Advertisement

Conservation Genetics Resources

, Volume 10, Issue 2, pp 269–276 | Cite as

Microsatellite records for volume 10, issue 2

Microsatellite Records
  • 224 Downloads

Species

Locus

Primer sequence (5′–3′)

Repeat motif

Size range (bp)

Sample size (N)

Number of alleles (NA)

Ho (He)

Rhynchocypris oxycephalus

Ro01a

F:GGACCATGCCTTTGTGCATG

R:CGCGCGAACTAACAAGTTGA

(AT)12

258–300

30

4

1.000 (0.570)

Rhynchocypris oxycephalus

Ro17a

F:AGTCTGGACAAGTTGACGCT

R:GACGATTACGCGGATGAGGA

(TCC)6

191–212

30

7

0.530* (0.780)

Rhynchocypris oxycephalus

Ro25a

F:ACCCACAGAAAGGTGTGCAA

R:CCACTGCTTTTCAGATGCGT

(AC)9

116–152

30

9

1.000 (0.840)

Rhynchocypris oxycephalus

Ro39a

F:AGCTGTCGTCAAGGATTGGG

R:GCTCTGACGCTAATGCATGC

(AC)10

242–281

30

7

0.430 (0.580)

Rhynchocypris oxycephalus

Ro55a

F:GTTTCGTTTGCATGGCGACT

R:GACGAGCAGTGACAGACCAA

(TG)18

332–440

29

8

1.000 (0.840)

Rhynchocypris oxycephalus

Ro69a

F:GATCCCGCGAGAGGAAAACA

R:GGGAGATAGGGCCGACTGTA

(AC)11

240–336

30

11

1.000 (0.880)

Rhynchocypris oxycephalus

Ro77a

F:GAGTCTGTCTGGCCAAGCAT

R:GTATTGATCTGCCCCGTCCA

(AC)14

271–307

29

6

0.860 (0.800)

Rhynchocypris oxycephalus

Ro78a

F:TCCAGAGAGAGTCAGGCCAA

R:TGATCTGTGGTGCTCTGATGT

(AC)11

251–291

29

9

0.3...

Supplementary material

12686_2018_1046_MOESM1_ESM.zip (31 kb)
Supplementary material 1 (ZIP 31 KB)
12686_2018_1046_MOESM2_ESM.zip (23 kb)
Supplementary material 2 (ZIP 22 KB)
12686_2018_1046_MOESM3_ESM.zip (23 kb)
Supplementary material 3 (ZIP 23 KB)
12686_2018_1046_MOESM4_ESM.zip (20 kb)
Supplementary material 4 (ZIP 19 KB)
12686_2018_1046_MOESM5_ESM.zip (51 kb)
Supplementary material 5 (ZIP 51 KB)
12686_2018_1046_MOESM6_ESM.zip (23 kb)
Supplementary material 6 (ZIP 22 KB)

Copyright information

© Springer Science+Business Media B.V., part of Springer Nature 2018

Personalised recommendations