First Occurrence of Cheilomenes sexmaculata (Coleoptera: Coccinellidae) on the Caribbean Island of Curaçao

Abstract

The predatory ladybird species, Cheilomenes sexmaculata (Fabricius), is native to Asia and Australia but has established populations outside its native range, most recently on the eastern and northern coast of South America. Here, we report for the first time the identification of the introduced ladybird beetle, C. sexmaculata, to the Caribbean islands, specifically the island of Curaçao. Although C. sexmaculata is typically considered beneficial and used as a means of biological control in continental ecosystems, due to its high predatory and reproductive ability, it has the potential to cause major ecological impacts as an invader to sensitive Caribbean island ecosystems.

Cheilomenes sexmaculata (Fabricius) is a ladybird beetle of the Coccinellidae family. They are primarily aphidophagous predators but also feed on other soft-bodied insects and pollen (Omkar 2004). Experimentally, C. sexmaculata has demonstrated higher predation rates on aphids than other coccinellids (Coccinella transversalis (Fabricius) and Propylea dissecta (Mulsant)), indicating its effectiveness as a biological control agent of aphids and other pests (Pervez & Omkar 2005). Due to its generalist diet and high predation rate, C. sexmaculata has the potential to be an invasive predator with high ecological impact (Venkatesan et al2006).

Cheilomenes sexmaculata is native to Asia and Australia (Poorani 2002), with a distribution over predominantly tropical and subtropical latitudes (Sasaji 1971). It has recently been introduced outside its native range to Ecuador, Peru, Chile, Venezuela, and Colombia in South America (González 2008, Angulo et al2011, Cornejo & González 2015, Ramírez et al2018) and to Oklahoma in the USA for biological pest control purposes (Cartwright et al1977). In its native range, C. sexmaculata is typically found in agricultural fields and urban areas and is rarely found in suburban or mountainous areas (Kawakami et al2016). In comparison, in its introduced range, it has been known to persist and thrive in areas of urban vegetation, as it uses the physical structures, climate, and food availability of urban green spaces to help extend its distribution (Kawakami et al2016). Thus far, C. sexmaculata has only been introduced to continental ecosystems. Continental ecosystems may be more resilient to invasions of exotic arthropods, whereas island ecosystems, such as those of the Caribbean, may be more fragile and susceptible to the harmful effects of invasion (Simberloff 1995). Here, we report the first finding of C. sexmaculata on the Caribbean island of Curaçao.

We sampled arthropods on Curaçao at 31 sites across the island that spanned a gradient of development and vegetation structure. At each site, we collected arthropods by sweep-netting all vegetation types within a site. The collected specimens were then frozen and preserved in 95% ethanol in the field. To confirm the identity of C. sexmaculata, we sequenced a 523-bp region of the mitochondrial cytochrome oxidase I gene. Total genomic DNA was extracted using a Chelex extraction protocol on tissue from our preserved specimen’s leg (Casquet et al2012). Amplification was accomplished using primers C_LepFolF (5′ ATTCAACCAATCATAAAGAT ATTGG 3′) and C_LepFolR (5′ TAAACTTCTGGATGTCCAAAAAATCA 3′) (Hajibabaei et al2006). DNA sequencing was performed by Genewiz (South Plainfield, NJ), and resultant sequences were compared to the GenBank nucleotide database using BLAST (vouchered sequence GenBank Accession Number, MK889163).

Of the 31 sites we sampled, we found C. sexmaculata at only one: the Curaçao Zoo (12.1300001N°, −68.8944016W°; WGS84) in Willemstad on January 31, 2017 (Fig 2). In total, we found seven C. sexmaculata, and six of the seven individuals were identified as female using the sex determination guide for the Coccinellid Harmonia axyridis (Pallas) (McCornack et al2007). Cheilomenes sexmaculata is identified via its securiform maxillary palpi; upper surface glabre; bidentate mandibles; simple, 11-segmented, clavate antennae that are shorter than head width and scape larger than pedicel; rounded form with the middle and back femurs not exceeding the elytra and wide elytral epipleura that are strongly inclined below (Fig 1c–d), tibial spurs absent in forelegs, and legs having pseudotrimerous tarsi and tarsal segments densely hairy, end with a pair of claws; descending postcoxal lines (Slipinski 2007, González 2014) and from its characteristic design compared with morphs illustrated in Kawakami et al (2015) and (González 2014).

Fig 1
figure1

Morphological and color morph characters of Cheilomenes sexmaculata showing a dorsal view with elytral pattern indicating morph L-2, b dorsal view of head with compound eyes, c ventral view, d ventral view of head with maxillary and labial palp.

Cheilomenes sexmaculata has 22 elytral polymorphs, which are associated with different habitats, as melanism was found to potentially indicate higher fitness at higher latitudes (Kawakami et al2015). The individuals found appear to be morph L-2, as indicated by their red elytra with two zig-zag black lines, a black mark on the posterior end of the head, small yellow spots on the head, and a posterior black spot (Kawakami et al2015) (Fig 1a–b). Morph L-2 is typically found in lower latitudes due to its lower melanin content (Kawakami et al2015) and is one of the morphs identified in the introduced population in Colombia (Ramírez et al2018) and may also be present in Venezuela (González 2014). The Curaçao Zoo receives frequent shipments of a variety of produce from Venezuela to feed the animals; therefore, Venezuela may be the source of the introduced population of C. sexmaculata on Curaçao. Based on the human development in the surrounding landscape, the Curaçao Zoo is classified in our study as urban and we found C. sexmaculata in an area overgrown with mixed vegetation near a garden (Fig 2). This habitat is consistent with the urban areas where C. sexmaculata has been found outside of its native range elsewhere (Kawakami et al2016).

Fig 2
figure2

Overgrown, mixed vegetation habitat where Cheilomenes sexmaculata was found on Curaçao (photo: M. R. Helmus).

Although ladybird beetles are usually considered beneficial and are often introduced purposefully to agricultural environments for pest control, they can cause significant population declines of ecologically important native species. For example, on the island of Cape Breton in Nova Scotia, an island twice the size of Curaçao, the introduction of three invasive ladybeetle species (introduced in 1990, 1995, and 1996) caused a population shift such that, by the year 2000, native ladybird beetle species accounted for less than 5% of the total ladybird population (Cormier et al2000). Among our samples from Curaçao, we found at least 12 other yet to be identified ladybird beetle species, which may be vulnerable to competition from C. sexmaculata. Additionally, introduced species are more likely to produce major ecological impacts on islands than in mainland ecosystems (Simberloff 1995). On average, island populations are smaller, less genetically diverse, and more geographically restricted, and therefore threatened species are less likely to have a refuge (Simberloff 1995). In conclusion, as C. sexmaculata continues to spread throughout the Caribbean region, its ability to survive in developed environments and strong predatory ability highlights the potential to cause disproportionately greater ecosystem shifts, including declines of important native populations, in island ecosystems.

References

  1. Angulo J, Arcaya E, González R (2011) Aspectos biológicos de Menochilus sexmaculatus (F.) (Coleoptera: Coccinellidae) alimentado con Aphis craccivora Koch (Hemiptera: Aphididae). Boletín del Centro de Investigaciones Biológicas 45:423–431

    Google Scholar 

  2. Cartwright BO, Eikenbary RD, Johnson JW, Farris TN, Morrison RD (1977) Field release and dispersal of Menochilus sexmaculatus, an imported predator of the Greenbug, Schizaphis graminum. Environ Entomol 6:699–704. https://doi.org/10.1093/ee/6.5.699

    Article  Google Scholar 

  3. Casquet J, Thebaud C, Gillespie RG (2012) Chelex without boiling, a rapid and easy technique to obtain stable amplifiable DNA from small amounts of ethanol-stored spiders. Mol Ecol Resour 12:136–141. https://doi.org/10.1111/j.1755-0998.2011.03073.x

    Article  CAS  PubMed  Google Scholar 

  4. Cormier CM, Forbes TA, Jones TA, Morrison RD, McCorquodale DB (2000) Alien invasion: the status of non-native lady beetles (Coleoptera: Coccinellidae) in industrial cape Breton, Nova Scotia. Northeast Nat 7:241–247. https://doi.org/10.2307/3858356

    Article  Google Scholar 

  5. Cornejo X, González G (2015) Contribution to knowledge of the Entomologic Fauna of Mangroves: Olla roatanensis Vandenberg and Cheilomenes sexmaculata Fabricius, two new records of Coleoptera: Coccinellidae for Ecuador and Peru. Rev Científica Cienc Nat Ambient 8:76–80

    Google Scholar 

  6. González G (2008) Lista y distribución geográfica de especies de Coccinellidae (Insecta: Coleoptera) presentes en Chile. Boletín del Museo Nacional de Historia Natural, Chile 57:77–107

    Google Scholar 

  7. González G (2014) Cheilomenes sexmaculata - Venezuela - Coccinellidae. In: Coccinellidae Venezuela – I Cheilomenes sexmaculatai. https://www.coccinellidae.cl/paginasWebVen/Paginas/Cheilomenes_sexmaculata_Ven.php. Accessed 4 Dec 2018

  8. Hajibabaei M, Janzen DH, Burns JM, Hallwachs W, Hebert PDN (2006) DNA barcodes distinguish species of tropical Lepidoptera. Proc Natl Acad Sci 103:968–971. https://doi.org/10.1073/pnas.0510466103

    Article  PubMed  Google Scholar 

  9. Kawakami Y, Yamazaki K, Ohashi K (2015) Increase in dark morphs and decrease in size during a range extension of Cheilomenes sexmaculata (Coleoptera: Coccinellidae). Eur J Entomol 112:289–294. https://doi.org/10.14411/eje.2015.029

    Article  Google Scholar 

  10. Kawakami Y, Yamazaki K, Ohashi K (2016) Population dynamics, seasonality and aphid prey of Cheilomenes sexmaculata (Coleoptera: Coccinellidae) in an urban park in central Japan. Eur J Entomol 113:192–199. https://doi.org/10.14411/eje.2016.023

    Article  Google Scholar 

  11. McCornack BP, Koch RL, Ragsdale DW (2007) A simple method for in-field sex determination of the multicolored Asian lady beetle Harmonia axyridis. J Insect Sci 7:1–12. https://doi.org/10.1673/031.007.1001

    Article  CAS  PubMed  Google Scholar 

  12. Omkar and RB Bind (2004) Prey quality dependent growth, development and reproduction of a biocontrol agent, Cheilomenes sexmaculata (Fabricius) (Coleoptera: Coccinellidae). Biocontrol Sci Tech 14:665–673. https://doi.org/10.1080/091583150410001682359

  13. Pervez A, Omkar (2005) Functional responses of coccinellid predators: an illustration of a logistic approach. J Insect Sci 5:1–6

    Article  Google Scholar 

  14. Poorani J (2002) An annotated checklist of the Coccinellidae (Coleoptera) (excluding Epilachninae) of the Indian subregion. Orient Insects 36:307–383. https://doi.org/10.1080/00305316.2002.10417335

    Article  Google Scholar 

  15. Ramírez J, González G, Sánchez Y (2018) First record of Cheilomenes sexmaculata (Fabricius, 1781) (Coleoptera, Coccinellidae) from Colombia. Check List 14:77–80. https://doi.org/10.15560/14.1.77

    Article  Google Scholar 

  16. Sasaji H (1971) Genus Menochilus Timberlake. In: Sasaji H (ed) Fauna Japonica Coccinellidae (Insecta: Coleoptera). Academic Press of Japan, Tokyo, pp 284–286

    Google Scholar 

  17. Simberloff D (1995) Why do introduced species appear to devastate islands more than mainland areas? Pac Sci 49:87–97

    Google Scholar 

  18. Slipinski A (2007) Australian ladybird beetles (Coleoptera: Coccinellidae). CSIRO publishing, Canberra

    Google Scholar 

  19. Venkatesan J, Murthy KS, Bkashkaran T, Jalali SK (2006) Rearing of Cheilomenes sexmaculata (Fabricius) on artificial diet and its predatory efficiency against Aphis craccivora Koch. Annals of Plant Protection Sciences 14:277–279

    Google Scholar 

Download references

Acknowledgments

We thank two anonymous reviewers for helpful comments that improved the quality of the manuscript. We thank M. Vermeij from CARMABI for logistical support and B. Isenia for permission for sampling. In addition, we are grateful to M. Helmus, C. Irian, K. Langhans, C. Lynch, T. Tran, and S. Williams for field support, sample processing, and genetic analyses.

Author Contribution Statement

JEB planned and conducted the field sampling. HRA identified the specimens in the lab. HRA and JEB wrote the manuscript.

Funding

This work was supported by funds from Temple University and the Netherlands Organization for Scientific Research (NWO) Grant 858.14.040.

Author information

Affiliations

Authors

Corresponding author

Correspondence to J E Behm.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Edited by Anne-Nathalie Volkoff – INRA

Rights and permissions

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

Assour, H.R., Behm, J.E. First Occurrence of Cheilomenes sexmaculata (Coleoptera: Coccinellidae) on the Caribbean Island of Curaçao. Neotrop Entomol 48, 863–865 (2019). https://doi.org/10.1007/s13744-019-00699-0

Download citation

Keywords

  • Biological control
  • Dutch Antilles
  • Exotic species
  • Invasive species
  • Ladybird beetle