Food and Environmental Virology

, Volume 4, Issue 3, pp 89–92 | Cite as

Potential Risk of Norovirus Infection Due to the Consumption of “Ready to Eat” Food

  • Serracca Laura
  • Rossini Irene
  • Battistini Roberta
  • Goria Maria
  • Sant Serena
  • De Montis Gabriella
  • Ercolini Carlo
Original Paper

Abstract

In this study, we investigated the presence of enteric viruses such as norovirus (NoV), hepatitis A virus (HAV), hepatitis E virus (HEV), and adenovirus (HAdV), in vegetables available on the Italian markets. For this aim, 110 national and international “ready to eat” samples were collected and analyzed by biomolecular tests and positive samples were confirmed by sequencing. All samples (100 %) were negative for HAV, HEV, and HAdV, while 13.6 % (15/110) were positive for NoV. Actually there is not a formal surveillance system for NoV infections in Italy but we clearly demonstrated a potential risk associated with the consumption of “ready to eat” vegetables. This study confirmed for the first time in Italy the presence of norovirus in semi-dried tomatoes by PCR technique.

Keywords

Ready to eat food Sun-dried tomatoes Norovirus PCR 

Introduction

Viruses are increasingly recognized among the causes of foodborne outbreaks. In 2006, viral agents in Europe were reported to be for 10.2 % of foodborne outbreaks and were listed as the second most common etiologic agent, after Salmonella (EFSA 2007). It has been shown by Mead et al. (1999) that each year 67 % of the causes of acute gastroenteritis can be attributed to viral agents, thus representing the main cause. In developing countries, it has been clearly demonstrated that the viral outbreaks attributed to the consumption of fresh produce, whose cases were mostly attributed to enteric viruses such as norovirus (NoV), hepatitis A virus (HAV), human adenovirus (HAdV), and the hepatitis E virus (HEV). Recently there have been outbreaks caused by HAV in Australia (May 2009), New Zealand (May 2009), Netherlands (January 2010), and France (February 2010), as well as outbreaks due to NoV in Finland (2009) and Austria (2007) (Craven et al. 2009; Kuo et al. 2009; Maunula et al. 2009; Petrignani et al. 2010; Wadl et al. 2010). Vegetables may become contaminated by enteric viruses, during cultivation before harvest by contact with inadequately treated sewage or sewage polluted water. In addition much emphasis was also placed on the role of workers during processing, storage, distribution or final preparation (Koopmans and Duizer 2004). The importance of these routes of transmission of infection is supported by the studies that have demonstrated the possibility of transfer enteric viruses from the fingers of workers to the surface of fresh produce (10 s for a single contact) (Rzezutka and Cook 2004). The viruses does not replicate in the food but they have the ability to withstand for long periods without suffering any reduction in infectivity (Koopmans and Duizer 2004; Carter 2005) and so hygiene likely is a main requirement for microbiological quality. The purpose of this study was to verify the presence of enteric viruses in ready to eat vegetables and sun-dried tomatoes available on the Italian markets.

Materials and Methods

During April–July 2010 we performed viral testing on 110 “ready to eat” samples. Eighty were packaged leafy green, represented by salad in bags of Eruca sativa, Valerianella olitoria, and Lactuca sativa, of a well-known brand purchased from supermarket in La Spezia, Italy. Thirty samples were tomatoes: 25 sun-dried tomatoes in bulk (12 imported from Turkey, 13 from national production) and 5 in oil (all originated from Turkish crop), bought at the local open-air market. The countries of origin were determined by the marker’s label. The samples were collected weekly depending on the availability of markets. All samples were analyzed in duplicate by bio-molecular tests for HAV, NoV, HEV, and HAdV presence. The viral detection method used was based on the procedure described by CEN/TC275 WG6 N 465. In brief, 25 g of each sample were cut into small pieces and eluted with tris glycine 1 % beef extract buffer at pH 9.5. The eluate was concentrated with 5× PEG/NaCl solution and the viral nucleic acids were extracted and purified using commercial kits (Virus Nucleospin RNA kit, Macherey–Nagel and Purelink Genomic DNA kits, Invitrogen) based on the selective binding of nucleic acids to silica membranes. Reverse transcription of viral RNA was performed by adding 3 μl of nucleic acids extracted to 20 μl of mixture containing 1× Buffer (Fermentas), 5 mmol l−1 MgCl2 (Roche), 0.4 mM dNTPs (Fermentas), 2.5 μmol l−1 random hexamers, 5U Reverse transcriptase, and 20 U RNAsi inhibitor. The reaction conditions were 42 °C for 1 h and 95 °C for 10 min. The cDNA obtained was amplified for the detection of HAV with an heminested PCR using primers targeting the conserved VP1–VP3 capsid region (Le Guyader et al. 1994) (Table 1) according to a protocol previously published (Serracca et al. 2010). Negative and positive (strain HM175/18f HAV) samples were included in each amplification run. NoV detection was performed with a RT-booster PCR (Vinjé and Koopmans 1996) followed in case of positive samples by a specific RT—heminested PCR for the identification of genogroups I and II (Vennema et al. 2002) using in both cases specific primers targeting the RNA dependent RNA polymerase gene region (Table 1). Negative and positive control (NoV strain 548) samples were added to each amplification run. HEV RNA was amplified by a specific RT-nested PCR with two degenerate primer sets (Table 1) targeting the ORF2 region and the amplification conditions were the same of the original work (Erker et al. 1999; Di Bartolo et al. 2008). HAdV detection was carried out by the application of a nested PCR with primers containing a region encoding viral capsid protein components (Table 1). DNA extracts (10 μl) were directly added to the PCR mixture (40 μl) according to the previous study (Puig et al. 1994; Allard et al. 2001). Negative and positive controls were included as a control in each assay. PCR products (10 μl) were added to 2 μl of loading buffer 5× (Bio-Rad) and analyzed by electrophoresis method on a 2 % agarose gel (Cambrex Bioscience) at 120 V for 35 min (Bio-rad PowerPac basic). Gel Green 10000× (Biotium), was mixed to the gel for the PCR products visualization at the trans-lighting (Gel Doc Bio-Rad). DNA sequencing was performed as a confirmatory test. Sequencing was carried out directly on purified fragments with ABI 310 Genetic Analyzer (Applied Biosystems), using ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit, version 1.1 (Applied Biosystems). The nucleotide sequences were submitted to BLASTN (Altschul et al. 1990) sequence similarity search at the NCBI database and were aligned with the gene sequences available in GenBank database.
Table 1

Primers used for PCR analyses

Virus

Type of amplification

Primer

Sequence 5′–3′

Product size (bp)

Norovirus

Booster RT-PCR

JV12Y

ATACCACTATGATGCAGAYTA

326

JV13I

TCATCATCACCATAGAAIGAG

Norovirus GI

Heminested RT-PCR

JV13I

TCATCATCACCATAGAAIGAG

228

GI

TCNGAAATGGATGTTGG

Norovirus GII

Heminested RT-PCR

JV12Y

ATACCACTATGATGCAGAYTA

277

Ni-R

AGCCAGTGGGCGATGGAATTC

HEV

Nested RT-PCR

HEVORF1

GACAGAATTRATTTCGTCGGCTGG

145

HEVORF2

CTTGTTCRTGYTGGTTRTCATAA

HEVORF3

GTYGTCTCRGCCAATGGCGAGC

HEVORF4

GTTCRTGYTGGTTRTCATAATC

Adenovirus

Nested PCR

Hex1deg

GCCSCARTGGKCWTACATGCACATC

171

Hex2deg

CAGCACSCCICGRATGTCAAA

Hex3deg

GCCCGYGCMACIGAIACSTACTTC

Hex4deg

CCYACRGCCAGIGTRWAICGMRCYTTGTA

HAV

Nested RT-PCR

AV1

GGAAATGTCTCAGGTACTTTCTTTG

210

AV2

GTTTTGCTCCTCTTTATCATGCTATG

AV3

TCCTCAATTGTTGTGATAGC

Results

Within the limited number of samples analyzed, it was possible to detect the presence of NoV and the genotype; although all samples (100 %) tested negative for HAV, HEV, and HAdV, 13.6 % (15/110) were positive for NoV GII. All positive samples were tomatoes in bulk (12) and in oil (3) so already submitted to the tomatoes processing and therefore ready to eat (Table 2). The samples tested positive for NoV, were compared to GenBank sequences, unfortunately we were not able to sequence 4 samples but the other 11 samples matched to NoV most closely. Moreover, they matched the genotype GII-4 (AN: EU872461 and AN: AB447463), normally associated with gastroenteritis in humans.
Table 2

Number of positive samples found in semi-dried tomatoes by bio-molecular tests

Sample type

Country of origin

No. samples

PCR positive results

   

NoV

HAV

HEV

Adv

Dried tomatoes in bulk

Italy

13

6/13

0/25

0/25

0/25

Turkey

12

6/12

Dried tomatoes in oil

Turkey

5

3/5

0/5

0/5

0/5

Packaged leafy green

Italy

80

0/80

0/80

0/80

0/80

Discussion

Over the years outbreaks of NoV gastroenteritis have been mainly linked to shellfish consumption, recently also matrices like herbs and red fruits (Maunula et al. 2009) have been associated with these diseases. This study shows for the first time in Italy the detection of NoV in sun-dried tomatoes native and from Turkey. A limit due to this study is the inability to determine the infectivity of NoV found in the samples: the used methods highlight the presence of the nucleic acid of the virus but we cannot effort the vitality as the genomic RNA can persist after the virus has been inactivated and as there is no cell culture line for the laboratory growth of human NoV. A single infectious NoV has an estimated high probability of causing infection and the risk to human health is mainly present in those types of foods that do not require cooking before consumption (Teunis et al. 2008). Water quality used for agricultural irrigation and the hand of the professional working in the field affect the microbiological characteristics of products and therefore may pose a risk to the health of consumers. In particular, the transformation of sun-dried tomatoes is a process that requires much work and for this reason it is hard to detect the point-source of the viral contamination. Numerous studies have shown that enteric viruses can survive the processes usually applied to food before being put on the market and remain in a vital condition for long periods of time or at least longer than the shelf life of products (Craven et al. 2009; Butot et al. 2009; Doultree et al. 1999; Bidawid et al. 2000; Fraisse et al. 2011;) and these characteristics make it particularly dangerous to the health of the consumer. Despite this, only recently raw plant products are tested for viral contamination (Cheong et al. 2009) and these organisms are not yet considered in the regulations currently in force. Our study suggests a contact with NoV and the vegetables during the food chain but the viruses was only detected by bio-molecular technique, so it was not possible to determine the infectivity of the virus and to quantify the risk for human health. Despite the positive results, no outbreaks were noted by the local hospital. In order to protect the consumer it is necessary that the companies will undertake controls during the transformation of the products to prevent enteric virus contamination and it could be useful to start epidemiological studies for linking outbreaks with positivity to bio-molecular tests.

References

  1. Allard, A., Albisson, B., & Wadell, G. (2001). Rapid typing of human adenoviruses by a general PCR combined with restriction endo-nuclease analysis. Journal of Clinical Microbiology, doi: 10.1128/JCM.39.2.498-505.2001.
  2. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., & Lipman, D. J. (1990). Basic local alignment search tool. Journal of Molecular Biology, 215(3), 403–410.PubMedGoogle Scholar
  3. Bidawid, S., Farber, J. M., Sattar, S. A., & Hayward, S. (2000). Heat inactivation of Hepatitis A virus in diary foods. Journal of Food Protection, 63(4), 522–528.PubMedGoogle Scholar
  4. Butot, S., Putallaz, T., Amoroso, R., & Sanchez, G. (2009). Inactivation of enteric viruses in minimally processed berries and herbs. Applied and Environmental Microbiology. doi:10.1128/AEM00182-09.
  5. Carter, M.J. (2005). Enterically infecting viruses: pathogenicity, transmission and significance for food and waterborne infection. Journal of Applied Microbiology, doi:10.1111/J.1365-2672.2005.02635x.
  6. Cheong, S., Lee, C., Song, S.W., Choi, W.C., Lee, C.H., & Kim, S.J. (2009). Enteric viruses in raw vegetables and groundwater used for irrigation in South Korea. Applied and Environmental Microbiology, doi:10.1128/AEM.01629-09.
  7. Craven, H., Duffy, L., Fegan, N., & Hillier, A. (2009). Semi dried tomatoes and hepatitis A virus. CSIRO Food and Nutritional Sciences, Victoria. http://www.foodstandards.gov.au/_srcfiles/P1012%20Hep%20A%20in%20semi-dried%20tomatoes%20Initial%20Cons%20SD1.pdf.
  8. Di Bartolo, I., Martelli, F., Inglese, N., Pourshaban, M., Caprioli, A., Ostanello, F., et al. (2008). Widespread diffusion of genotype 3 hepatitis E virus among farming swine in Northern Italy. Veterinary Microbiology, doi:10.1016/j.vetmic.2008.04.028.
  9. Doultree, J. C., Druce, J. D., Birch, C. J., Bowden, D. S., & Marshall, J. A. (1999). Inactivation of feline calicivirus, a Norwalk virus surrogate. Journal of Hospital Infection, 41(1), 51–57.PubMedCrossRefGoogle Scholar
  10. Erker, J. C., Desai, S. M., & Mushahwar, I. K. (1999). Rapid detection of Hepatitis E virus RNA by reverse transcription-polymerase chain reaction using universal oligonucleotide primers. Journal of Virological Methods, 81(1–2), 109–113.PubMedCrossRefGoogle Scholar
  11. European Food Safety Authorities. (2007). The community summary report on trends and sources of zoonoses, zoonotic agents, antimicrobial resistance and foodborne outbreaks in the European Union in 2006. EFSA Journal, 130.Google Scholar
  12. Fraisse, A., Temmam, S., Deboosere, N., Guillier, L., Delobel, A., & Maris, P. (2011). Comparison of chlorine and peroxyacetic-based disinfectant to inactivate Feline calicivirus, Murine norovirus and Hepatitis A virus on lettuce. International Journal of Food Microbiology, 151(1), 98–104.PubMedCrossRefGoogle Scholar
  13. Koopmans, M., & Duizer, E. (2004). Foodborne viruses: an emerging problem. International Journal of Food Microbiology, doi:10.1016/S0168-1605(03)00169-7.
  14. Kuo, H. W., Schmid, D., Jelovcan, S., Pilcher, A. M., Magnet, E., Reichart, S., et al. (2009). A foodborne outbreak due to Norovirus in Austria, 2007. Journal of Food Protection, 72(1), 193–196.PubMedGoogle Scholar
  15. Le Guyader, F., Dubois, E., Menare, D., & Pommepuy, M. (1994). Detection of hepatitis A virus, rotavirus and enterovirus in naturally contaminated shellfish and sediment by reverse transcription-heminetsed PCR. Applied and Environmental Microbiology, 60(10), 3665–3671.PubMedGoogle Scholar
  16. Maunula, L., Roivaunen, M., Keranen, M., Makela, S., Soderberg, K., Summa, M., et al. (2009). Detection of human Norovirus from frozen raspberries in a cluster of gastroenteritis outbreaks. European Surveillance, 49(14):ppi 19435.Google Scholar
  17. Mead, P. S., Slutsker, L., Dietz, V., McCaig, L. F., Bresee, J. S., Shapiro, C., et al. (1999). Food-related illness and death in the United states. Emerging Infectious Diseases, 5(5), 607–625.PubMedCrossRefGoogle Scholar
  18. Petrignani, M., Harms, M., Verhoef, L., Van Hunen, R., Swaan, C., Van Steenbergen, J., et al. (2010). Update: A food-borne outbreak of hepatitis A in the Netherlands related to semi-dried tomatoes in oil, January–February 2010. European Surveillance, 20(15):19572.Google Scholar
  19. Puig, M., Jofre, J., Lucena, F., Allard, A., Waddel, G., & Girones, G. (1994). Detection of adenoviruses and enteroviruses in polluted waters by nested-PCR amplification. Applied and Environmental Microbiology, 60(8), 2963–2970.PubMedGoogle Scholar
  20. Rzezutka, A., & Cook, N. (2004). Survival of human enteric viruses in the environment and food. FEMS Microbiology Reviews, 28(4), 441–453.PubMedCrossRefGoogle Scholar
  21. Serracca, L., Gallo, F., Rossini, I., Benedetto, A., Lacerenza, D., Callipo, M. R., et al. (2010). Official surveillance of Hepatitis A virus: description of an HAV detection method in shellfish. Food and Environmental Virology,. doi:10.1007/s12560-009-9015-8.Google Scholar
  22. Teunis, P. F., Moe, C. L., Liu, P., Miller, S. E., Lindesmith, L., Baric, R. S., et al. (2008). Norwalk virus: how infectious is it? Journal of Medical Virology, 80(8), 1468–1476.PubMedCrossRefGoogle Scholar
  23. Vennema, H., De Bruin, E., & Koopmans, M. (2002). Rational optimization of generic primers used for Norwalk-like virus detection by reverse transcriptase polymerase chain reaction. Journal of Clinical Virology, 25(2), 233–235.PubMedCrossRefGoogle Scholar
  24. Vinjé, J., & Koopmans, M. (1996). Molecular detection and epidemiology of small round-structured viruses in a outbreaks of gastroenteritis in the Netherlands. The Journal of Infectious Diseases, 174(3), 610–615.PubMedCrossRefGoogle Scholar
  25. Wadl, M., Scherer, K., Nielsen, S., Diedrich, S., Ellerbroek, L., Frank, C., et al. (2010). Food-borne norovirus-outbreak at a military base, Germany, 2009. BMC Infectious Diseases,. doi:10.1186/1471-2334-10-30.PubMedGoogle Scholar

Copyright information

© Springer Science + Business Media, LLC 2012

Authors and Affiliations

  • Serracca Laura
    • 1
    • 3
  • Rossini Irene
    • 1
  • Battistini Roberta
    • 1
  • Goria Maria
    • 2
  • Sant Serena
    • 2
  • De Montis Gabriella
    • 1
  • Ercolini Carlo
    • 1
  1. 1.Marine Microbiology Laboratory of the Experimental Zooprophylactic Institute of Piemonte Liguria e Valle d’AostaLa SpeziaItaly
  2. 2.Molecular Microbiology and Genomic Analyses Laboratory of the Experimental Zooprophylactic Institute of Piemonte Liguria e Valle d’AostaTurinItaly
  3. 3.Laboratorio di Microbiologia Marina, Istituto Zooprofilattico SperimentaleSezione La SpeziaItaly

Personalised recommendations