Introduction

The plasmodium of Physarum polycephalum (true slime mold) is a multinucleate cell with active shuttle streaming of the cytoplasm [1]. The plasmodium moves around in search of bacteria and grows rapidly [1]. The plasmodium forms a microplasmodium in nutrient-rich liquid media, and grows into a macroplasmodium on agar plates [1]. However, the plasmodium differentiates into a cyst and becomes a dormant body in an environment adverse to growth such as dark starvation (DS). The cyst formed by the micro or macroplasmodium is called spherule (Sp) or sclerotium (Sc), and shows no active shuttle streaming of the cytoplasm [1]. Recently, we reported an experimental system with high synchrony in Sp formation from the microplasmodium under DS conditions. We induced Sp formation from microplasmodia using this system, and Sp formation was then confirmed within 36–48 h [2]. Furthermore, Sc formation from macroplasmodia with high synchrony has not been reported except in our report [3].

In our previous studies, we reported an acid phosphatase [EC 3.1.3.2] in the macroplasmodial cytoplasmic soluble fraction of P. polycephalum [4,5,6]. Furthermore, the acidic phosphatase was found to have changed its relative activity in the process of Sp formation from the microplasmodium under DS conditions [7]. The specific dephosphorylation activity of the extracted phosphatase toward p-nitrophenyl phosphate (p-NPP) was assayed at pH 5.0 during synchronous Sc formation from macroplasmodia during DS in P. polycephalum Ng-1 [6]. After 1 day of DS, enzymatic activity toward p-NPP increased by nearly twofold, and then decreased to levels below to the original after 3.5 days [6]. Phosphatase activity in Sc formation from synchronized macroplasmodium under DS conditions was accurately assayed for the first time. Two distinct enzyme activity bands were observed in a plasmodial phosphatase preparation upon native polyacrylamide gel electrophoresis (PAGE) [6]. These results indicate that the phosphatase has at least two isoforms, which we named as E1 and E2 [6]. The isoform E1 showed a peak of phosphatase activity in the process of Sc formation from the macroplasmidium. Thus, isoform E1 was predicted to be involved in Sc formation under DS [6].

Recently, we established a purification method for isoform E1 [9]. Purification of E1 was performed from the macroplasmodium of P. polycephalum using ion exchange column and hydrophobic column chromatography, and isoform E1 was then separated and extracted by native PAGE [8, 9]. The molecular mass of the enzyme E1 purified from macroplasmodia was estimated to be 50 kDa by gel filtration column chromatography [9]. Finally, the phosphatase activity indicated that 400 pkatals (pkat)/mg of protein, and was purified 340-fold [9]. Among the activities of the purified enzyme E1 assayed at pH 7.6, the hydrolytic activity of the nucleotide phosphate compound was not detected [9]. Although the hydrolysis activity of enzyme E1 was detected toward the phosphorylated myosin light chain (PLCM) at pH 7.6, dephosphorylation activity toward the PLCM was not observed at pH 5.0 [9]. The Km value for the hydrolysis activity of enzyme E1 for PLCM was 10 μM [9]. The Vmax of E1 was 1.17 nkat/mg protein [9]. This enzyme characterization showed that the Physarum phosphatase E1, which hydrolyses the Physarum PLCM, could be classified into the serine/threonine protein phosphatase 1 (PP1) category of PP1-like phosphatases [10]. Therefore, we concluded that the enzyme E1 purified from plasmodia of Physarum is a novel protein exhibiting hydrolytic activity for PLCM [9].

We also determined that the rapid increase in the phosphatase activity of E1 toward PLCM at pH 7.6 preceded Sc formation in plasmodia of Physarum [9]. It was thus suggested that the phosphatase activity of E1 (phosphatase E1) toward PLCM at pH 7.6 plays an important role in the process of Sc formation in plasmodia under DS, which was described in the previous report [6] (Suppl. Fig. 1).

To demonstrate this assumed role of phosphatase E1 (PPH), we attempted to clarify this phenomenon at the molecular level using Physarum microplasmodia in this study. As the first step, we generated recombinant Physarum PLCM. We then determined the enzymatic activity toward PLCM and the gene expression of PPH during Sp formation. In the second step, we performed molecular cloning of PPH and generated a specific antibody against PPH. To correlate its profile with protein accumulation, western blot analysis was performed using a 50 kDa band that corresponded to PPH. These results enabled us to propose that the physiological function of Physarum PPH is related to the cessation of cytoplasmic shuttle streaming that precedes Sp formation from Physarum microplasmodia.

Materials and Methods

Culture Conditions

Microplasmodia of the P. polycephalum Ng-1 strain were used in all experiments of this study. Sp formation of Physarum microplasmodia during DS was induced as described previously [11]. Every 0.1 days after initiation of DS in the microplasmodial cultures, four drops containing ~30 microplasmodia each were randomly taken from the culture, and the number of Sps formed was counted. The velocity of cytoplasmic streaming occurring in the microplasmodia was measured under a stereomicroscope every 0.1 days after initiation of DS in the microplasmodial cultures.

Enzyme Extraction

Enzyme extraction from microplasmodia and Sps during DS was carried out as described previously [9]. The enzyme extract from the band of crude enzyme fraction in the native PAGE, corresponding to a rate of Rm 0.6 (E1), was named extracted PPH and the enzymatic activity toward PLCM was assayed.

Purification of Physarum Plasmodial Acid Phosphatase

Purification of the acid phosphatase from macroplasmodia of Physarum was performed from the macroplasmodium of P. polycephalum using ion exchange column and hydrophobic column chromatography, and isoform E1 (Rm 0.6) was then separated and extracted by native PAGE [8], as described previously [9]. The purified enzyme E1 is hereafter called PPH.

N-terminal Amino Acid Partial Sequencing

For analysis of the N-terminal amino acid sequence of Physarum microplasmodial PPH, it was subjected to sodium dodecyl sulfate (SDS)-PAGE using the described method [12], electroblotted to a polyvinylidene difluoride (PVDF) membrane (Millipore Corporation, Billerica, MA, USA) [13], and stained with Coomassie brilliant blue (CBB) R-250 for protein detection. The N-terminal amino acid sequence of the protein was determined using an automated protein sequence analyzer (Mode 492/14C, Applied Systems, Foster City, CA, USA).

3′-RACE of Phosphatase E1 (PPH)

Total RNA from Physarum microplasmodia (10 g fresh weight) was extracted using the acid guanidium phenol chloroform method [14]. The total RNA was further purified with an RNeasy Total RNA kit (QIAGEN, Valencia, CA, USA). Next, 3′ rapid amplification of cDNA ends (3′-RACE) was performed using a ThermoScript RT-PCR System (Invitrogen, Carlsbad, CA, USA). cDNA was synthesized at 50 °C for 1 h and 55 °C for 1 h, using 10 µg of total RNA in a 60 µl reaction mixture containing 1.0 mM deoxynucleotides (dNTPs), 5 µM dithiothreitol (DTT), 120U RNase OUT, 45U ThermoScript reverse transcriptase, and 0.17 µM of an oligodeoxythymidylic acid (oligo dT) M13-M4 adapter primer in the supplied cDNA synthesis buffer. The resulting cDNAs were subjected to polymerase chain reaction (PCR) in a 50 µl reaction mixture containing 1.25 U EX Taq DNA polymerase (Takara Bio, Japan), 2 µM M13-M4 primer, and 2 µM GSP1 primer, ((Fig. 1(4)) 5′-GGNTAYACNWSNGTNGCNAARGAYTTT-3′, which was designed based on the N-terminal amino acid sequence, GYTSVAKDF. The amplification conditions were as follows: 95 °C for 4 min, 30 cycles of 95 °C for 10 s, 55 °C for 30 s, and 72 °C for 3 min using a thermal cycler (TP240; Takara Bio, Japan). Using the reaction products as a template, nested PCR was performed with 2 µM of M13-M4 primer and 2 µM of another degenerate primer, (GSP2), (Fig. 1(5)), 5′-AARGAYTTYGGNGARATHWSNATHAARAT-3′, designed from the N-terminal amino acid sequence, KDFGEISIKI. The amplification conditions were as follows: 95 °C for 4 min, 30 cycles of 95 °C for 10 s, 55 °C for 30 s, and 72 °C for 3 min using a thermal cycler (TP240; Takara Bio, Japan). The PCR products obtained from nested PCR were purified on an agarose gel and extracted with a GENECLEAN Turbo Kit (Qbiogene Inc., Carlsbad, CA, USA), and cloned into a TA-cloning vector, pGEM-T Easy (Promega Corp., Fitchburg, WI, USA), according to the manufacturer’s instructions. Nucleotide sequences of the isolated clones were determined with an automated fluorescence-based sequencer, ABI PRISM 310 (PE Applied Biosystems, Foster City, CA, USA), using the universal primer T7, 5′-TAATACGACTCACTATAGGG-3′, the universal primer SP6, 5′-CAAGCTATTTAGGTGACACTATAG-3′, and the primers GSP-F1, GSP-F2, and GSP- R1, respectively, which were designed based on the partial nucleotide sequence of the clones: primer GSP-F1, (Fig. 1(6)), 5′-ATCACTCTGGTTCGTTTTGGCTCCC-3′, primer GSP-F2, (Fig. 1(7)), 5′-GTTATGTGCCGGTCCTAACCAATTA-3′, and primer GSP-R1 (Fig. 1(8)), 5′-TTTGCACTTTCCAGTCATTTCCAGT-3′. The obtained plasmid was called pGEM/ 3′-Pase.

Fig. 1
figure 1

Complementary DNA and deduced amino acid sequences of Physarum PPH. Noncoding regions at the 3′ end are underlined, (1) The noncoding region at the 5′ end is underlined, (2) The deduced amino acids determined from the N-terminal amino acids of PPH are underlined, (3) All PCR primers are indicated by underlining from 4–11: (4) GSP1 primer, 5′-GGNTAYACNWSNGTNGCNAARGAYTTT-3′, (5) GSP2 primer, 5′-AARGAYTTYGGNGARATHWSNATHAARAT-3′, (6) GSP-F1 primer, 5′-ATCACTCTGGTTCGTTTTGGCTCCC-3′, (7) GSP-F2 primer, 5′-GTTATGTGCCGGTCCTAACCAATTA-3′, (8) GSP R1 primer, 5′-TTTGCACTTTCCAGTCATTTCCAGT-3′. (9) GSP3 primer, 5′-AAATATTTTGAAAAAGATGCATCGAGCCTGTTAC-3′, (10) GSP4 primer, 5′-CCAAAAAATGGAATATAAGCACTCT-3′, (11) GSP5 primer, 5′-CCATAAAACGTTAGTCTCTGGAG-3′ (refer to the Materials and methods section for details). (s) PPH sense primer: 5′-CGTGAACCCTAGCTTGAGCCAA-3′. (a) PPH antisense primer: 5′-AGGGTAGTCATCATTTGGTGCAAAG-3′

Full size image

PPH obtained by pGEM/3′-Pase was subcloned into a PCR-Plunt II TOPO vector (Invitrogen Life Technologies, Carlsbad, CA, USA) using a primer that was constructed by adding the SacI cleavage site to the 5′-terminal region of the open reading fragment of the PPH cDNA, and the SP6 primer, 5′-CAAGCTATTTAGGTGACACTATAG-3′. After the PCR product was treated with SacI and EcoRI, it was ligated to pColdI (Takara Bio, Japan) for expression. The obtained plasmid was called pColdI/3′-Pase.

5′-RACE of Phosphatase E1 (PPH)

5′ rapid amplification of cDNA ends (5′-RACE) was performed using the 5′-RACE System Version 2.0 (Invitrogen Life Technologies, Carlsbad, CA, USA). First-strand cDNA was synthesized from 4.5 µg of total RNA prepared from Physarum microplasmodia in a 25 µl reaction mixture containing 0.4 µM GSP3 primer (Fig. 1(9)), 5′-AAATATTTTGAAAAAGATGCATCGAGCCTGTTAC-3′, 1.0 mM dNTP mix, 2.5 mM MgCl2, 10 mM DTT, and 200 U SuperScript II Reverse Transcriptase, incubated at 42 °C for 50 min. Next, first-strand cDNA was incubated in a 25 µl mixture with 5× Tailing buffer and 0.2 mM dCTP at 94 °C for 3 min, and then at 37 °C for 10 min, with TdT added for tailing the control first strand cDNA. The dT-added first strand cDNA was used as a template for PCR amplification in a 50 µl mixture containing 0.4 µM primer I, GSP4 (Fig. 1(10)), which corresponds to the cDNA sequence obtained by 3′-RACE, 5′-CCAAAAAATGGAATATAAGCACTCT-3′, and 0.4 µM primer II, an abridged anchor primer, 5′-GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG-3′, with Takara Ex-Taq DNA polymerase premix. The amplification conditions were as follows: 30 cycles of 95 °C for 10 s, 55 °C for 20 s, and 72 °C for 3 min. The resulting PCR product was used as a template for the second nested PCR amplification with primer I, an abridged universal primer, 5′-GGCCACGCGTCGACTAGTAC-3′, and primer II, GSP5 (Fig. 1(11)), 5′-CCATAAAACGTTAGTCTCTGGAG-3′.

Cloning and nucleotide sequencing were carried out as described in the methods section for -. The obtained plasmid was called pGEM/5′-Pase.

Synthesis of Full-length cDNA

After pColdI/3′-Pase and pGEM/5′-Pase was digested in a 60 µl mixture containing 10× buffer and SacI, the mixture was purified on Sephacryl S 400 (Promega Corp. Fitchburg, WI, USA). Each mixture was then treated with BgIII. After pGEM/5′-Pase was dephosphorylated using Antarctic phosphatase (New England Biolabs, Ipswich, MA, USA), the dephosphorylated pGEM/5′-Pase and pColdI/3′-Pase were respectively excised from agarose gels. The bacterial expression plasmid obtained by subcloning the pGEM/5′-Pase product of PPH into the 3′ regions of the pColdI/3′-Pase of the partial cDNA clone was named as pColdI/ PPH.

The nucleotide sequences of the full-length cDNA were determined using an automated fluorescence-based sequencer, ABI PRISM 310 (PE Applied Biosystems, Foster City, CA, USA).

The determined cDNA sequence was registered with the DNA Data Bank of Japan (DDBJ)/European Molecular Biology Laboratory (EMBL)/GenBank (Accession No. AB262522). basic local alignment search tool programs were used to search for homologs against nucleotide sequence databases and to deduce the amino acid sequence (http://blast.ncbi.nlm.nih.bov/Blast.cgi).

Real-time PCR

Real-time PCR using total RNA from Physarum microplasmodia and Sps was conducted with a SYBR Green PrimeScriptTM RT reagent Kit (Takara Bio, Japan). Physarum actin mRNA was used as a control. Primers used for Physarum actin mRNA were: sense, GCCATGTACGTCGCCATCCA, and antisense, AGATGGGCACAGTGTGGGAGA. Primers used for PPH were: sense, CGTGAACCCTAGCTTGAGCCAA, and antisense, AGGGTAGTCATCATTTGGTGCAAAG.

The amplified nucleotide sequence of the mRNAs was detected using the ABI PRISM 7500 Fast Sequence Detection System (PE Applied Biosystems, Foster City, CA, USA).

Expression of Recombinant PPH in Escherichia coli

The pColdI/PPH was transformed into E. coli BL21 (DE3) codon plus PR (Stratagene, La Jolla, CA) cells. An overnight 3 ml culture from a single colony was grown at 37 °C in LB medium containing 100 mg/l of ampicillin, and was then transferred to 1 L of LB supplemented with ampicillin. Gene expression was induced by adding 1 mM isopropyl-thio-β-D-galactoside to the culture, when the OD600 was 0.5. The culture was incubated at 16 °C with 200 rpm for 24 h. After induction, cells were harvested by centrifugation at 5000 rpm for 15 min at 4 °C and were then frozen at −80 °C. Cells were washed in 1 ml water, and centrifuged at 12,000 rpm for 5 min at 4 °C. Precipitates were resuspended in 0.1 ml extraction buffer (50 mM sodium phosphate, 300 mM NaCl, 150 mM imidazole, and 1% lysozyme, pH 7.0) and allowed to stand on ice for 1 h. Then, the cell lysate was disrupted by sonication at 4 °C and centrifuged at 12,000 rpm for 5 min. The rPPH in the insoluble fraction was solubilized using 0.3% and 0.5% sarkosyl. The solubilized rPPH was used for SDS-PAGE analysis and was used to determine dephosphorylation activity against PLCM.

Antibody Production

The recombinant protein of rPPH was injected into rabbits two times at 2-week intervals. The antibody against PPH from the sera of immunized rabbits was affinity-purified with rPPH blotted onto a PVDF membrane (Millipore, Billerica, MA, USA). The antibody was then called as the specific antibody against rPPH.

Western Blotting

Total lysate of Physarum microplasmodia and Sps was prepared by homogenization with 50% trichloro-acetic acid and SDS-PAGE sample buffer containing 6.25 mM Tris-HCl (pH 6.8, 2% SDS, 5% beta mercapto-ethanol, 5% sucrose, and 0.02% bromophenol blue, followed by boiling. The lysate was subjected to SDS-PAGE and then transferred onto a PVDF membrane. Immunosignals of Physarum PPH were detected using the specific antibody against rPPH as the primary antibody, and horseradish peroxidase (HRP) conjugated donkey anti-rabbit IgG (Amersham Biosciences Corp. Piscatway, NJ, USA) as the secondary antibody, with the enhanced chemiluminescence (ECL) system (Amersham Biosciences, Piscatway, NJ, USA). Physarum plasmodial actin was used as the endogenous control. Detection of the P.plasmodial actin signal was performed using mouse anti-actin monoclonal antibody (Chemicon International, Temecula, CA, USA) as the primary antibody, and HRP conjugated donkey anti-mouse (H + L) IgG antibody (Jackson ImmunoResearch Laboratories, PA, USA) as the secondary antibody with the ECL system. Relative protein content was calculated by densitometry using image analysis software (Lane and Spot Analyzer Ver.6.01 WLSA, ATTO Corp., Tokyo, Japan), after scanning the film obtained after detection with the ECL system.

Expression of Recombinant Protein in the Wheat Germ Cell-free System

The recombinant phosphatase E1 (rWPPH) was produced using the wheat germ cell-free system (ENDONET Technology Wheat Germ Expression Premium Kit, CellFree Sciences, Japan). PCR was performed using a primer containing a BamHI cleavage site in the 5′-terminal region of the protein-coding region of the PH cDNA, and a primer containing the KpnI cleavage site at the 3′-terminal region. Next, the DNA insert containing the PPH coding sequence was isolated from the PCR product by double digestion with BamHI and KpnI, and then subcloned into the pEU-E01-His expression vector (CellFree Sciences, Japan) at the same restriction sites. The resulting plasmid was named pEU-E01-His-PPH. The expression of rWPPH was performed using the wheat germ expression system according to the manufacturer’s instructions. The solubilized rWPPH was used for SDS-PAGE analysis, western blotting analysis, and to determine the dephosphorylation activity against PLCM. The expression vector pEU-E01-DHFR, encoding the dihydrofolate reductase gene derived from E. coli was used as a positive control for protein expression. The expression vector pEU-E01-MCS was used as a negative control for protein expression.

Assay for Phosphatase Activity toward PLCM

PLCM was prepared using the recombinant light chain of Physarum myosin II (LCM), as described previously [15]. Phosphatase activity toward PLCM was assayed using 0.011 mM PLCM and 17 mM Tris-HCl (pH 7.6) in a final volume of 15 µl at 30 °C, as described previously [9]. After the enzyme reactions were terminated by 15 mg of urea powder, the electrophoretically phosphorylation level of LCM was determined by urea glycerol-PAGE according to the method described [16], with some previously described modifications [17]. The phosphorylation ratio of phosphorylated LCM/LCM released was used to determine the amount of inorganic phosphate (Pi) released. Enzymatic activity was measured in katals (kat), with one katal means as the amount of activity that converts one mole of substrate per second. Alternatively, enzyme activity was shown as Pi released per 60 min per milliliter of enzyme solution, in “Expression of recombinant protein in the wheat germ cell-free system and enzyme activity.”

Other Procedures

Native PAGE was performed in a nondenaturing buffer using 7.5% (w/v) polyacrylamide slab gels at 4 °C according to a previously described method [8]. The band representing phosphatase activity was localized using a reaction mixture containing Fast B salt and alpha-naphthyl disodium salt as a substrate. The developed gels were stored in 7% acetic acid. SDS-PAGE was carried out in 12% polyacrylamide gels containing 0.1% SDS, as described [12]. The separated protein bands were stained with CBB R-250 (Sigma-Aldrich, St. Louis, MO, USA). The size markers (Amersham Biosciences, Piscataway, NJ, USA) were myosin (220 kDa), phosphorylase (97 kDa), bovine serum albumin (BSA, 66 kDa), egg ovalbumin (45 kDa), carbonic anhydrase (30 kDa), soybean trypsin inhibitor (20.1 kDa), and alpha-lactalbumin (14.4 kDa). The velocity of cytoplasmic streaming of plasmodia was measured under a stereomicroscope (Olympus C011, Olympus, Japan) with an ocular micrometer and an objective micrometer.

Statistical Analyses

Data are presented as mean ± standard deviation (SD). Independent experiments were carried out four times in principle.

Results

cDNA Cloning and Sequence

The full-length cDNA of PPH was 1367 bp long and contained 38- and 85-bp noncoding regions at the 5′ (Fig. 1(2)) and 3′ end (Fig. 1(1)), respectively. The complete sequence shows an ORF of 1245 bp corresponding to 415 amino acids. The deduced amino acids from the 60 bp at the 5′-terminal, G-Y-T-S-V-A-K-D-F-G-E-I-S-I-K-I-T-T-D-Y, were consistent with the amino acids determined from the N-terminal of PPH (Fig. 1(3)).

In the nucleotide sequence of cDNA shown in Fig. 1, the nucleotide sequence of GSP1 primer (Fig. 1(4)) GSP2 primer (Fig. 1(5)), GSP-F1 primer (Fig. 1(6)), GSP-F2 primer (Fig. 1(7)), and GSP-R1 primer (Fig. 1(8)), which was used to perform the 3′-RACE, was detected. The nucleotide sequence of GSP3 primer (Fig. 1(9)), GSP4 primer (Fig. 1(10)), and GSP5 primer (Fig. 1(11)), which was used to perform the 5′-RACE, was also detected. Either the sense or antisense primer (Fig. 1(s, a)) was demonstrated in the nucleotide sequence of the cDNA. Both the sense and antisense primers for real-time PCR were also demonstrated in the cDNA nucleotide sequence (Fig. 1(s, a)).

Expression of Recombinant Protein in E. coli

The rPPH expressed in E. coli was insoluble. Therefore, the insoluble fraction was solubilized using 0.3% and 0.5% sarkosyl (Fig. 2a). The solubilized rPPH was ~49 kDa (Fig. 2b) and was used to determine the dephosphorylation activity against PLCM. Although the enzyme activity was assayed for 18 h at 30 °C, no activity was detected (data not shown).

Fig. 2
figure 2

Expression of the recombinant protein, rPPH in E. coli. a The expressed rPPH in the insoluble fraction was solubilized with 0.3% and 0.5% sarkosyl. b Detection of rPPH in the solubilized fraction (Sup., ~10 µg protein per lane) and insolubilized fraction (Ppt., ~10 µg per protein per lane) was performed by SDS-PAGE. SDS-PAGE was performed using 12% polyacrylamide gels containing 0.1% SDS. The separated protein bands were stained with CBB. The size markers (Amersham Biosciences, Ltd) were phosphorylase (97 kDa), bovine serum albumin (BSA, 66 kDa), egg ovalbumin (45 kDa), carbonic anhydrase (30 kDa), soybean trypsin inhibitor (20.1 kDa), and alpha-lactalbumin (14.4 kDa). An arrow indicates rPPH

Full size image

Profiles of Extracted PPH Activity toward PLCM, Velocity of Cytoplasmic Streaming, and Expression of PPH during Sp Formation

Approximately 90% of the microplasmodia showed Sps after 0.8 days from the start of DS (Fig. 3a). The velocity of cytoplasmic streaming was decreased rapidly (by ~15% of the maximal activity) within 0.5 days of Sp formation and vanished within 0.8 days of Sp formation (Figs. 3a, b and 4b).

Fig. 3
figure 3

Profiles of the extracted PPH activity toward PLCM, velocity of cytoplasmic streaming, and mRNA expression of PPH during Sp formation. a Profiles of the extracted PPH activity toward PLCM and velocity of cytoplasmic streaming during Sp formation of Physarum plasmodia. Every 0.1 days after initiation of DS in the microplasmodial cultures, four drops containing ~30 microplasmodia each were randomly taken from the culture, and the number of Sps formed was counted. The open diamond indicates Sp formation (%). The enzyme activity of the isoform of Rm 0.6, which corresponds to the extracted PPH, toward PLCM was measured after the enzyme extraction. The filled circle indicates the enzymatic activity toward PLCM. The velocity of cytoplasmic streaming occurring in microplasmodia was measured under a stereomicroscope equipped with ocular and objective micrometers (Olympus C011, Olympus) at every 0.1 days after the initiation of DS in the microplasmodial cultures. The filled square indicates the velocity of cytoplasmic streaming in the microplasmodia. Error bars indicate the standard deviation (n = 4). b Profiles of PPH mRNA expression in Physarum microplasmodia during Sp formation. Every 0.1 days after the initiation of DS in the microplasmodial cultures, 0.5 g fresh weight of microplasmodia was harvested. Total RNA isolated from the microplasmodia was used for real-time PCR analysis with gene-specific primers. Physarum actin mRNA was used as the control. The filled squares indicate the relative expression level of the mRNA per gram dry weight of microplasmodia (%) and the open diamonds indicate Sp formation (%), as described in a. Error bars indicate the standard deviation (n = 4)

Full size image
Fig. 4
figure 4

Profiles of PPH protein expression during Sp formation. a Western blot analysis profiles of PPH expression in Physarum microplasmodia during Sp formation. Every 0.1 days after the initiation of DS in the microplasmodial cultures, 0.5 g fresh weight of microplasmodia was harvested. The total lysate of Physarum microplasmodia prepared was probed with the specific antibody against rPPH (top). Immunosignals for Physarum microplasmodia actin were detected as the control (bottom). b Densitometric analysis profiles of band intensity after western blot analysis for PPH expression in Physarum microplasmodia during Sp formation. The total cell lysate of the Physarum microplasmodia prepared was probed with the specific antibody against rPPH. Protein contents were normalized to Physarum microplasmodia actin and were analyzed by densitometry. Filled diamonds indicate the relative protein expression level per gram dry weight of microplasmodia (%); open diamonds indicate Sp formation (%), as described in Fig. 3a Error bars indicate the standard deviation (n = 4)

Full size image

We assayed the phosphatase activity of the extracted PPH toward PLCM at pH 7.6, every 0.1 days during the 0.8 days of Sp formation (Fig. 3a). The enzyme activity per gram dry weight was increased by approximately sixfold (1.5 nkat/g dry weight) within 0.5 days after DS. However, within 0.8 days, the enzyme activity was decreased by ~75% (1.1 nkat/g dry weight) of the maximal activity shown within 0.5 days.

Next, we addressed the expression of PPH in Physarum microplasmodia. The expression levels of PPH evaluated by real-time PCR are depicted in Fig. 3b. During Sp formation, the expression of PPH mRNA was increased, starting from a low basal expression at 0 days and reaching a maximum within 0.5 days. Within 0.8 days, the expression of PPH mRNA was decreased by ~20% of the maximal level shown within 0.5 days.

To correlate this profile with protein accumulation, we performed western blot analysis. As shown in Fig. 4a, a band of 50 kDa protein, corresponding to PPH, was visible in the total lysate of Physarum microplasmodia. Its intensity was faint at 0 days and increased gradually within 0.5 days; it then decreased within 0.8 days. During the assay period, the levels of expressed Physarum plasmodial actin remained unchanged, as indicated by western blotting in Fig. 4a.

Densitometric analysis of band intensity, taking the 0.5 days sample as 100, revealed that the 50 kDa protein of PPH increased from 10 at the start of DS, to 60 within 0.3 days and reached a maximum within 0.5 days, according to the increase in enzyme activity reached at the maximum. Moreover, the band intensity decreased to 80 within 0.8 days (Fig. 4b). The increase in phosphatase activity toward PLCM, PPH expression, and PPH accumulation were strongly specific to the Sp formation of Physarum microplasmodia.

Expression of Recombinant Protein in the Wheat Germ Cell-free System and Enzyme Activity

As we could not obtain the active form of PPH using the bacterial expression system, we tried to express rWPPH using the eukaryotic wheat germ cell-free expression system. We were able to express soluble rWPPH and detected a single protein band of ~50 kDa by SDS-PAGE (Fig. 5a). No difference in size was observed between rWPPH and the endogenous PPH described previously [9]. We confirmed rWPPH expression by western blot analysis using the specific antibody against rPPH (Fig. 5b), because no signal was detected with the analysis performed in the three negative controls of wheat germ extract, the expression vector pEU-E01-MCS, and pEU-E01-DHFR.

Fig. 5
figure 5

SDS-PAGE (a) and western blot (b) analysis of the rWPPH expressed in the wheat germ cell-free system. a SDS-PAGE analysis of rWPPH expressed in the wheat germ cell-free system. The expressed rWPPH (0.8 µg protein in each lane) was subjected to SDS-PAGE in 12% polyacrylamide gels under reducing conditions and was stained with CBB. Phosphorylase b (97 kDa), bovine serum albumin (66 kDa), ovalbumin (45 kDa), carbonic anhydrase (30 kDa), trypsin inhibitor (20.1 kDa), and lysozyme (14.3 kDa) were used as the molecular size markers (Amersham Biosciences). A single protein band of ~50 kDa was detected by CBB staining on the gel. b Western blot analysis of rWPPH expressed in the wheat germ cell-free system using the specific antibody against rPPH. The expressed rWPPH (0.8 µg protein in each lane) separated by SDS-PAGE was analyzed by western blotting. The analysis was performed along with three negative controls of wheat germ extract, the expression vector pEU-E01-DHFR and the expression vector pEU-E01-MCS

Full size image

We investigated the phosphatase activity of rWPPH toward PLCM for 60 min at 30 °C. As shown in Fig. 6, the enzyme activity increased proportionally to the reaction time within 60 min of the start of incubation; however, no hydrolytic activity toward PLCM was detected with the three negative controls of the wheat germ extract, the expression vector pEU-E01-MCS, and pEU-E01-DHFR.

Fig. 6
figure 6

Phosphatase activities of rWPPH expressed in the wheat germ cell-free system toward PLCM. The phosphatase activity of the rWPPH expressed in the wheat germ cell-free system toward PLCM was measured for 60 min. Filled circles indicate the rWPPH expressed in the wheat germ cell-free system. Open diamonds indicate the three negative controls of wheat germ extract, the expression vector pEU-E01-DHFR, and the expression vector pEU-E01-MCS, because none of the negative controls showed enzymatic activity toward PLCM. Error bars indicate the standard deviation (n = 8)

Full size image

Discussion

Primary Structure of PPH

The nucleotide sequence from every primer used to perform the 3′-RACE and 5′-RACE for cDNA cloning was detected. This indicates that the obtained cDNA encodes PPH. The deduced protein was predicted to have a molecular mass of 44,493 Da and to carry 23 N-glycosylation sites on asparagine residues. PPH might be a glycoprotein because it can bind the Con A affinity column, as shown previously [9]. This supposition was confirmed by the 23 N-glycosylation sites obtained from the cDNA sequence in this study. Amino acid sequence homology of PPH with other phosphatases has not been detected, suggesting that PPH is a novel phosphatase that hydrolyses PLCM, as described previously [9]. The amino acid sequence from 3 to 191 was found homologous to that of a plant protein with unknown function (DUF946 domain, [18]). The plant was Poplus tricocarpa × Poplus deltoides, the cDNA of which was from a hybrid reported in a wound-induced leaf cDNA library as EST Data [19]. The homologous region of the amino acid sequence covered the N-terminal sequence. Moreover, PPH showed the ~45% identity with DUF946 when examining the total amino acids sequence identities. This suggests that the poplar protein is likely a phosphatase. The calculated molecular mass of PPH deduced amino acids from the cDNA sequence was 44,493 Da, which is considerably smaller than that of the purified PPH from Physarum plasmodia (~50 kDa), as described previously [9]. The deduced protein carried 23 N-glycosylation sites at asparagine residues; thus, the molecular mass of PPH obtained from SDS-PAGE and analytical gel filtration [9] was larger than that calculated from the deduced amino acids possibly owing to the sugar moieties attached to the asparagine residues.

The expressed rPPH was insoluble; therefore, the insoluble fraction was solubilized with sarkosyl to determine phosphatase activity. However, phosphatase activity was not detected in the expressed rPPH. This result indicates that the protein expressed in E. coli was not conformationally complete, to possess hydrolytic activity toward PLCM (Fig. 2).

Possible Role of PPH during Sp Formation of Physarum Microplasmodia

In this study, we confirmed that the rapid increase in the phosphatase activity of extracted PPH toward PLCM at pH 7.6 preceded Sp formation by Physarum microplasmodia, as described previously [9]. We also determined for the first time that the rapid decrease in cytoplasmic streaming velocity preceded Sp formation by Physarum plasmodia (Fig. 3). The velocity of cytoplasmic streaming was maximal initially, and decreased rapidly by ~15% within 0.5 days of Sp formation (Fig. 3a). The phosphatase activity of extracted PPH toward PLCM at pH 7.6 was ~15% of the maximal activity at 0 time; however, it increased rapidly to the maximal activity within 0.5 days (Fig. 3a). These results suggest that the relationship between the behavior of cytoplasmic streaming velocity and that of the hydrolytic activity of extracted PPH toward PLCM at pH 7.6 was in reciprocal proportion during Sp formation of Physarum microplasmodia, and that the phosphatase is involved in the cessation of cytoplasmic streaming in Physarum microplasmodia. The profiles showing an increase in phosphatase activity toward PLCM, PPH expression, and PPH accumulation during DS were correlated with Sp formation of Physarum microplasmodia (Figs. 3a, b and 4a, b).

After 0.5 days, the level of PPH mRNA was decreased by ~20% within 0.8 days (Fig. 3b). However, the enzyme activity was decreased by ~75%, and the protein expression of PPH decreased to approximately 80% (Figs. 3a and 4a, b). The rate of decrease in PPH expression observed within 0.8 days was approximately four times higher than that of enzyme activity and protein expression (Figs. 3a, b and 4a, b). These results revealed that the PPH protein with high phosphatase activity toward PLCM at pH 7.6 was required for the cessation of cytoplasmic streaming and to trigger of the formation of Sc from microplasmodium, during the early stage of DS within 0.5 days. After cessation of cytoplasmic streaming, PPH is not needed for the formation of Sc and other processes occurred because some enzymatic activity was present during DS [20]. Further, the expression level of PPH mRNA was decreased to 20% after 0.5 days within 0.8 days; however, the PPH protein was not quickly degraded or inhibited. Future studies will be required to characterize the role of the interaction between PPH and other proteins (proteases and inhibitors such as the interaction between human MYPT1 [phosphorylate the myosin phosphatase targeting subunit 1] and ROCK [Rho‑associated protein kinase] [21]) during DS.

Confirmation of rWPPH Biological Activity as a Phosphatase

Application of the wheat germ cell-free expression system allowed successful production of the recombinant protein rWPPH, whose molecular mass was consistent with that described previously for the enzyme protein purified from Physarum microplasmodium. It was also consistent with that described previously in terms of the expression of phosphatase activity toward PLCM (Fig. 5a, b).

Thus, Physarum microplasmodium PPH cloned using PCR with degenerate primers based on the N-terminal amino acid sequence of the purified enzyme as determined previously [9] was confirmed to encode a biologically active phosphatase toward PLCM.

Conclusion

In this study, we identified the novel full-length cDNA and deduced the amino acid sequence encoding the Physarum microplasmodial phosphatase PPH by cloning, and expressed the recombinant protein from the cDNA for the first time. Specific primers for PPH were designed for real-time PCR based on the cDNA sequence and the specific antibody against PPH was generated for western blotting using the recombinant protein. The increases in PPH activity toward PLCM, PPH mRNA expression, and PPH protein accumulation during DS were correlated with Sp formation in the Physarum microplasmodia. Moreover, the recombinant protein rWPPH exhibited activity toward the PLCM at pH 7.6. These results provide valuable information regarding the activity of PPH toward PLCM at pH 7.6 and the physiological role of this phosphatase. We believe that the cDNA encoding PPH and the recombinant phosphatase will be helpful for further studies on Sp or Sc formation under DS.