Advertisement

Conservation Genetics Resources

, Volume 8, Issue 1, pp 43–81 | Cite as

Microsatellite records for volume 8, issue 1

  • Maria Cristina Arias
  • Stéphane Aulagnier
  • Erin F. Baerwald
  • Robert M. R. Barclay
  • Jacqueline Silva Batista
  • Rochelle R. Beasley
  • Rodrigo A. Bezerra
  • Frédéric Blanc
  • Eli S. Bridge
  • Maria Teresa Cabria
  • Lívia Izabela Caputo
  • Jie Chen
  • Jian-Hua Chen
  • Zhi Chen
  • Ching-Hung Chen
  • Pengfei Chu
  • Andrea Contina
  • Fausto Moreira da Silva Carmo
  • Leiliane Campos de Carvalho
  • Priscila Maria de Freitas Viana
  • Jeferson Luis Vasconcelos de Macêdo
  • Gabriel de Menezes Yazbeck
  • Zélia de Oliveira Teixeira
  • Natália de Souza Araujo
  • Gabriel Dequigiovanni
  • Shaoxiong Ding
  • Priscila Karla Ferreira Dos Santos
  • Holly B. Ernest
  • Yan-Wei Feng
  • Kyara Martins Formiga
  • Christine Fournier-Chambrillon
  • Elaine Françoso
  • Yaru Fu
  • Roderick B. Gagne
  • Fernanda A. Gaiotto
  • Tian-xiang Gao
  • Hongzi Ge
  • Taiming Ge
  • François Gillet
  • Yun Gong
  • Hong-mei Gong
  • Qiqiang Guo
  • Liang Guo
  • Liang Guo
  • Ryan J. Harrigan
  • Libo He
  • Carrie J. House
  • Chung- Der Hsiao
  • Rong Huang
  • Arati Iyengar
  • Xiayun Jiang
  • Hai-Lin Jiang
  • Tania A. Johnson
  • Kenneth L. Jones
  • Paulo Yoshio Kageyama
  • Jeffrey F. Kelly
  • Lydia Lam
  • Stacey L. Lance
  • Hong Li
  • Cheng Li
  • Fugui Li
  • Huie Li
  • Shaoke Li
  • Yongming Li
  • Mingming Li
  • Mingming Li
  • Fuhua Li
  • Wei-guo Li
  • Jitao Li
  • Jian Li
  • Xinru Li
  • Kai Liang
  • Yaosi Liang
  • Fuchu Liao
  • Lanjie Liao
  • Haoran Lin
  • Haoran Lin
  • Haoran Lin
  • Qiang Lin
  • Hong Liu
  • Honggao Liu
  • Lu Liu
  • Xiang-Quan Liu
  • Ping Liu
  • Chen Liu
  • Xin Liu
  • Maria Teresa Gomes Lopes
  • Danqi Lu
  • Ming-Bao Luan
  • Wei Luo
  • Zining Meng
  • Zining Meng
  • Johan R. Michaux
  • Mélanie Némoz
  • John P. Pollinger
  • Ye Qiao
  • Hongyue Qu
  • Santiago Linorio Ferreyra Ramos
  • Stephné Le Roux
  • Leandro Rodrigues Santiago
  • Xiaoyan Shao
  • Kang-Ning Shen
  • Heding Shen
  • Hao Shen
  • Thomas B. Smith
  • Dang-yu Song
  • Eric Sourp
  • Yiwen Sun
  • Huiyuan Tang
  • Qing Tang
  • Yiqin Tong
  • Marion van den Einden
  • Moniek J. C. van Hoppe
  • Elizabeth Ann Veasey
  • Corinne Vial-Novella
  • Li Wan
  • Xiaojun Wang
  • Yiming Wang
  • Yu Wang
  • Yaping Wang
  • Ruoran Wang
  • Xin Wang
  • Rifang Wang
  • Quanchao Wang
  • Guo-dong Wang
  • Jiajia Wang
  • Dongfeng Wang
  • Peipei Wang
  • Xiu-Mei Wei
  • Yanfei Wen
  • Haishen Wen
  • Xue-Ping Wu
  • Xin Wu
  • Jianhai Xiang
  • Zhenzhen Xie
  • Zhanning Xu
  • Pao Xu
  • Zhi Yang
  • Sen Yang
  • Sen Yang
  • Cece Yin
  • Shaowu Yin
  • Shaowu Yin
  • Yang Yu
  • Xiping Yuan
  • Gen Hua Yue
  • Gong-Gu Zang
  • Rafael Zardoya
  • Li-hui Zhang
  • Xiaojun Zhang
  • Yong Zhang
  • Guosong Zhang
  • Yan- di Zhang
  • Hongye Zhang
  • Guosong Zhang
  • Jie Zhao
  • Cheng Zhao
  • Fei Zhu
  • Hongchai Zhu
  • Shilong Zhu
  • Shuming Zou
Microsatellite Records

Species

Locus

Primer sequence (5′–3′)

Repeat motif

Size range (bp)

Sample size (N)

Number of alleles (NA)

Ho (He)

Synechogobius hasta

S-7170a

F:GGCTTTGCGATTTATCCTCA

R:CAGTGTACACAAGGGGGCTT

(AC)6)

178–288

32

16

0.594 (0.799)

Synechogobius hasta

S-9662a

F:CACCGTCCTTTTAGATCCCA

R:TGGAACTCAGGCCATAAAGG

(AC)7

248–256

32

5

0.656 (0.733)

Synechogobius hasta

S-12224a

F:TCCTCCCTGAGATTCCTCAA

R:TACCAAAAAGATGCACTGCG

(AT)6

180–188

32

5

0.594 (0.656)

Synechogobius hasta

S-12344a

F:TGATTGAGCCTTGATTTAGCG

R:GAGGCAAAGAAAGCCAAGTC

(AC)7

282–300

32

9

0.750 (0.818)

Synechogobius hasta

S-9829a

F:GCAACATCGATAGAAAGTGCC

R:CGCATAACAAAACTGATCCAAA

(AAT)6

246–263

32

10

0.625 (0.812)

Synechogobius hasta

S-12421a

F:TTCCGCTTCACTCACACTTG

R:AGTTTTAGCGCCATCTACCG

(TG)6

256–264

32

4

0.594 (0.477)

Synechogobius hasta

S-14128a

F:CATTTTCACCCGGTTCAGTT

R:GGAGACTCTGGGTCTGAACG

(TCC)5

186–216

32

11

0.750 (0.847)

Synechogobius hasta

S-8301a

F:ATATGCTGGAGGTGCCTCTG

R:AAGGGAAATCAGGGCTTCAT

(GTG)5

254–270

32

5

0.500 (0.486)

Synechogobius...

Supplementary material

12686_2016_522_MOESM1_ESM.zip (23 kb)
Supplementary material 1 Wang et al. Development and characterization of 42 novel polymorphic microsatellite markers from Synechogobius hasta EST sequences (ZIP 24 kb)
12686_2016_522_MOESM2_ESM.zip (41 kb)
Supplementary material 2 Wu et al. Isolation and characterization of 22 nuclear microsatellite markers for Platevindex mortoni (Mollusca: Gastropoda:Eupulmonata) based on transcriptome sequencing (ZIP 42 kb)
12686_2016_522_MOESM3_ESM.zip (32 kb)
Supplementary material 3 He et al. Charazterization of 27 polymorphic microsatellite markers in the Onychostoma sima isolated by next-generation sequencing (ZIP 33 kb)
12686_2016_522_MOESM4_ESM.zip (23 kb)
Supplementary material 4 Ramos et al. Microsatellite markers for Euterpe precatoria Mart. (Arecaceae) a palm species used by extractive traditional farmers of Amazon (ZIP 23 kb)
12686_2016_522_MOESM5_ESM.zip (32 kb)
Supplementary material 5 Liang et al. Development and characterization of 36 novel microsatellite loci in Coilia nasus (ZIP 32 kb)
12686_2016_522_MOESM6_ESM.zip (12 kb)
Supplementary material 6 Bezerra and Gaiotto. Development and characterization of microsatellite markers for Chaetomys subspinosus (Rodentia: Erethizontidae), an endangered species, endemic to the Brazilian Atlantic Rainforest (ZIP 13 kb)
12686_2016_522_MOESM7_ESM.zip (12 kb)
Supplementary material 7 Li et al. Development and characterization of 21 microsatellite markers for Spinibarbus caldwelli (Cyprinidae: Spinibarbus) (ZIP 13 kb)
12686_2016_522_MOESM8_ESM.zip (44 kb)
Supplementary material 8 Li et al. Development and characterization of 24 novel polymorphic microsatellites for the critically endangered plant Taihangia rupestris by transcriptome sequencing (ZIP 44 kb)
12686_2016_522_MOESM9_ESM.zip (22 kb)
Supplementary material 9 Moniek et al. Characterization of microsatellite markers in the hen harrier (Circus cyaneus) (ZIP 23 kb)
12686_2016_522_MOESM10_ESM.zip (69 kb)
Supplementary material 10 Zhu et al. Twenty-four novel tetranucleotide microsatellite markers for Epinephelus awoara (ZIP 70 kb)
12686_2016_522_MOESM11_ESM.zip (31 kb)
Supplementary material 11 Chen et al. Isolation and characterization of 28 polymorphic microsatellite markers of the Pacific seaweed pipefish Syngnathus schlegeli (ZIP 32 kb)
12686_2016_522_MOESM12_ESM.zip (12 kb)
Supplementary material 12 Gillet et al. Isolation, characterization and PCR multiplexing of polymorphic microsatellite markers in the endangered Pyrenean desman, Galemys pyrenaicus (ZIP 12 kb)
12686_2016_522_MOESM13_ESM.zip (27 kb)
Supplementary material 13 Contina et al. Genome-wide identification and characterization of simple sequence repeats in the painted bunting (Passerina ciris) for population and forensic analyses (ZIP 27 kb)
12686_2016_522_MOESM14_ESM.zip (25 kb)
Supplementary material 14 Viana et al. First set of polymorphic microsatellite markers for Brycon orbignyanus, an endangered Neotropical piracema fish species (ZIP 25 kb)
12686_2016_522_MOESM15_ESM.zip (14 kb)
Supplementary material 15 Li et al. Isolation and characterization of 36 novel EST-based microsatellite markers for blunt snout bream (Megalobrama amblycephala) based on transcriptome analysis (ZIP 15 kb)
12686_2016_522_MOESM16_ESM.zip (18 kb)
Supplementary material 16 Lam et al. Development of 24 polymorphic microsatellite loci for the threatened Southern (California) sea otter (Enhydra lutris nereis) (ZIP 19 kb)
12686_2016_522_MOESM17_ESM.zip (19 kb)
Supplementary material 17 Zhao et al. Development of 43 novel polymorphic microsatellite markers for Takifugu fasciatus and cross amplification in Takifugu xanthopterus (ZIP 19 kb)
12686_2016_522_MOESM18_ESM.zip (24 kb)
Supplementary material 18 Luo et al. Development of polymorphic microsatellite markers for an endangered fish, lined seahorse (Hippocampus erectus) (ZIP 25 kb)
12686_2016_522_MOESM19_ESM.zip (23 kb)
Supplementary material 19 Baerwald et al. Development of novel polymorphic microsatellite markers for two bat species affected by wind turbines, hoary bats (Lasiurus cinereus) and silver-haired bats (Lasionycteris noctivagans) (ZIP 24 kb)
12686_2016_522_MOESM20_ESM.zip (47 kb)
Supplementary material 20 Françoso et al. Microsatellite loci for Tetrapedia diversipes (Hymenoptera: Apidae) (ZIP 48 kb)
12686_2016_522_MOESM21_ESM.zip (9 kb)
Supplementary material 21 Jiang et al. Fifty new microsatellite markers in the grand jacknife clam Solen grandis (Dunker) isolated via Hiseq 2000 sequencing (ZIP 10 kb)
12686_2016_522_MOESM22_ESM.zip (13 kb)
Supplementary material 22 Tang et al. Characterization of 30 novel polymorphic genomic microsatellite markers for Boehmeria longispica Steud (ZIP 13 kb)
12686_2016_522_MOESM23_ESM.zip (20 kb)
Supplementary material 23 Wang et al. Isolation and characterization of microsatellite markers in the ridgetail white prawn Exopalaemon carinicauda (ZIP 21 kb)
12686_2016_522_MOESM24_ESM.zip (14 kb)
Supplementary material 24 Wen et al. Characterization of 23 polymorphic microsatellites in a marine fish white-spotted snapper (Lutjanus stellatus) (ZIP 15 kb)
12686_2016_522_MOESM25_ESM.zip (35 kb)
Supplementary material 25 Fu et al. Development of 26 nuclear microsatellites for red-listed endangered herb Sinopodophyllum hexandrum by next-generation sequencing (ZIP 36 kb)

Copyright information

© Springer Science+Business Media Dordrecht 2016

Authors and Affiliations

  • Maria Cristina Arias
  • Stéphane Aulagnier
  • Erin F. Baerwald
  • Robert M. R. Barclay
  • Jacqueline Silva Batista
  • Rochelle R. Beasley
  • Rodrigo A. Bezerra
  • Frédéric Blanc
  • Eli S. Bridge
  • Maria Teresa Cabria
  • Lívia Izabela Caputo
  • Jie Chen
  • Jian-Hua Chen
  • Zhi Chen
  • Ching-Hung Chen
  • Pengfei Chu
  • Andrea Contina
  • Fausto Moreira da Silva Carmo
  • Leiliane Campos de Carvalho
  • Priscila Maria de Freitas Viana
  • Jeferson Luis Vasconcelos de Macêdo
  • Gabriel de Menezes Yazbeck
  • Zélia de Oliveira Teixeira
  • Natália de Souza Araujo
  • Gabriel Dequigiovanni
  • Shaoxiong Ding
  • Priscila Karla Ferreira Dos Santos
  • Holly B. Ernest
  • Yan-Wei Feng
  • Kyara Martins Formiga
  • Christine Fournier-Chambrillon
  • Elaine Françoso
  • Yaru Fu
  • Roderick B. Gagne
  • Fernanda A. Gaiotto
  • Tian-xiang Gao
  • Hongzi Ge
  • Taiming Ge
  • François Gillet
  • Yun Gong
  • Hong-mei Gong
  • Qiqiang Guo
  • Liang Guo
  • Liang Guo
  • Ryan J. Harrigan
  • Libo He
  • Carrie J. House
  • Chung- Der Hsiao
  • Rong Huang
  • Arati Iyengar
  • Xiayun Jiang
  • Hai-Lin Jiang
  • Tania A. Johnson
  • Kenneth L. Jones
  • Paulo Yoshio Kageyama
  • Jeffrey F. Kelly
  • Lydia Lam
  • Stacey L. Lance
  • Hong Li
  • Cheng Li
  • Fugui Li
  • Huie Li
  • Shaoke Li
  • Yongming Li
  • Mingming Li
  • Mingming Li
  • Fuhua Li
  • Wei-guo Li
  • Jitao Li
  • Jian Li
  • Xinru Li
  • Kai Liang
  • Yaosi Liang
  • Fuchu Liao
  • Lanjie Liao
  • Haoran Lin
  • Haoran Lin
  • Haoran Lin
  • Qiang Lin
  • Hong Liu
  • Honggao Liu
  • Lu Liu
  • Xiang-Quan Liu
  • Ping Liu
  • Chen Liu
  • Xin Liu
  • Maria Teresa Gomes Lopes
  • Danqi Lu
  • Ming-Bao Luan
  • Wei Luo
  • Zining Meng
  • Zining Meng
  • Johan R. Michaux
  • Mélanie Némoz
  • John P. Pollinger
  • Ye Qiao
  • Hongyue Qu
  • Santiago Linorio Ferreyra Ramos
  • Stephné Le Roux
  • Leandro Rodrigues Santiago
  • Xiaoyan Shao
  • Kang-Ning Shen
  • Heding Shen
  • Hao Shen
  • Thomas B. Smith
  • Dang-yu Song
  • Eric Sourp
  • Yiwen Sun
  • Huiyuan Tang
  • Qing Tang
  • Yiqin Tong
  • Marion van den Einden
  • Moniek J. C. van Hoppe
  • Elizabeth Ann Veasey
  • Corinne Vial-Novella
  • Li Wan
  • Xiaojun Wang
  • Yiming Wang
  • Yu Wang
  • Yaping Wang
  • Ruoran Wang
  • Xin Wang
  • Rifang Wang
  • Quanchao Wang
  • Guo-dong Wang
  • Jiajia Wang
  • Dongfeng Wang
  • Peipei Wang
  • Xiu-Mei Wei
  • Yanfei Wen
  • Haishen Wen
  • Xue-Ping Wu
  • Xin Wu
  • Jianhai Xiang
  • Zhenzhen Xie
  • Zhanning Xu
  • Pao Xu
  • Zhi Yang
  • Sen Yang
  • Sen Yang
  • Cece Yin
  • Shaowu Yin
  • Shaowu Yin
  • Yang Yu
  • Xiping Yuan
  • Gen Hua Yue
  • Gong-Gu Zang
  • Rafael Zardoya
  • Li-hui Zhang
  • Xiaojun Zhang
  • Yong Zhang
  • Guosong Zhang
  • Yan- di Zhang
  • Hongye Zhang
  • Guosong Zhang
  • Jie Zhao
  • Cheng Zhao
  • Fei Zhu
  • Hongchai Zhu
  • Shilong Zhu
  • Shuming Zou

There are no affiliations available

Personalised recommendations