspondence to Gershon Golomb.

Ethics declarations

Conflict of Interest

GG, HD, and IR have a financial stake in Biorest Ltd.; EG, MG, AE, and AO declare that they have no conflict of interest.

Ethical Approval

All procedures performed in studies involving animals were in accordance with the ethical standards of the institution or practice at which the studies were conducted.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic Supplementary Material

ESM 1

(PPTX 993 kb)

Rights and permissions

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

Grad, E., Gutman, D., Golomb, M. et al. Monocyte Modulation by Liposomal Alendronate Improves Cardiac Healing in a Rat Model of Myocardial Infarction. Regen. Eng. Transl. Med. 5, 280–289 (2019). https://doi.org/10.1007/s40883-019-00103-8

Download citation

Keywords

  • Myocardial infarction
  • Drug delivery
  • Liposomes
  • Alendronate
  • Monocytes
  • Cytokines