Advertisement

Conservation Genetics Resources

, Volume 8, Issue 2, pp 169–196 | Cite as

Microsatellite records for volume 8, issue 2

  • Dareen Almojil
  • Maria Cristina Arias
  • Rochelle R. Beasley
  • Yiyong Chen
  • Rulon W. Clark
  • Yinghui Dong
  • Zhiguo Dong
  • Natalie Forsdick
  • Elaine Françoso
  • E. González-Ortegón
  • A. M. González-Tizón
  • Linsheng Gui
  • Huayang Guo
  • Hongfang Guo
  • Marie L. Hale
  • Shigui Jiang
  • Kenneth L. Jones
  • Stacey L. Lance
  • Yi Lei
  • Jiuxuan Li
  • Xiaoyan Li
  • Haotian Li
  • Chuanwu Li
  • Xiaoying Li
  • Jiale Li
  • Zongqiang Lian
  • Zhiqiang Liang
  • Stinus Lindgreen
  • Tiantian Liu
  • Mingqiu Liu
  • Zhihong Liu
  • Xiaojun Liu
  • Yongqiang Lu
  • Tianshu Lv
  • Qingzhan Ma
  • Wenming Ma
  • A. Martínez-Lage
  • Melanie Massaro
  • Donghong Niu
  • A. Perina
  • Mauro Ramalho
  • Paulo Cseri Ricardo
  • Stephen E. Rice
  • Priscila Karla Ferreira Santos
  • Weilai Sha
  • Maise Silva
  • Zhaobin Song
  • Xiujun Sun
  • A. Vizcaíno
  • Yaning Wang
  • Xiaoyu Wang
  • Chongrui Wang
  • Chenghe Wang
  • Dawei Wei
  • Xudong Wu
  • Biao Wu
  • Xing Xiang
  • Shuyu Xue
  • Aiguo Yang
  • Xiping Yuan
  • Linsen Zan
  • Aibin Zhan
  • Nan Zhang
  • Dianchang Zhang
  • Huanxin Zhang
  • Jiupan Zhang
  • Le Zhang
  • Guangming Zhang
  • Honghai Zhang
  • Zaiyong Zhang
  • Guangming Zhang
  • Chao Zhao
  • Yu Zhou
  • Liqing Zhou
  • Kecheng Zhu
  • Wanchao Zhu
Microsatellite Records

Species

Locus

Primer sequence (5′–3′)

Repeat motif

Size range (bp)

Sample size (N)

Number of alleles (NA)

Ho (He)

Xylocopa abbreviata

Xa1a

F:CCTCGCGGGAACCAAGCTCC

R:GCGGTCGCGTCTCCAGGAAT

(CT)3CG(CT)2A(T)5(CT)13(T)2CT

Pop1 193–229

Pop2 221–229

Pop1 21

Pop2 20

Pop1 7

Pop2 5

Pop1 0.905 (0.774)

Pop2 0.450 (0.731)

Xylocopa abbreviata

Xa2a

F:AGACACGCGTAAACAGTGTAAAT

R:GGGCAATGTATCGTCTTACATCT

CT(TC)14AC(TC)2T2(TC)7CATC(T)2(TC)3

Pop1 252–282

Pop2 264–282

Pop1 21

Pop2 20

Pop1 10

Pop2 7

Pop1 0.905 (0.839)

Pop2 0.600 (0.698)

Xylocopa abbreviata

Xa3a

F:TTACAGGGACGCGCGAACGG

R:GTCGGTGGCACGGTCGTGAT

(GA)3A2(GA)A2(GA)18

Pop1 200–238

Pop2 202–210

Pop1 21

Pop2 20

Pop1 14

Pop2 2

Pop1 0.952 (0.892)

Pop2 0.100 (0.095)

Xylocopa abbreviata

Xa6a

F:ACCCTTTGGCTCGAAGCGAC

R:CCCCGCGAATATACTTGATACCGA

(CT)16CA(CT)3C2(CT)C2G(CT)3

Pop1 227–245

Pop2 229–235

Pop1 21

Pop2 20

Pop1 9

Pop2 4

Pop1 0.810 (0.837)

Pop2 0.550 (0.636)

Xylocopa abbreviata

Xa8a

F:CCGTCCTCCGAGCTTTCGCC

R:CCCTCTCCCGTCCGGTGGTT

(CT)4T2AC(CT)2AT(CT)10

Pop1...

Supplementary material

12686_2016_549_MOESM1_ESM.zip (24 kb)
Supplementary material 1 (ZIP 24 kb)
12686_2016_549_MOESM2_ESM.zip (26 kb)
Supplementary material 2 (ZIP 25 kb)
12686_2016_549_MOESM3_ESM.zip (16 kb)
Supplementary material 3 (ZIP 16 kb)
12686_2016_549_MOESM4_ESM.zip (14 kb)
Supplementary material 4 (ZIP 13 kb)
12686_2016_549_MOESM5_ESM.zip (28 kb)
Supplementary material 5 (ZIP 28 kb)
12686_2016_549_MOESM6_ESM.zip (18 kb)
Supplementary material 6 (ZIP 18 kb)
12686_2016_549_MOESM7_ESM.zip (19 kb)
Supplementary material 7 (ZIP 19 kb)
12686_2016_549_MOESM8_ESM.zip (14 kb)
Supplementary material 8 (ZIP 13 kb)
12686_2016_549_MOESM9_ESM.zip (55 kb)
Supplementary material 9 (ZIP 56 kb)
12686_2016_549_MOESM10_ESM.zip (14 kb)
Supplementary material 10 (ZIP 14 kb)
12686_2016_549_MOESM11_ESM.zip (16 kb)
Supplementary material 11 (ZIP 16 kb)
12686_2016_549_MOESM12_ESM.zip (23 kb)
Supplementary material 12 (ZIP 23 kb)
12686_2016_549_MOESM13_ESM.zip (28 kb)
Supplementary material 13 (ZIP 29 kb)
12686_2016_549_MOESM14_ESM.zip (12 kb)
Supplementary material 14 (ZIP 11 kb)

Copyright information

© Springer Science+Business Media Dordrecht 2016

Authors and Affiliations

  • Dareen Almojil
  • Maria Cristina Arias
  • Rochelle R. Beasley
  • Yiyong Chen
  • Rulon W. Clark
  • Yinghui Dong
  • Zhiguo Dong
  • Natalie Forsdick
  • Elaine Françoso
  • E. González-Ortegón
  • A. M. González-Tizón
  • Linsheng Gui
  • Huayang Guo
  • Hongfang Guo
  • Marie L. Hale
  • Shigui Jiang
  • Kenneth L. Jones
  • Stacey L. Lance
  • Yi Lei
  • Jiuxuan Li
  • Xiaoyan Li
  • Haotian Li
  • Chuanwu Li
  • Xiaoying Li
  • Jiale Li
  • Zongqiang Lian
  • Zhiqiang Liang
  • Stinus Lindgreen
  • Tiantian Liu
  • Mingqiu Liu
  • Zhihong Liu
  • Xiaojun Liu
  • Yongqiang Lu
  • Tianshu Lv
  • Qingzhan Ma
  • Wenming Ma
  • A. Martínez-Lage
  • Melanie Massaro
  • Donghong Niu
  • A. Perina
  • Mauro Ramalho
  • Paulo Cseri Ricardo
  • Stephen E. Rice
  • Priscila Karla Ferreira Santos
  • Weilai Sha
  • Maise Silva
  • Zhaobin Song
  • Xiujun Sun
  • A. Vizcaíno
  • Yaning Wang
  • Xiaoyu Wang
  • Chongrui Wang
  • Chenghe Wang
  • Dawei Wei
  • Xudong Wu
  • Biao Wu
  • Xing Xiang
  • Shuyu Xue
  • Aiguo Yang
  • Xiping Yuan
  • Linsen Zan
  • Aibin Zhan
  • Nan Zhang
  • Dianchang Zhang
  • Huanxin Zhang
  • Jiupan Zhang
  • Le Zhang
  • Guangming Zhang
  • Honghai Zhang
  • Zaiyong Zhang
  • Guangming Zhang
  • Chao Zhao
  • Yu Zhou
  • Liqing Zhou
  • Kecheng Zhu
  • Wanchao Zhu

There are no affiliations available

Personalised recommendations