Advertisement

Constitutively Expressed RB Gene Confers a High Level but Unregulated Resistance to Potato Late Blight

  • Lei Wu
  • Saowapa Duangpan
  • Pudota B. Bhaskar
  • Susan M. Wielgus
  • Jiming Jiang
Article
  • 97 Downloads

Abstract

The RB gene, which was cloned from the wild potato species Solanum bulbocastanum, confers a high level of broad spectrum resistance to various strains of Phytophthora infestans, the causal agent of potato late blight. The level of RB-mediated resistance is correlated with the amount of RB transcripts in transgenic potato lines containing RB gene(s) driven by its native promoter. To assess whether the level of RB-mediated resistance can be further enhanced by overexpression of the RB gene, multiple transgenic potato lines containing RB gene(s) driven by the cauliflower mosaic virus (CaMV) 35S promoter were developed. Surprisingly, all 35S::RB transgenic lines with one or several copies of the RB gene showed a similar level of late blight resistance. In parallel, a statistically similar amount of RB transcript was observed among all resistant transgenic lines with different copy numbers of the RB gene. In addition, the levels of RB gene transcription in the 35S::RB transgenic potato lines were the same or lower than in transgenic lines containing the RB gene driven by its native promoter. Thus, developing transgenic potato lines using RB with the native promoter will be the best approach to deploy this gene for combating late blight.

Keywords

RB gene 35S promoter Transgenic potato Late blight resistance 

Resumen

El gen RB, que fue clonado de la especie silvestre de papa Solanum bulbocastanum, confiere un alto nivel y amplio espectro de resistencia a variantes de Phytophthora infestans, el agente causal del tizón tardío de la papa. El nivel de la resistencia mediada por el RB esta correlacionada con la cantidad de transcriptos de RB en líneas de papa transgénica que contiene gen(es) RB impulsados por el promotor nativo. Para evaluar si el nivel de resistencia mediada por RB puede aumentarse más mediante su sobreexpresión, se desarrollaron múltiples líneas transgénicas de papa con gen(es) RB conducidos por el virus mosaico de la coliflor (CaMV) 35S como promotor. Sorpresivamente, todas las líneas transgénicas 35S::RB con una o varias copias del gen RB mostraron un nivel similar de resistencia al tizón tardío. Paralelamente, se observó una cantidad similar estadísticamente del transcripto RB entre todas las líneas transgénicas resistentes con diferente número de copias del gen RB. Además, los niveles de transcripción del gen RB en las líneas transgénicas de papa 35S::RB fueron los mismos o más bajos que en las líneas transgénicas con el gen RB impulsado por su promotor nativo. De aquí que el desarrollo de líneas transgénicas de papa usando RB con su promotor nativo será la mejor estrategia para utilizar este gen en el combate al tizón tardío.

Introduction

Potato late blight, caused by the oomycete Phytophthora infestans, is the most destructive potato disease in the world. Late blight causes losses of up to $14 billion annually in developing countries (Haverkort et al. 2009) due to the reduced yield, lower quality of the product, diminished storability, and increased cost associated with disease control (Nowicki et al. 2012). In developed countries, frequent fungicide applications have been the main approach to controlling this disease, which is both costly and a cause of significant environmental concerns (Haverkort et al. 2009). Development of potato cultivars with adequate resistance to P. infestans to avoid losses to late blight has been a major goal for the potato breeding community. Numerous late blight resistance (R) genes have been mapped and/or cloned from wild Solanum species (Nowicki et al. 2012; Rodewald and Trognita 2013; Witek et al. 2016; Chen et al. 2018), and some have been introgressed into cultivated potato. However, most of R genes provide resistance only to specific P. infestans strains, and such resistance is often quickly lost due to the evolving population dynamics of the late blight pathogen (Wastie 1991).

Solanum bulbocastanum is a wild diploid species with a high level resistance to late blight (Helgeson et al. 1998). The geographical distribution of S. bulbocastanum overlaps with the genetic diversity center of P. infestans (Grunwald and Flier 2005). Co-evolution of these organisms in the same environment has enabled S. bulbocastanum to develop durable resistance against P. infestans (Niederhauser and Millis 1953). Resistance screening of the S. bulbocastanum accessions stored at the United States Potato Genebank (http://www.ars-grin.gov/nr6/) revealed that all accessions had similar high levels of resistance to late blight (James Bradeen, personal communication). Four R genes have been cloned from S. bulbocastanum, including RB (also known as Rpi-blb1) (Song et al. 2003; van der Vossen et al. 2003), Rpi-blb2 (van der Vossen et al. 2005), Rpi-blb3 (Lokossou et al. 2009), and Rpi-bt1 (Oosumi et al. 2009). All four R genes belong to the NBS-LRR (nucleotide binding site-leucine rich repeat) class of resistance gene. RB, Rpi-blb2 and Rpi-blb3 encode proteins that recognize distinct P. infestans effectors that may be conserved in various P. infestans strains (Champouret et al. 2009; Halterman et al. 2010; Lokossou et al. 2009; Oh et al. 2009; Chen et al. 2012). Thus, potato plants containing these genes show broad-spectrum resistance against a variety of P. infestans strains.

The RB gene with its native promoter has been transferred into various potato cultivars (Bradeen et al. 2009; Halterman et al. 2008; Kuhl et al. 2007). It has been demonstrated that RB triggers an HR in both potato foliage and tuber challenged with P. infestans (Chen and Halterman 2011; Gao et al. 2013). However, individual transgenic potato lines often showed different levels of late blight resistance. Interestingly, the RB-mediated late blight resistance is positively correlated with the amount of RB transcripts in the transgenic lines (Bradeen et al. 2009; Kramer et al. 2009). Consequently, to assess the possibility of further enhancing the level of resistance by constitutively overexpressing the RB gene, an RB gene construct driven by the cauliflower mosaic virus (CaMV) 35S promoter was developed and used to develop multiple 35S::RB transgenic lines. We demonstrate that the 35S::RB transgenic potato lines did not provide improved late blight resistance compared to transgenic potato lines using RB with the native promoter.

Materials and Methods

Plant Materials

The potato cultivar Katahdin was transformed with a modified pMD1 vector, which contains the full length coding sequence of the RB gene driven by the CaMV 35S promoter. Transgenic Katahdin potato lines were generated using an Agrobacterium-mediated transformation method described previously (Bhaskar et al. 2008). In vitro clones of transgenic lines were propagated and maintained in tissue culture under a 16 h 23 °C/8 h 21 °C light/dark regime on a modified MS medium (Phytotechnology Labs, Shawnee Mission, KS) containing 3% sucrose and 0.2% phytogel. Transgenic lines and control plants were grown at the Biotron greenhouses of the University of Wisconsin-Madison, where plants were grown at 15 to 25 °C with a light (irradiance 500 μmol m−1 s−1) and dark cycle of 16 h and 8 h, respectively.

Southern Blot Hybridizations

Southern blot hybridization was performed according to published protocols (Stupar et al. 2002). Genomic DNA was isolated from leaf tissue using the CTAB method and was quantified using a Nanodrop (ThermoFisher Scientific, Hampton, NH). Approximately 15 μg DNA from each line was singly digested with EcoRΙ or HindIII. The digested DNA fragments were separated on a 0.8% agarose gel and were blotted on an N+ membrane (GE Healthcare Limited, Amersham Place, NA). The blots were probed with a 530 bp PCR fragment amplified from pMD1 using forward primers 5’TTTGTCAAGACCGACCTGTC and reverse primer 5’CCAACGCTATGTCCTGAT. This DNA probe hybridizes to the NPTII gene which is in the left border of the pMD1 vector. The blots were probed overnight at 65 °C, washed, and autographed with standard protocols (Sambrook and Russell 2001).

Late Blight Resistance Evaluation

The 35S:RB Katahdin lines along with the control lines; including Katahdin, S. bulbocastanum accession PT29, and transgenic Katahdin lines 951, 925 with full length genomic RB DNA (Kramer et al. 2009), were evaluated for late blight resistance in the Biotron greenhouses using P. infestans isolate US930287 (US-8 genotype, A-2 mating type). The inoculation and resistance evaluation were performed as described previously (Colton et al. 2006). All lines were grown in triplicate and placed in a mist chamber within Biotron greenhouse eight hours prior to inoculation. A daytime temperature between 17 and 19 °C and a nighttime temperature at 13–15 °C as well 100% humidity were set in the mist chamber. All lines used in inoculation studies were grown in triplicate and were randomly placed in a mist chamber five hours prior to inoculation. The mist chamber held a relative humidity of >90% for 24-h, a 16 h light period, a daytime temperature of 17 to 19 °C and a nighttime temperature of 13 to 15 °C. Three biological replicate inoculations were performed using the following sporangial concentrations: 6.8 × 104, 6.6 × 104, 6.7 × 104 sporangia ml−1, respectively. Measurements of foliar late blight were interpreted and scored according to the Malcolmson scale (Cruickshank et al. 1982). The scale was based on percent of foliage symptomatic and scores were as follows: 9 = no visible symptoms; 8 = <10% symptoms; 7 = 11–25%; 6 = 26–40%; 5 = 41–60%; 4 = 61–70%; 3 = 71–80%; 2 = 81–90%; 1 = >90%; 0 = 100% symptoms. Disease scores were recorded 4, 7 and 10 days after inoculation. An average score for resistance was determined using the three replicate plants of each clone in each inoculation experiment. Statistical analysis was performed using a t-test (two-sample, unequal variance, two-tailed distribution).

Quantification of RB Gene Transcription

Quantification of the RB transcript was performed on six independent 35S:RB lines along with the original Katahdin, and transgenic lines 951 and 925. Leaf samples were collected 1, 2, and 3 weeks after the tissue culture plants were transplanted into greenhouses. Leaf samples were also collected 5 h after the plants were placed in the mist chamber before inoculation, and again 1, 2, 3, and 5 days post inoculation (dpi). Three independent leaves were collected from each plant for RNA isolation. RNA was isolated using the Qiagen Plant RNeasy kit (Qiagen, Germantown, Maryland) according to the manufacturers’ instructions. To eliminate DNA contamination, total RNA samples were treated with TURBO DNA-free (Ambion, Austin, TX). First strand cDNA was synthesized from 2 μg DNase-treated total RNA using SuperScript III reverse transcriptase with random hexamers (Invitrogen, Carlsbad, CA). DYNAMO SYBR Green master mix (Finnzymes, New England Biolabs, Ipswich, MA) and MJ Research Opticon 2 (Bio-Rad Laboratories, Hercules, CA) were used for quantitative real-time (qRT) PCR assay. All lines for inoculation experiment were grown in triplicate. Three independent leaves were collected from each plant and were mixed for RNA isolation. The following protocol was performed for all qRT-PCR assays: 15 min at 95 °C, 40 cycles of 20 s at 94 °C, 20 s at the corresponding annealing temperature, 30 s at 72 °C, followed by a plate read, and then, a melting curve of 50 to 95 °C with 0.2 °C steps, hold for 2 s, followed by a final extension step of 10 min at 72 °C. Primers for the RB gene were: 5’-CACGAGTGCCCTTTTCTGAC-3’ and 5’-ACAATTGAATTTTTAGACTT-3’. The primers are located within the leucine-rich repeat (LRR) domain of the second exon of the RB gene with an amplicon of 213 bp. S. tuberosum Actin-97, TC164213 was used as a reference gene. Primers for the actin gene were: 5’-GATGGCAGACGGAGAGGA-3’ and 5’-GAGGACAGGATGCTCCTC-3’. All statistical analyses were performed for the delta Ct values using t-tests with unequal variance against the baseline (35S:RB Katahdin line L1 or week 1 WK1) performed in R statistical analysis environment (Yuan et al. 2006).

Results

Copy Numbers of the RB Gene in 35S::RB Transgenic Potato Lines

Potato cultivar Katahdin, which is highly susceptible to late blight, was transformed with the RB gene construct driven by the CaMV 35S promoter. We developed several transgenic potato lines using Agrobacterium-mediated transformation. Southern blot hybridization was performed on eleven independent transgenic lines to determine the copy number of the RB transgene. A 530 bp polymerase chain reaction (PCR) fragment, corresponding to the neomycin phosphotransferase-II region of the transgene construct, was used as a probe. Since this DNA fragment does not contain an EcoRI or HindIII restriction site, each Southern hybridization band from EcoRI- or HindIII-digested genomic DNA from the transgenic lines indicates an independent insertion of the RB gene. Among the eleven transgenic lines, six lines showed a single insertion of the RB gene, three lines showed 3–5 copies of the RB gene, and the remaining two lines contained approximately 10 copies of the RB gene (Fig. 1).
Fig. 1

Southern blot analysis of copy numbers of the RB gene in 35S::RB transgenic potato lines. Lanes 1: Genomic DNA digested with EcoRI; Lanes 2: Genomic DNA digested with HindIII. Transgenic lines L5, L7, L20, L14 and L19 were estimated to contain 1, 1, 5, 10, and 10 copies of the RB gene, respectively

Late Blight Resistance Evaluation of the 35S::RB Transgenic Lines

Late blight resistance evaluation was performed on whole plants of the eleven characterized 35S::RB transgenic lines along with resistant and susceptible controls in the Biotron greenhouses, where relative humidity of more than 90% was maintained to facilitate P. infestans growth and infection. Three individual plants of each line were included in each inoculation experiment, and three biological replicates of inoculation experiments were performed using P. infestans strain US930287 (US-8 genotype).

The inoculation experiments confirmed that a complete coding sequence (CDS) of the RB gene driven by the 35S promoter can provide strong resistance to P. infestans. Seven out of the eleven transgenic lines (L1, L7, L8, L10, L12, L13, L16) showed resistance to P. infestans, with mean resistance scores >6.5 by 10 days post inoculation (dpi) in all three inoculation experiments (Fig. 2). Transgenic line L5 showed a mean resistance rating of 5.89 ± 0.48, and was categorized as moderately resistant. These eight transgenic lines, as well as PT29, the RB gene donor plant of S. bulbocastanum, showed statistically significant differences (two tailed t-test with unequal variance, P < 0.01) in resistance rating compared to the Katahdin control treatment in all three inoculation experiments. L8 and L10 contained 3 to 4 copies of the RB gene, each of the remaining six lines contained a single RB gene.
Fig. 2

Greenhouse late blight resistance evaluation of 35S::RB transgenic Katahdin lines at 10 days post inoculation. P. infestans stain US930287 was used in all three independent inoculations. Disease was scored using a 0 to 9 scale by estimating the degree of foliage infected. L1 to L20 are the 35S::RB potato lines with different copy numbers of the RB transgene. Lines with one copy of RB: L1, L5, L7, L12, L13, L16; Lines with 3–4 copies of RB: L8, L10; Line with five copies of RB: L20; Lines with ~10 copies of RB: L14, L19. S. bulbocastanum accession PT29 and non-transgenic Katahdin (Kat) were used as positive and negative controls, respectively. The asterix marks all lines that show a significantly higher level resistance than the negative control

Three transgenic lines were susceptible to late blight in all three inoculation experiments. The mean resistance ratings of these three lines (L14, L19 and L20) were 3.00 ± 0.44, 2.89 ± 0.45, 2.11 ± 0.11, respectively. Interestingly, L20 contained 5 copies of the RB gene, whereas both L14 and L19 contained approximately 10 copies of the RB gene (Fig. 1).

Transcription of the RB Gene(s) in Transgenic Potato Lines

Our previous work showed that RB-mediated late blight resistance is correlated with transcript abundance of the RB transgene (Kramer et al. 2009). To evaluate the amount of RB transcripts in the 35S::RB lines, we conducted qRT-PCR analysis in six representative transgenic lines (L1, L5, L7, L8, L19, L20) that covered different copy numbers of the RB gene. Leaf tissues were collected 1 week (WK1), 2 weeks (WK2), and 3 weeks (WK3) after planting, from plants that received mist treatment, and from plants at 1 day, 3 days and 5 days post inoculation with P. infestans. The expression of the potato actin gene was used to normalize the relative abundance of the RB transcript within each line.

The transcription of the RB gene(s) was compared statistically at different growth stages within each transgenic line. The amount of RB transcripts detected at WK1 was used as the base expression level for comparison with the expression at other stages. The RB gene expression levels were statistically similar for L1, L5, L7, L19, and L20 at WK1, WK2 and WK3 after planting, showing no significant differences (two tailed t-test with unequal variance) (Fig. 3). A statistically significant increase of RB expression was noticed in L8 at WK2, but the expression was at the same level as WK1 by WK3. When the transgenic plants were inoculated with P. infestans, the amount of RB transcripts detected in the transgenic lines remained constant; no statistically significant differences were detected for all sampling time points in all lines, except L8 and L20 at 5 dpi (Fig. 3).
Fig. 3

Quantification of RB transgene transcription in 35S::RB transgenic lines during plant growth and after late blight inoculation. The amount of RB transcripts at WK1 within each line was used as the base expression level for comparison with expression at other stages. T-tests with unequal variance against the baseline (WK1) were performed in the R statistical analysis environment. Asterisk (*) indicate the samples that are statistically significantly different from the WK1 cycle threshold values based on a t-test (alpha = 0.05)

When comparing expression levels of the RB gene(s) in different 35S::RB transgenic lines at the same plant growth stages, the amount of RB transcripts detected in 35S::RB transgenic line L1, which contained a single RB transgene, was used as the base expression level for comparison. Katahdin RB transgenic lines 951 and 925 were included in the analysis as lines containing 1 and 3 copies of the RB transgene, respectively, driven by the native RB gene promoter (Kramer et al. 2009). Overall, the 35S::RB transgenic lines showed a similar RB transcript abundance when not inoculated with P. infestans or with mist inoculation alone (Fig. 4). However, significantly lower levels of RB transcription were detected in L20 at WK1 and when exposed to misting (Fig. 4). The low transcription level of L20 at one day post inoculation was confirmed by qRT-PCR analysis (Fig. 5). After P. infestans inoculation, a significant increase of RB transcription was detected in 951 at 1 dpi, and in 925 at 3 dpi, respectively. In contrast, RB expression levels remained consistent from 1 dpi to 5 dpi for all 35S::RB transgenic lines, regardless of the copy number of the RB transgene (Fig. 4).
Fig. 4

Quantification of RB gene transcription in different transgenic lines at eight different time points. The amount of RB transcripts in L1 was used as the baseline expression value for comparisons. Stars (*) indicate samples that are significantly different from the L1 cycle threshold values comparison expression value based on a t-test (alpha = 0.05)

Fig. 5

Detection of RB transcripts in 35S::RB Katahdin lines. qRT-PCR amplification (45 cycles) was performed at one day post inoculation and the PCR products were detected in 1% agarose gel. Lane C is the Katahdin control. A low amount of the RB transcript is shown in lane L20 (arrow)

Discussion

Activation of R gene-based defense can trigger a significant and energetically costly transcriptomic changes in host plants. Thus, R genes are ideally either silent or expressed at a very low basal level during the absence of their cognate pathogens. Indeed, expression of some NBS-LRR genes is either induced (Mohr et al. 2010; Yoshimura et al. 1998), or is enhanced only upon pathogen infection (Cai et al. 1997; Halterman et al. 2003; Levy et al. 2004; Liu and Ekramoddoullah 2011; Radwan et al. 2005). Overexpression of some NBS-LRR genes has proved to be deleterious to the plants, causing dwarfing, sterility and other growth defects (Stokes et al. 2002), or results in cell death caused by the R gene-induced hypersensitive response (Bendahmane et al. 2002). Interestingly, overexpression of some other NBS-LRR genes only enhances the disease resistance and does not cause visible phenotypic abnormalities (Cao et al. 2007; Oldroyd and Staskawicz 1998; Xiao et al. 2001). We did not observe any unambiguous abnormal phenotypes from the 35S::RB transgenic lines under the growing conditions in greenhouses. Interestingly, three 35S::RB transgenic lines were susceptible to late blight although RB transcripts were detected in these lines. It is possible that these lines, which contain multiple copies of the RB gene, produce only incomplete RB transcripts. These transcripts, however, can still be amplified by PCR. Similarly, loss of Prf-mediated tomato bacterial resistance was reported in transgenic tomato lines containing high copy numbers of the Prf gene (Oldroyd and Staskawicz 1998).

It is interesting to note that the RB expression levels in the 35S::RB transgenic lines developed in this study were not greater than those of transgenic lines 951 and 925 containing the native promoter (Fig. 4). These results suggest that the native promoter of the RB gene plays a key role in high and optimal levels of RB gene expression. Thus, transgenic RB lines using the native promoter should be used in deploying this gene in potato cultivars. We noticed that the increase of RB transcripts detected in lines 951 and 925 after inoculation with P. infestans was not as dramatic as observed in previous experiments (Kramer et al. 2009). The relatively low concentration of sporangia used in this study for inoculating potato plants (6.6×104 to 6.8×104 sporangia/ml) compared to previous experiments (8.6×104–13×104 sporangia/ml) may account for this difference in levels of RB transcripts. We have consistently observed that the different levels of late blight resistance detected among the RB transgenic lines with the native promoter were especially visible when a high concentration of sporangia was applied during greenhouse inoculation tests. In addition, we used a different P. infestans strain (US930287) in the current study. P. infestans strains may have differential competence for inducing/suppressing RB gene expression.

Although numerous NBS-LRR genes have been cloned and the mechanisms of NBS-LRR protein function have been studied extensively, there is very limited knowledge about the mechanisms of regulation of NBS-LRR gene expression. A recent report demonstrated that the expression of the Arabidopsis downy mildew resistance gene RPP8, an NBS-LRR gene, is induced by pathogen infection (Mohr et al. 2010). The promoter of the RPP8 gene contains three ‘W box’-associated cis elements that bind WRKY proteins. Mutation of all three W boxes greatly diminished RPP8 basal expression, inducibility, and resistance in transgenic plants (Mohr et al. 2010). The expression of the RB gene also is significantly enhanced upon infection of potato plants by the late blight pathogen (Kramer et al. 2009). Thus, the RPP8 and RB genes share similarities in transcription regulation. Interestingly, we detected three W boxes in the putative promoter region of the RB gene (Fig. 6). It will be interesting to assess if these W boxes play a similar role in the regulation of RB expression.
Fig. 6

W boxes in the RPP8 and RB genes. The promoter of the RPP8 gene contains three W boxes. Sequence changes from TTGACT to TTGAAT in the three boxes significantly diminished the function of the RPP8 gene (Mohr et al. 2010). Three W boxes were identified in the promoter of the RB gene

Notes

Acknowledgements

We thank James Bradeen and Dennis Halterman for valuable comments on the manuscript. This research was supported partially by Hatch funds to J.J. L.W. was partially supported by National Natural Science Foundation of China (NO.31300127) and Research Program of science and technology at Universities of Inner Mongolia Autonomous Region (NJZY12002). The experiments comply with the current laws of United States of America and People’s Republic of China in which they were performed.

References

  1. Bendahmane, A., G. Farnham, P. Moffett, and D.C. Baulcombe. 2002. Constitutive gain-of-function mutants in a nucleotide binding site-leucine rich repeat protein encoded at the Rx locus of potato. The Plant Journal 32: 195–204.CrossRefGoogle Scholar
  2. Bhaskar, P.B., J.A. Raasch, L.C. Kramer, P. Neumann, S.M. Wielgus, S. Austin-Phillips, and J.M. Jiang. 2008. Sgt1, but not Rar1, is essential for the RB-mediated broad-spectrum resistance to potato late blight. BMC Plant Biology 8: 8.CrossRefPubMedCentralGoogle Scholar
  3. Bradeen, J.M., M. Iorizzo, D.S. Mollov, J. Raasch, L.C. Kramer, B.P. Millett, S. Austin-Phillips, J.M. Jiang, and D. Carputo. 2009. Higher copy numbers of the potato RB transgene correspond to enhanced transcript and late blight resistance levels. Molecular Plant-Microbe Interactions 22: 437–446.CrossRefGoogle Scholar
  4. Cai, D.G., M. Kleine, S. Kifle, H.J. Harloff, N.N. Sandal, K.A. Marcker, R.M. KleinLankhorst, E.M.J. Salentijn, W. Lange, W.J. Stiekema, U. Wyss, F.M.W. Grundler, and C. Jung. 1997. Positional cloning of a gene for nematode resistance in sugar beet. Science 275: 832–834.CrossRefGoogle Scholar
  5. Cao, Y.L., X.H. Ding, M. Cai, J. Zhao, Y.J. Lin, X.H. Li, C.G. Xu, and S.P. Wang. 2007. Expression pattern of a rice disease resistance gene Xa3/Xa26 is differentially regulated by the genetic backgrounds and developmental stages that influence its function. Genetics 177: 523–533.CrossRefPubMedCentralGoogle Scholar
  6. Champouret, N., K. Bouwmeester, H. Rietman, T. van der Lee, C. Maliepaard, A. Heupink, P.J.I. van de Vondervoort, E. Jacobsen, R.G.F. Visser, E.A.G. van der Vossen, F. Govers, and V.G.A.A. Vleeshouwers. 2009. Phytophthora infestans isolates lacking class I ipiO variants are virulent on Rpi-blb1 potato. Molecular Plant-Microbe Interactions 22: 1535–1545.CrossRefGoogle Scholar
  7. Chen, Y., and D.A. Halterman. 2011. Phenotypic characterization of potato late blight resistance mediated by the broad-spectrum resistance gene RB. Phytopathology 101 (2): 263–270.CrossRefGoogle Scholar
  8. Chen, Y., Z. Liu, and D.A. Halterman. 2012. Molecular determinants of resistance activation and suppression by Phytophthora infestants effector IPI-O. PLoS Pathogens 8: e1002595.CrossRefPubMedCentralGoogle Scholar
  9. Chen, X., D. Lewandowska, M.R. Armstrong, K. Baker, T.-Y. Lim, M. Bayer, B. Harrower, K. McLean, F. Jupe, K. Witek, A.K. Lees, J.D. Jones, G.J. Bryan, and I. Hein. 2018. Identification and rapid mapping of a gene conferring broad-spectrum late blight resistance in the diploid potato species Solanum verrucosum through DNA capture technologies. Theoretical and Applied Genetics 131: 1287–1297.Google Scholar
  10. Colton, L.M., H.I. Groza, S.M. Wielgus, and J.M. Jiang. 2006. Marker-assisted selection for the broad-spectrum potato late blight resistance conferred by gene RB derived from a wild potato species. Crop Science 46: 589–594.CrossRefGoogle Scholar
  11. Cruickshank, G., H.E. Stewart, and R.L. Wastie. 1982. An illustrated assessment key for foliage blight of potatoes. Potato Research 25: 213–214.CrossRefGoogle Scholar
  12. Gao, L.L., Z.J. Tu, B.P. Millett, and J.M. Bradeen. 2013. Insight into organ-specific pathogen dedense responses in plants: RNA-seq analysis of potato tuber-Phytopghtora infestans interactions. BMC Genomics 14: 340.CrossRefPubMedCentralGoogle Scholar
  13. Grunwald, N. J., and W. G. Flier. 2005. The biology of Phytophthora infestans at its center of origin. Annual Review of Phytopathology 43: 171–190.Google Scholar
  14. Halterman, D.A., F.S. Wei, and R.P. Wise. 2003. Powdery mildew-induced Mla mRNAs are alternatively spliced and contain multiple upstream open reading frames. Plant Physiology 131: 558–567.CrossRefPubMedCentralGoogle Scholar
  15. Halterman, D.A., L.C. Kramer, S. Wielgus, and J.M. Jiang. 2008. Performance of transgenic potato containing the late blight resistance gene RB. Plant Disease 92: 339–343.CrossRefGoogle Scholar
  16. Halterman, D.A., Y. Chen, J. Sopee, J. Berduo-Sandoval, and A. Sanchez-Perez. 2010. Competition between Phytophthora infestans effectors leads to increased aggressiveness on plants containing broad-spectrum late blight resistance. PLoS One 5: e10536.CrossRefPubMedCentralGoogle Scholar
  17. Haverkort, A.J., P.C. Struik, R.G.F. Visser, and E. Jacobsen. 2009. Applied biotechnology to combat late blight in potato caused by Phytophthora infestans. Potato Research 52: 249–264.CrossRefGoogle Scholar
  18. Helgeson, J.P., J.D. Pohlman, S. Austin, G.T. Haberlach, S.M. Wielgus, D. Ronis, L. Zambolim, P. Tooley, J.M. McGrath, R.V. James, and W.R. Stevenson. 1998. Somatic hybrids between Solanum bulbocastanum and potato: a new source of resistance to late blight. Theoretical & Applied Genetics 96: 738–742.CrossRefGoogle Scholar
  19. Kramer, L.C., M.J. Choudoir, S.M. Wielgus, P.B. Bhaskar, and J.M. Jiang. 2009. Correlation between transcript abundance of the RB gene and the level of the RB-mediated late blight resistance in potato. Molecular Plant-Microbe Interactions 22: 447–455.CrossRefGoogle Scholar
  20. Kuhl, J.C., K. Zarka, J. Coombs, W.W. Kirk, and D.S. Douches. 2007. Late blight resistance of RB transgenic potato lines. Journal of the American Society for Horticultural Science 132: 783–789.Google Scholar
  21. Levy, M., O. Edelbaum, and I. Sela. 2004. Tobacco mosaic virus regulates the expression of its own resistance gene N. Plant Physiology 135: 2392–2397.CrossRefPubMedCentralGoogle Scholar
  22. Liu, J.J., and A.K.M. Ekramoddoullah. 2011. Genomic organization, induced expression and promoter activity of a resistance gene analog (PmTNL1) in western white pine (Pinus monticola). Planta 233: 1041–1053.CrossRefGoogle Scholar
  23. Lokossou, A.A., T.H. Park, G. van Arkel, M. Arens, C. Ruyter-Spira, J. Morales, S.C. Whisson, P.R.J. Birch, R.G.F. Visser, E. Jacobsen, and E.A.G. van der Vossen. 2009. Exploiting knowledge of R/Avr genes to rapidly clone a new LZ-NBS-LRR family of late blight resistance genes from potato linkage group IV. Molecular Plant-Microbe Interactions 22: 630–641.CrossRefGoogle Scholar
  24. Mohr, T.J., N.D. Mammarella, T. Hoff, B.J. Woffenden, J.G. Jelesko, and J.M. McDowell. 2010. The Arabidopsis downy mildew resistance gene RPP8 is induced by pathogens and salicylic acid and is regulated by W box cis elements. Molecular Plant-Microbe Interactions 23: 1303–1315.CrossRefGoogle Scholar
  25. Niederhauser, J.S., and W.R. Millis. 1953. Resistance of Solanum species to Phytophthora infestans in Mexico. Phytopathology 43: 456–457.Google Scholar
  26. Nowicki, M., M.R. Foolad, M. Nowakowska, and E.U. Kozik. 2012. Potato and tomato late blight caused by Phytophthora infestans: an overview of pathology and resistance breeding. Plant Disease 96: 4–17.CrossRefGoogle Scholar
  27. Oh, S.K., C. Young, M. Lee, R. Oliva, T.O. Bozkurt, L.M. Cano, J. Win, J.I.B. Bos, H.Y. Liu, M. van Damme, W. Margan, D. Choi, E.A.G. Van der Vossen, V. Vleeshouwers, and S. Kamoun. 2009. In planta expression screens of Phytophthora infestans RXLR effectors reveal diverse phenotypes, including activation of the Solanum bulbocastanum disease resistance protein Rpi-blb2. The Plant Cell 21: 2928–2947.CrossRefPubMedCentralGoogle Scholar
  28. Oldroyd, G.E.D., and B.J. Staskawicz. 1998. Genetically engineered broad-spectrum disease resistance in tomato. Proceedings of the National Academy of Sciences of the United States of America 95: 10300–10305.CrossRefPubMedCentralGoogle Scholar
  29. Oosumi, T., D.R. Rockhold, M.M. Maccree, K.L. Deahl, K.F. McCue, and W.R. Belknap. 2009. Gene Rpi-bt1 from Solanum bulbocastanum confers resistance to late blight in transgenic potatoes. American Journal of Potato Research 86: 456–465.CrossRefGoogle Scholar
  30. Radwan, O., S. Mouzeyar, P. Nicolas, and M.F. Bouzidi. 2005. Induction of a sunflower CC-NBS-LRR resistance gene analogue during incompatible interaction with Plasmopara halstedii. Journal of Experimental Botany 56: 567–575.CrossRefGoogle Scholar
  31. Rodewald, J., and B. Trognita. 2013. Solanum resistance genes against Phytophthora infestans and their corresponding avirulence genes. Molecular Plant Pathology 7: 740–757.CrossRefGoogle Scholar
  32. Sambrook, J., and D.W. Russell. 2001. Molecular cloning: A laboratory manual. Cold Spring Harbor: Cold Spring Harbor Laboratory Press.Google Scholar
  33. Song, J., J.M. Bradeen, S.K. Naess, J.A. Raasch, S.M. Wielgus, G.T. Haberlach, J. Liu, H. Kuang, S. Austin-Phillips, C.R. Buell, J.P. Helgeson, and J. Jiang. 2003. Gene RB cloned from Solanum bulbocastanum confers broad spectrum resistance to potato late blight. Proceedings of the National Academy of Sciences of the United States of America 100: 9128–9133.CrossRefPubMedCentralGoogle Scholar
  34. Stokes, T.L., B.N. Kunkel, and E.J. Richards. 2002. Epigenetic variation in Arabidopsis disease resistance. Genes & Development 16: 171–182.CrossRefGoogle Scholar
  35. Stupar, R.M., J.Q. Song, A.L. Tek, Z.K. Cheng, F.G. Dong, and J.M. Jiang. 2002. Highly condensed potato pericentromeric heterochromatin contains rDNA-related tandem repeats. Genetics 162: 1435–1444.PubMedCentralGoogle Scholar
  36. van der Vossen, E., A. Sikkema, B.L. Hekkert, J. Gros, P. Stevens, M. Muskens, D. Wouters, A. Pereira, W. Stiekema, and S. Allefs. 2003. An ancient R gene from the wild potato species Solanum bulbocastanum confers broad-spectrum resistance to Phytophthora infestans in cultivated potato and tomato. The Plant Journal 36: 867–882.CrossRefGoogle Scholar
  37. van der Vossen, E.A.G., J. Gros, A. Sikkema, M. Muskens, D. Wouters, P. Wolters, A. Pereira, and S. Allefs. 2005. The Rpi-blb2 gene from Solanum bulbocastanum is an Mi-1 gene homolog conferring broad-spectrum late blight resistance in potato. The Plant Journal 44: 208–222.CrossRefGoogle Scholar
  38. Wastie, R.L. 1991. Phytophthora infestans, the cause of late blight of potato - breeding for resistance. San Diego: Academic Press.Google Scholar
  39. Witek, K., F. Jupe, A.I. Witek, D. Baker, M.D. Clark, and J.D.G. Jone. 2016. Accelerated cloning of a potato late blight–resistance gene using RenSeq and SMRTRT sequencing. Nature Biotechnology 34: 656–660.CrossRefGoogle Scholar
  40. Xiao, S.Y., S. Ellwood, O. Calis, E. Patrick, T.X. Li, M. Coleman, and J.G. Turner. 2001. Broad-spectrum mildew resistance in Arabidopsis thaliana mediated by RPW8. Science 291: 118–120.CrossRefGoogle Scholar
  41. Yoshimura, S., U. Yamanouchi, Y. Katayose, S. Toki, Z.X. Wang, I. Kono, N. Kurata, M. Yano, N. Iwata, and T. Sasaki. 1998. Expression of Xa1, a bacterial blight-resistance gene in rice, is induced by bacterial inoculation. Proceedings of the National Academy of Sciences of the United States of America 95: 1663–1668.CrossRefPubMedCentralGoogle Scholar
  42. Yuan, J.S., A. Reed, F. Chen, and C.N. Stewart. 2006. Statistical analysis of real-time PCR data. BMC Bioinformatics 7: 85.CrossRefPubMedCentralGoogle Scholar

Copyright information

© The Potato Association of America 2018

Authors and Affiliations

  1. 1.Inner Mongolia Potato Engineering and Technology Research CentreInner Mongolia UniversityHohhotPeople’s Republic of China
  2. 2.IMU-UW Potato Research CenterInner Mongolia UniversityHohhotPeople’s Republic of China
  3. 3.Department of HorticultureUniversity of Wisconsin-MadisonMadisonUSA
  4. 4.Department of Plant Science, Faculty of Natural ResourcesPrince of Songkla UniversitySongklaThailand
  5. 5.Department of Plant BiologyMichigan State UniversityEast LansingUSA
  6. 6.Department of HorticultureMichigan State UniversityEast LansingUSA

Personalised recommendations