Advertisement

Isolation and characterization of 89 SNP markers in the oriental turtle dove, Streptopelia orientalis

  • Jiangyong QuEmail author
  • Ruxiao Wang
  • Shanshan Wang
  • Xiaoyu Guo
  • Yutong Cui
  • Yuanyuan Li
Open Access
Technical Note

Abstract

Streptopelia orientalis is an important commercial species, and natural populations have declined dramatically in recent years because of the application of traditional Chinese medicine. The effective conservation and management of S. orientalis have been limited without sufficient molecular markers. In this study, we reported the isolation and characterization of 89 SNP markers in S. orientalis. The minor allele frequency raged from 0.0417 to 0.4792. The observed heterozygosity and expected heterozygosity ranged from 0.0000 to 0.9583 and from 0.0816 to 0.5098, respectively. Polymorphic information content ranged from 0.0767 to 0.3746. The inbreeding coefficient values varied from − 0.3149 to 0.8686. Only four loci showed significant deviations from the Hardy–Weinberg equilibrium (P < 0.05). The polymorphic SNPs will be helpful for the further population genetic analysis and natural resource conservation of S. orientalis.

Keywords

Streptopelia orientalis SNP markers Population genetic diversity Transcriptome 

The oriental turtle dove (Streptopelia orientalis) is a widespread polytypic Asian species that breeds from the Ural Mountains to the Pacific coast of the Russian Far East (Brazil 2009; Gibbs et al. 2001; Johnson et al. 2001; Lee et al. 2017). S. orientalis has been listed in the International Union for Conservation of Nature (IUCN), IUCN Red List of Threatened Species (2016), ranging from north (Heilongjiang Province) to south (Hainan Island), and from west (Xinjiang and Tibet) to east (Hong Kong and Taiwan). Although S. orientalis has not yet been classified as an endangered species, natural populations have declined dramatically in recent years because of the application of traditional Chinese medicine and commercial values. Therefore, it is urgent to perform population genetic investigation on S. orientalis to conserve and utilize the natural resources. As an important DNA marker, single nucleotide polymorphisms (SNPs) are widely used for genetic studies (Vignal et al. 2002). In this study, SNPs were developed and characterized in S. orientalis for the first time with the restriction-site associated DNA tags sequencing (RAD-seq), and will be important genetic markers for the researches on conservation genetics.

Blood was collected from 30 S. orientalis individuals from Yantai in Shandong province (37°27′N/121°30′E). Genomic DNA was extracted from blood samples using the DNeasy Blood & Tissue kit (QIAGEN, Germany) according to the manufacturer’s instructions. RAD library construction, sample indexing and pooling followed for the natural populations (Baird et al. 2008). To obtained SNP marker resources, pair-end (150-bp) sequencing was performed using Illumina HiSeq4000 (Shanghai BIOZERON Co., Ltd.), and a total of 254, 291 putative SNPs in S. orientalis was identified.

Primer v3.0 was used to design primers, 89 primer pairs successfully created. PCR reactions were performed in a 25 µl volume with GenStar PCR Mix according to the manufacturer’s instructions (GeneStar, Beijing, China). PCR amplification cycles were as follows: an initial denaturation at 94 °C for 5 min; 40 cycles of 94 °C for 30 s, annealing for 30 s (for annealing temperatures of each primer pair, see Table 1) for 30 s, and 72 °C for 30 s; and a final extension at 72 °C for 7 min. Amplified samples were purified by gel extraction and sequenced on ABI 3730 DNA Analyzer (Applied Biosystems). For validated loci, statistics including the minor allele frequency (MAF), observed heterozygosity (HO), expected heterozygosity (HE), polymorphism information content (PIC), inbreeding coefficient (FIS) and P-value representing the deviations from Hardy–Weinberg equilibrium (HWEP) were caltulated using Cervus 3.0 (Kalinowski et al. 2007).

Table 1

Characterization of 89 SNP markers in the oriental turtle dove Streptopelia orientalis

Primer ID

Primer sequence (5′–3′)

Size

(bp)

Tm

(°C)

SNP type

SNP position

H O

H E

F IS

HWEP

PIC

MAF

33515

F:TGGCACATGTGTCACATCCA

R:AGAACCCTGCTGTGTGATTCA

327

60

T/C

68

0.8750

0.5027

− 0.2799

*

0.3711

0.4375

41019

F:GGCATTCAGTGTCATCCCCT

R:CGTCATTCAGGCTGGATGGT

281

60

G/A

80

0.9583

0.5098

− 0.3149

**

0.3746

0.4792

120812

F:GGGAAGATCAGAGACAGTGCT

R:CAGAGCAAAGCAGAGGTCGA

304

60

C/T

87

0.1250

0.1197

− 0.0234

NS

0.1103

0.0625

121698

F:TGTGCACCAGAAACCAGAGG

R:GCTGGGGCAGTCTTCCTTAG

293

60

A/G

74

0.1250

0.1197

− 0.0234

NS

0.1103

0.0625

128473

F:TAGAGGCTGAGCATTGGCAG

R:AGACAGCAATGAAAATGGCCT

324

60

G/C

63

0.2500

0.3369

0.1377

*

0.2755

0.2083

128889

F:AGAGTAAAAAGCTTAACCCCAGA

R:GTGTCCTCAGGGCTCTCATG

294

57

T/A

54

0.0417

0.1906

0.6098

NS

0.1692

0.1042

134895

F:GTCTCCTCTTCAAACTTTTCAACTCA

R:CTGGTACCTACATGACAGAGGC

333

60

T/G

49

0.1250

0.1197

− 0.0234

NS

0.1103

0.0625

135047

F:GCAAAAGCTGGGCTGGATTT

R:AGCCAGTAGGAAAACCCTTCT

328

60

T/C

92

0.0417

0.1197

0.4372

NS

0.1103

0.0625

136010

F:TCGGAAAACTTCACAACAAGCA

R:GTGGCTGTAGCGTAGTGTGA

292

59

A/G

94

0.0417

0.1197

0.4372

NS

0.1103

0.0625

137106

F:AGGCTGAAGTGCTCACTGAA

R:CTCTCAGCATGCTATGGGGG

302

59

A/G

76

0.0417

0.1197

0.4372

NS

0.1103

0.0625

138042

F:TCTGTTTGCCAGGGGTCTTC

R:TGGGAATGGGAAGAATTGGGA

297

60

A/G

83

0.1250

0.1906

0.1975

NS

0.1692

0.1042

140802

F:TAAGCCCTGCTCTGTTGTCC

R:ATTGCCTCCCTTGTTCGTGT

309

60

C/T

58

0.0833

0.0816

− 0.0122

NS

0.0767

0.0417

141092

F:ATTCCCTTGCTTCCCAGGAG

R:AACTCCTTGGTGTTAGGCGG

302

60

T/C

75

0.1667

0.1560

− 0.0358

NS

0.1411

0.0833

141452

F:GTGGCATAAGCTAAACCAGAGC

R:ACAATCAAGGCAGCAAGGATG

270

60

G/A

77

0.0833

0.1560

0.2899

NS

0.1411

0.0833

142319

F:TCAGAGCTGCCACGTATGTG

R:CTTGTTCAGACTGACACCCCA

352

60

C/G

33

0.0833

0.1560

0.2899

NS

0.1411

0.0833

142716

F:ACACAGCCTGAATTGCATCAC

R:GGTTTCAGGAGAGGCAAGCA

330

59

G/T

63

0.0833

0.0816

− 0.0122

NS

0.0767

0.0417

144488

F:TCCTCAAACCCTGGAAGCTT

R:CAGGAGCTATTCAGGTGGCA

264

58

T/C

48

0.1250

0.1197

− 0.0234

NS

0.1103

0.0625

144543

F:TGTCAGGCAAGTGCATTTTTCT

R:CGCCTTCAAGCCAGTTTTGT

293

59

C/A

86

0.1250

0.1197

− 0.0234

NS

0.1103

0.0625

145456

F:AGATTGCAGCTCTGTTTTACTGT

R:GTGATCGCCTCCTACCCAAC

258

58

T/G

76

0.1250

0.1197

− 0.0234

NS

0.1103

0.0625

145938

F:TGTCACGCTAATCCAGACACC

R:GGGAGATGCAAGGTCACACA

296

60

C/G

87

0.2500

0.2234

− 0.062

NS

0.1948

0.125

145945

F:TGTAACCCATGAACCAGGTGG

R:CACTGGCAGCTGGAAGGTTA

311

60

G/C

67

0.1250

0.1197

− 0.0234

NS

0.1103

0.0625

145954

F:AGACAATGTGCAGAGAAGCA

R:CCCGAGGAGAACGTCAAACA

309

57

G/A

86

0.1250

0.1197

− 0.0234

NS

0.1103

0.0625

146400

F:GGCTTTTCCCCCACACATCT

R:ACTTTTGCTGCCTTACTCCT

283

60

A/T

86

0.1667

0.1560

− 0.0358

NS

0.1411

0.0833

147303

F:TGCACATTAGCCTGAGCCAA

R:GAGAGAGCACCACAGAGCAG

323

60

T/C

71

0.1667

0.1560

− 0.0358

NS

0.1411

0.0833

147628

F:GCCTCACCAGTGCTGAGTAC

R:CTGGGGCTCTTAATGGGACC

290

60

A/G

81

0.1667

0.1560

− 0.0358

NS

0.1410

0.0833

150367

F:GCCTTTGGCCTCATGGGTAT

R:TGTGTGCACATGTGTTTCAGT

256

60

T/G

44

0.3333

0.4220

0.1070

*

0.3278

0.2917

151912

F:CCACTCCCTAGAGCAGAAGC

R:CCAGAACGATGTCATACACGC

329

60

G/A

49

0.3333

0.2837

− 0.0884

NS

0.2392

0.1667

212816

F:GGCCATACCTCAAACCTACCA

R:TCAAGCCATAACCAGCAAAAGT

289

59

A/G

57

0.0417

0.1197

0.4372

NS

0.1103

0.0625

213823

F:ACATTTGTTGCATCTAGGCT

R:TCTGAAAATGCAGCCTGAGGT

331

55

T/A

69

0.0000

0.0816

0.6831

NS

0.0767

0.0417

214980

F:TGGCATTCCATTTGTCTCAA

R:CCCTCCCCCAAGCAATGTTA

275

56

G/C

90

0.0833

0.0816

− 0.0122

NS

0.0767

0.0417

221170

F:TCTCTACAGAAAGTTACCAGGAGT

R:CCAGGCAGGATGTGAAACCT

306

58

A/G

47

0.1250

0.1197

− 0.0234

NS

0.1103

0.0625

224434

F:TGTGTTTGAAGGCTGGAAAGTG

R:CACTGGTACTGGTCAGCAGG

260

60

G/A

98

0.0417

0.1197

0.4372

NS

0.1103

0.0625

225989

F:TGACACATTTCCAGCCCTGT

R:CACCTTCAGTAGACCCAGGC

324

60

G/A

56

0.0417

0.1906

0.6098

NS

0.1692

0.1042

227551

F:TGGCATTTGACTGAAGAGCTG

R:AGCTGTGGGGGTTAGGATCT

309

59

G/A

73

0.0000

0.1560

0.8686

NS

0.1411

0.0833

227699

F:ATGGGATGTTCGGACAGCTG

R:AGTGTGAGATAAAGGTGACACGA

307

60

C/T

78

0.1250

0.1906

0.1975

NS

0.1692

0.1042

228914

F:TTGAAAGCTGAGCCTGAGGG

R:GGCCTGTATCACACCACGTT

289

60

C/G

100

0.0417

0.1906

0.6098

NS

0.1692

0.1042

229943

F:TCCCCTATTGTTGGCACCAA

R:CTCAGTTCCAGCAGGACAGG

298

59

C/T

82

0.0000

0.1560

0.8686

NS

0.1411

0.0833

230950

F:AAGAGGTCCACACTGTCACC

R:AACGAGTGCCAAGTCTCTCC

260

59

G/C

92

0.0833

0.1560

0.2899

NS

0.1411

0.0833

231430

F:ACACTGGCTTTAAATTCCTTTGCA

R:GATTTGCAGCCTTCGTGTCG

328

60

G/C

78

0.0833

0.1560

0.2899

NS

0.1411

0.0833

231643

F:TCACAGAAACAAACATAGCTCC

R:TGGCAGCATCACACTGTTCT

280

57

C/G

60

0.0833

0.1560

0.2899

NS

0.1411

0.0833

232294

F:CCAAATCCTCATCGTGCCCT

R:GAGACACTGGCTCTGGCTTT

335

60

A/G

104

0.1250

0.1197

− 0.0234

NS

0.1103

0.0625

232564

F:TCCATTGTATTGTGCATTAAGC

R:CCTGGCTGTTGGCTTCAGTA

278

55

T/C

74

0.0417

0.1197

0.4372

NS

0.1103

0.0625

233731

F:TCTGTGCAAACAGCTTATATGCT

R:AAAGTTCAGTGCCCAGCAGT

269

59

T/C

61

0.0417

0.1197

0.4372

NS

0.1103

0.0625

233978

F:CTCTTTCGTGGCTGCAGAGA

R:ACGAGCAGCTGATGTGTCTT

289

60

C/T

87

0.0833

0.2234

0.4439

NS

0.1948

0.1250

234255

F:AGGGATTTGTCAACAGCACA

R:TTGCAGACCTCTTTCCCACC

249

58

G/T

50

0.1250

0.1197

− 0.0234

NS

0.1103

0.0625

234498

F:CAAAACGCCCCATGTGACAG

R:GACACAGGTGGCTCTCTCAG

301

60

G/C

104

0.1250

0.1197

− 0.0234

NS

0.1103

0.0625

234911

F:ACCCTCACAGTGGCAAAGAG

R:GGGTTAAAACGAGGGGGTCA

325

60

G/C

91

0.1250

0.1197

− 0.0234

NS

0.1103

0.0625

235190

F:ATCGGGAGCACTGAGTTTGG

R:CAGCTGGATGCCACTTCAGA

290

60

A/G

91

0.0000

0.0816

0.6831

NS

0.0767

0.0417

235866

F:GGGTCTTTTGTCTTCAAACCCC

R:CCTGGCCATCCCCATTTCTT

300

60

T/C

73

0.0833

0.2234

0.4439

NS

0.1948

0.1250

236152

F:CATCCACGGGGGTAGATGC

R:CTCTCTTGGCCTCACAGGAG

256

60

C/G

58

0.1250

0.1197

− 0.0234

NS

0.1103

0.0625

236543

F:CCCCATGAAAACCTGAGTGC

R:GCACAGCTCAGTGAAAACCAG

275

59

A/C

58

0.0833

0.1560

0.2899

NS

0.1411

0.0833

236686

F:ATGCTGTCAGGTTCCTGAGC

R:CTGAAGTGACAGGGCAGGTC

262

60

T/G

87

0.1250

0.1197

− 0.0234

NS

0.1103

0.0625

236767

F:TCCAAACACTGTCAGGGACG

R:GTTCAGGGGAAATGGGTGCT

335

60

T/C

101

0.1250

0.1197

− 0.0234

NS

0.1103

0.0625

237156

F:ACCTGACAAGTGCAGGTAAAC

R:TTCACACCGTGTGTCTGAGG

301

58

C/T

76

0.0833

0.2234

0.4439

NS

0.1948

0.1250

237183

F:AACAAGCATCTTGGCAATCA

R:ACAATGACATGCAAGTCCAT

288

56

C/A

88

0.1250

0.1197

− 0.0234

NS

0.1103

0.0625

237210

F:AAGGTGAGTAGCTGGCATGC

R:CCTCCTCCTGCCTCCAAAAG

299

60

T/A

85

0.1250

0.1197

− 0.0234

NS

0.1103

0.0625

237745

F:CCAAAGGTATGCCACAAATTGC

R:TGAGCGGCTGTGACTCAAAG

336

59

T/C

49

0.0417

0.1197

0.4372

NS

0.1103

0.0625

237823

F:GGAATCACTCTGGAACCCCC

R:CCCTTGTCATGGCTGCTGTA

309

60

C/T

102

0.1250

0.1197

− 0.0234

NS

0.1103

0.0625

238083

F:AGGGAAGAATCAGAACTTTGCTCT

R:TAGCTCTGCTGGCTGGAATG

274

60

A/G

70

0.1250

0.1906

0.1975

NS

0.1692

0.1042

238127

F:ATTCGGACTGGAGGTGACAG

R:GCAGTTTGGTTTAGCAGGGC

292

59

A/G

56

0.1250

0.1197

− 0.0234

NS

0.1103

0.0625

238315

F:TCAAGCCAACCAGTTTCCCT

R:CCCCGTTCACAGCTATGCAA

267

59

G/C

50

0.1250

0.1197

− 0.0234

NS

0.1103

0.0625

239210

F:TCAACCAAGGGAAAAGGCTGA

R:CCATGGCTTGTTTGGGCTTC

311

60

G/A

77

0.1250

0.1197

− 0.0234

NS

0.1103

0.0625

239788

F:AGTGGAACTTAAGTTTTCATTTTGCT

R:GAAAACGATGACCCGTGCTG

295

59

A/G

84

0.1250

0.1197

− 0.0234

NS

0.1103

0.0625

240197

F:TCCAGGTCAGAAATGCACAGT

R:AATCACGGCCTGATCAAGCA

290

60

A/C

103

0.1250

0.1197

− 0.0234

NS

0.1103

0.0625

240200

F:TCAAAATCTGTGACTCGGTGGT

R:ACAAATGGGGTCAGAGAGCG

294

60

T/C

105

0.1250

0.1197

− 0.0234

NS

0.1103

0.0625

240354

F:TCACAATACACTGCTGCTGC

R:TTTCTGTCGCCGTGGTTCAT

276

59

A/G

65

0.0833

0.1560

0.2899

NS

0.1411

0.0833

241120

F:CATCCCCAGCACACAGTTGA

R:TCTCACAACAGGCAGCACAT

348

60

T/C

55

0.1250

0.1197

− 0.0234

NS

0.1103

0.0625

241709

F:TGCAACTAAGTGCATTGCAGA

R:AGGGACATCAGCAGCTCAAC

315

59

A/G

73

0.1667

0.1560

− 0.0358

NS

0.1411

0.0833

241854

F:TGTCAAACGCAGAACCGATC

R:GTGTCACCTTTCCAGAGGGG

290

59

T/C

51

0.1667

0.1560

− 0.0358

NS

0.1411

0.0833

242618

F:TGCCCATGGTGAGTAATGCC

R:GCTGCTGCAAATCCCCTTCT

321

60

G/T

62

0.1667

0.1560

− 0.0358

NS

0.1411

0.0833

243695

F:TAACTTGCAGACAAACGCGG

R:AACTCGTCCCACAACTTCCC

320

59

G/A

97

0.1250

0.1197

− 0.0234

NS

0.1103

0.0625

244077

F:ATGGTGCCAATGTCCCCTTC

R:GGAACCCTTGGCGAGAATGT

340

60

T/C

71

0.2083

0.1906

− 0.0488

NS

0.1692

0.1042

245338

F:TCTGTTACAGCAGCCAGAGC

R:ACAAATTCTTCAATTCCATAACACA

321

60

C/T

36

0.1667

0.1560

− 0.0358

NS

0.1411

0.0833

245390

F:CAGCAGCCAGAGGTGGGG

R:CGAAATTCAGCACCCAGAGC

351

62

G/C

40

0.2083

0.1906

− 0.0488

NS

0.1692

0.1042

245551

F:ACAGGCTAGTTTTATCAGCTCCA

R:GCTCACCAGAAATGCAAGCA

255

59

G/C

72

0.1250

0.1197

− 0.0234

NS

0.1103

0.0625

246794

F:ACTGTTGCTTGCCTGACATG

R:TGGTTTTCCTCTGCAGTGGG

312

59

A/G

103

0.0833

0.1560

0.2899

NS

0.1411

0.0833

246879

F:AGAAAAGATGAGTGGGAAGAGA

R:GCTTCAGAGCTGCCCATTTC

326

56

G/A

69

0.1667

0.1560

− 0.0358

NS

0.1411

0.0833

246928

F:AGATGACTCTGAGGTTTTGTTAGT

R:TTCCTGTTCCTCCTCTCCGT

309

58

G/A

68

0.1667

0.1560

− 0.0358

NS

0.1411

0.0833

247124

F:TCACAAATTCACAAGGGGCA

R:CAAGCAGGGACCAGACTGAG

346

58

C/T

55

0.1667

0.1560

− 0.0358

NS

0.1411

0.0833

247894

F:TGCTGCTGAAGAAATGATTCA

R:CCAGTTTCAGGCTGTGGAGT

326

56

A/C

109

0.0417

0.1197

0.4372

NS

0.1103

0.0625

248120

F:TAAGGGAGGGCTAGAGGACC

R:GTTTGCTTGTGCCTTCCAGG

274

59

G/A

55

0.0000

0.1560

0.8686

NS

0.1411

0.0833

248609

F:ATTCTGAGTGATGCTGCCGC

R:GGGGTTCGTTCTGCTGATCA

270

61

T/C

38

0.2917

0.2544

− 0.0752

NS

0.2181

0.1458

249320

F:CTCCTCCTGTTCAAGGCTGG

R:TCTGCTCATTTGCTTATGGTTGA

290

60

A/G

72

0.1667

0.1560

− 0.0358

NS

0.1411

0.0833

249921

F:CTCGTTGCTGCTCTGAGCT

R:GCTACGGATCAGAGGTCAGC

271

60

A/G

103

0.1250

0.1197

− 0.0234

NS

0.1103

0.0625

249986

F:CCCCTGGAAGCGATGACTTT

R:TCCCAATTCTTCCCATTCCCA

312

60

A/G

99

0.2917

0.2544

− 0.0752

NS

0.2181

0.1458

250879

F:AGACCACATCCCAAACCACC

R:TGACTCAAGGCAAGACAGAGC

266

60

T/C

85

0.1250

0.1197

− 0.0234

NS

0.1103

0.0625

251191

F:ACTGCTTATTTTGACAGATTAGGT

R:TGCTTTTCTTCTGGTCAGCA

306

56

T/C

60

0.1250

0.1197

− 0.0234

NS

0.1103

0.0625

251324

F:ACAACTTCCCTGCATCCCAA

R:GGAACATACACCTTTCCCCCA

297

59

T/C

105

0.0417

0.1906

0.6098

NS

0.1692

0.1042

253951

F:TTCTGAGGACAGCTGGCATG

R:GCCAACAAAACAGCACACCA

324

60

T/A

62

0.1250

0.1197

− 0.0234

NS

0.1103

0.0625

Tm annealing temperature, Ho observed heterozygosity, He expected heterozygosity, Fis inbreeding coefficient, HWEP results for Hardy–Weinberg Equilibrium text, PIC polymorphism information content, MAF minor allele frequency, NS non-significant

*P < 0.05, **P < 0.01

Eighty-nine primer pairs could be amplified, and 89 SNPs located within these sequences were confirmed by Sanger sequencing. The minor allele frequency raged from 0.0417 to 0.4792 (Table 1). The observed heterozygosity and expected heterozygosity ranged from 0.0000 to 0.9583 and from 0.0816 to 0.5098, respectively. Polymorphic information content ranged from 0.0767 to 0.3746. The FIS values varied from − 0.3149 to 0.8686. Only four loci showed significant deviations from the HWE after Bonferroni correction (P < 0.05). These polymorphic SNP markers will be useful for further population genetic analysis, natural resource conservation and selective breeding of S. orientalis.

Notes

Acknowledgements

This work was supported by National Natural Science Foundation of China (No.: 31460562), the Key Research Program of Yantai (SM17SK04, SM17SK09), and the Doctoral Science Research Foundation of Yantai University (SM15B01).

References

  1. Baird NA, Etter PD, Atwood TS, Currey MC, Shiver AL, Lewis ZA, Selker EU, Cresko WA, Johnson EA (2008) Rapid SNP discovery and genetic mapping using sequenced RAD markers. PLoS ONE 3(10):e63376.  https://doi.org/10.1371/journal.pone.0003376 CrossRefGoogle Scholar
  2. Brazil M (2009) Birds of East Asia: eastern China, Taiwan, Korea, Japan, eastern Russia. Christopher Helm, LondonGoogle Scholar
  3. Gibbs D, Barnes E, Cox J (2001) Pigeons and doves: a guide to the pigeons and doves of the world. Pica Press, RobertsbridgeGoogle Scholar
  4. IUCN (2016) The IUCN red list of threatened species. Version 2016-3. Available at: http://www.iucnredlist.org. Accessed 7 Dec 2016
  5. Johnson KP, De Kort S, Dinwoodey K, Mateman AC, Cate CT, Lessells CM, Clayton DH (2001) A molecular phylogeny of the Dove Genera Streptopelia and Columba. Auk 118(4):874–887CrossRefGoogle Scholar
  6. Kalinowski ST, Taper ML, Marshall TC (2007) Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment. Mol Ecol 16:1099–1106CrossRefGoogle Scholar
  7. Lee HR, Koo BS, Kim JT, Kim HC, Kim MS, Klein TA, Shin MS, Lee SH, Jeon EO, Min KC, Lee SB, Bae YN, Mo IP (2017) Molecular epidemiology of avian poxvirus in the oriental turtle dove (Streptopelia orientalis) and the biting midge (Culicoides arakawae) in the Republic of Korea. J Wildl Dis 53(4):749–760.  https://doi.org/10.7589/2016-10-230 CrossRefGoogle Scholar
  8. Vignal A, Milan D, SanCristobal M, Eggen A (2002) A review on SNP and other types. of molecular markers and their use in animal genetics. Genet Sel Evol 34:275–305.  https://doi.org/10.1186/1297-9686-34-3-275 CrossRefGoogle Scholar

Copyright information

© The Author(s) 2019

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.

Authors and Affiliations

  • Jiangyong Qu
    • 1
    Email author
  • Ruxiao Wang
    • 1
  • Shanshan Wang
    • 1
  • Xiaoyu Guo
    • 1
  • Yutong Cui
    • 1
  • Yuanyuan Li
    • 1
  1. 1.College of Life SciencesYantai UniversityYantaiChina

Personalised recommendations