Advertisement

Arthropod-Plant Interactions

, Volume 12, Issue 4, pp 567–574 | Cite as

A PCR-based analysis of plant DNA reveals the feeding preferences of Apolygus lucorum (Heteroptera: Miridae)

  • Qian Wang
  • Weifang Bao
  • Fan Yang
  • Yizhong Yang
  • Yanhui Lu
Original Paper
  • 104 Downloads

Abstract

The mirid bug Apolygus lucorum (Meyer-Dür) (Heteroptera: Miridae) is a severe pest of cotton and other crops in China. The feeding preferences of this pest are unclear due to its frequent movement among different host plants and the inconspicuous signs of its feeding. Here, we present results of a field trial that used direct observation of bug densities and a PCR-based molecular detection assay to detect plant DNA in bugs to explore relationships between A. lucorum population abundance and its feeding preference between two host plants, Humulus scandens (Loureiro) Merrill and Medicago sativa L. The field-plot samples showed that A. lucorum adults generally prefer flowering host plants. Its density was significantly higher on flowering H. scandens than on seedlings of M. sativa, and a similarly higher bug density was observed on flowering M. sativa than on seedlings of H. scandens. In the laboratory, we designed two pairs of species-specific primers targeting the trnL-F region for H. scandens and M. sativa, respectively. The detectability of plant DNA generally decreased with time post-feeding, and the half-life of plant DNA detection (DS50) in the gut was estimated as 6.26 h for H. scandens and 3.79 h for M. sativa with significant differences between each other. In mirid bugs exposed to seedlings of H. scandens and flowering M. sativa, the detection rate of M. sativa DNA was significantly higher than that of H. scandens. Meanwhile, in mirid bugs exposed to seedlings of M. sativa and flowering H. scandens, a significantly higher detection rate of H. scandens DNA was found. We developed a useful tool to detect the remaining plant food species specifically from the gut of A. lucorum in the current study. We provided direct evidence of its feeding preference between H. scandens and M. sativa at different growth stages, which strongly supported a positive correlation between population abundance and feeding preference of A. lucorum on different plants under field conditions. The findings provide new insights into the understanding of A. lucorum’s feeding preference, and are helpful for developing the strategies to control this pest.

Keywords

Herbivory Population abundance Host plant preference Plant DNA Species-specific primers 

Introduction

As the success of herbivorous insect populations depends on the efficient utilization of host plants, which offer sites for feeding, mating, egg-laying, or refuge, insect–host interactions play a fundamental role in driving the co-evolution of herbivorous insects and their host plants (Price et al. 1987; Bernays and Graham 1988; Mitter et al. 1991). Many herbivorous insects are polyphagous, using various host plants for different activities and frequently switching habitats and host plants to find suitable nutritional sources in different seasons (Kennedy and Storer 2000). These interactions between insects and host plants, especially host plant preference and feeding behaviors, are often complicated and elusive (Wallinger et al. 2014).

Diverse approaches have been applied to explore insect feeding preferences and diet profiles, including stable isotopes, hard part identification, or even biochemical and histological analyses (Spence and Rosenheim 2005; Novotny et al. 2006; Wanner et al. 2006; Stephens et al. 2008; Traugott et al. 2013). For example, Silberbauer et al. (2004) confirmed feeding on certain plant species by morphological identification of the pollens present either on the exoskeleton or within the gut of predatory insects, and the information could be used to track their movements under field conditions. However, these methods are time consuming and have various limitations, often leading to inaccurate assessments of the interactions between polyphagous insects and their host plants. Molecular gut-content analysis can potentially overcome previous methodological hurdles as it can provide rapid, sensitive, and accurate plant species identifications by detecting host plant-specific DNA, extracted from herbivorous insects (Valentini et al. 2009; Traugott et al. 2013). Matheson et al. (2008) first proposed that feeding behaviors, and in particular the host plant identification of insects belonging to eight different families could be well studied by detecting the ribulose bisphosphate carboxylase gene (rbcL) from insect guts. Subsequently, this method was employed and simplified when Jurado-Rivera et al. (2009) investigated the associations between chrysomeline leaf beetles and their putative host plants, where they demonstrated that host plant-specific DNA of the chloroplast trnL (UAA) intron from the whole bodies of leaf beetles can be reliably detected. These studies compared amplified, specific plant barcoding regions (e.g., rbcL and trnL) with a database (http://blast.ncbi.nlm.nih.gov) of known DNA-sequences, which facilitated the identification of unknown ingested host plant species. DNA metabarcoding based on next-generation sequencing (NGS) has been more powerful by allowing the direct characterization of dozens of samples with several thousand sequences per PCR product, and has the potential to reveal many consumed species simultaneously (Pompanon et al. 2012). However, in studies with a limited number of known host plants, PCR assays with plant-specific primers are more effective and less time consuming for the identification of trophic interactions. Diagnostic PCR based on the development of specific primers was established by Pumariño et al. (2011) to explore the feeding behaviors of three polyphagous insect pests on tomato, Solanum lycopersicum L. Recently, species-specific plant primers associated with diagnostic PCR methods have been successfully used to detect specific plant DNA to better understand the feeding activities of belowground herbivore pests (Staudacher et al. 2011; Wallinger et al. 2012, 2013, 2014, 2015).

The widespread adoption of transgenic Bacillus thuringiensis (Bt) cotton has effectively suppressed Helicoverpa armigera (Hübner) that has been the dominant pest on cotton for a long time, which led to a greatly decreased insecticide use in this crop than before (Wu et al. 2008). Since then, the mirid bug Apolygus lucorum (Meyer-Dür) (Hemiptera: Miridae), which was historically only a minor pest in cotton fields before (Wu et al. 2002), has emerged as one of the most important insect pests of this crop. It also causes significant damage to many other neighboring crops (Lu et al. 2008, 2010b). Apolygus lucorum is typically polyphagous, with more than 200 known species of host plants, from 49 different families (Lu et al. 2010a, 2012). Based on the results of a 6-year field trial, Pan et al. (2013) found significant differences in the density of A. lucorum among different host plants, and proposed that adult density of A. lucorum on one specific host plant at the flowering stage was significantly higher than on the same species at a non-flowering stage. Dong et al. (2013) also found that female adults preferred to lay eggs on flowering host plants rather than seedlings of the same species, and that offspring performed better on the former. These results reveal that A. lucorum adults prefer to flowering plants for egg-laying; however, whether the feeding behavior drives the preference for flowering plants remains unclear. Due to the inconspicuous nature of symptoms directly after feeding of A. lucorum, the information on the feeding preference of this mirid bug between different plants is still lacking, and the relationship between population abundance and feeding preference under field conditions needs be proved.

In the current study, we designed species-specific primers for DNA amplification of two host plants, Humulus scandens (Lour.) Merrill. and Medicago sativa L. A PCR-based approach was then used for identifying plant DNA present in the guts of A. lucorum from choice trials between the two plant species at different growing stages, conducted in field cages. Furthermore, we compared A. lucorum field population densities on H. scandens and M. sativa. Finally, we comprehensively analyzed the data of the molecularly derived diet information and the population survey to test the hypothesis that there is a positive relationship between population density and feeding preference of this mirid bug.

Materials and methods

Insect rearing and plant collection

Apolygus lucorum used in this study were taken from a laboratory colony reared on fresh pods of green bean (Phaseolus vulgaris) at the Langfang Experimental Station, 1 °C, 60 ± 10% RH, and a 16:8 h L:D photoperiod.

To set up a reference DNA database for identifying food plants from other plants, we collected young leaves of common plant species around the experimental fields in 2014 (Table 1). Leaf samples were stored at − 80 °C.

Table 1

Plant species used to develop the PCR-based identification system

Family

Plant species

GenBank Accession

Amaranthaceae

Amaranthus retroflexus L.

KP318869

Asteraceae

Artemisia scoparia Waldst. et Kit.

KF736813

Artemisia argyi Lévl. et Vant.

FJ710525

Artemisia lavandulaefolia DC.

FJ842622

Cirsium setosum (Willd.) MB.

AB036035

Helianthus annuus L.

/

Balsaminaceae

Impatiens balsamina L.

EF649982

Capparaceae

Cleome gynandra L.

/

Chenopodiaceae

Salsola collina Pall.

/

Chenopodium album L.

/

Convolvulaceae

Ipomoea purpurea (L.) Roth.

EU401730

Euphorbiaceae

Acalypha australis L.

/

Ricinus communis L.

AY794734

Fabaceae

Vigna radiata (L.) Wilczek

JX233513

Phaseolus vulgaris L.

/

Astragalus adsurgens Pall.

JX893488

Medicago sativa L.

KP174818

Melilotus suaveolens Ledeb.

/

Sophora japonica L.

EF466270

Moraceae

Cannabis sativa L.

AF501598

Humulus scandens (Lour.) Merr.

KT032213

Malvaceae

Gossypium hirsutum L.

HQ696725

Poaceae

Digitaria sanguinalis (L.) Scop.

AY116268

Echinochloa crusgalli (L.) Beauv.

AY116269

Setaria viridis (L.) Beauv.

EF137585

Zea mays L.

GQ870012

Polygonaceae

Fagopyrum esculentum Moench

EF653788

Rhamnaceae

Ziziphus jujuba Mill.

DQ146533

Rosaceae

Malus pumila Mill.

JQ392306

Prunus persica L.

AF348560

Pyrus bretschneideri Rehd.

/

Solanaceae

Solanum nigrum L.

GU323357

Vitaceae

Vitis vinifera L.

EF179097

Field survey of bug population abundance

During 2006 and 2007, field studies were conducted at the Langfang Experiment Station of CAAS (39.53°N, 116.70°E) in 10 m, with all plots being separated by aisles with > 5 m wide, which were maintained by hand weeding. Apolygus lucorum adults usually have strong preference to flowering host plants (Chu and Meng 1958; Pan et al. 2013), therefore we selected the plants with different development stages for host preference assay under field conditions. Medicago sativa plants were mowed monthly, and then the growth of each plant was adjusted for the field trial so that H. scandens was in the seedling stage while M. sativa was in the flowering stage in mid-July, and the reverse by mid-August. We measured adult density of A. lucorum in each plot twice per period (middle July or middle August) at 1-week intervals. The sampling protocol was as described in Pan et al. (2013).

Species-specific primers design

Plant species and DNA extraction

To create a reference DNA database that would allow us to identify meals from the common plants around field plots, we collected samples of young leaves of all plants that were common weeds around the experimental fields (Table 1). Leaf samples were collected in the summer of 2014 and stored at − 80 °C. Plant DNA was extracted from a 1 cm dia leaf disc using the DNeasy Plant Mini Kit (QIAGEN) following the manufacturer’s protocol, and was then quantified using a spectrophotometer (NanoDrop™ 1000, Thermo Fisher Scientific, USA). All plants DNA extracts were stored at − 20 °C until analyzed. We tested the DNA extracts using a PCR assay with the general primers, which are located in the cpDNA region encoding chloroplast tRNA for leucine (trnL) 5′-CGAAATCGGTAGACGCTACG-3′ (Primer c A49325), situated in the trnL (UAA) exon (Taberlet et al. 1991), and 5′-GATTTGGCTCAGGATTGCCC-3′ (trnL 110R) (Borsch et al. 2003), located in the trnL (UAA) intron, to check whether plant DNA was well extracted as they can result in amplicons of similar size (120 bp) among different plant species (Table 2). PCR conditions are as follows.

Table 2

Primer sequences (5′–3′) and amplicon sizes for Humulus scandens and Medicago sativa, respectively

Plant species

Primer sequence (5′–3′)

Tm (°C)

Size (bp)

H. scandens

ATCCTTTCATCGAAACTCCG (Forward)

58

334

CTTTTTGGGGATAGAGGGAC (Reverse)

M. sativa

AATAAATAAAAGTTCAGAAAGTTAAAATC (Forward)

60

280

CACGATTTCTAAAGTCGACGG (Reverse)

Primers design and species identification

The sequences for the chloroplast trnL and trnF of H. scandens (KT032213) and M. sativa (KP174818) were obtained from GenBank. Based on those we designed species-specific primers by comparison of these regions with other plants using BioEdit Sequence Alignment Editor v7.1.3.0 (Hall 1999). The specificity of the primers was tested by attempting to PCR-amplify DNA from the leaves of the 31 non-target plant species belonging to 16 families that had been collected (Table 1). H. scandens DNA, M. sativa DNA, and water were always included as positive and negative controls, respectively.

PCR and electrophoresis

PCR amplification was performed in 20 µL reaction mixtures containing 1 µL DNA extract, 2 µL 10 × Taq buffer (TransGen Biotech, Beijing, China), 0.4 µL dNTP, 0.2 µL Easy Taq (TransGen Biotech, Beijing, China), 0.75 µL of each primer (10 µM), and 14.9 µL autoclaved distilled water. PCR reactions were performed in Veriti 96-Well Thermal Cyclers (Applied Biosystems, USA). The cycling protocol began with an initial denaturing step of 95 °C for 10 min, followed by 35 cycles of 95 °C for 30 s, 58 or 60 °C for 30 s, and 72 °C for 1 min, and a final extension of 72 °C for 10 min. PCR products (6 µL) were then separated in a 2% agarose gel and visualized under a UV transilluminator.

Detection of plant food post-feeding

Feeding experiment

It was performed to test the detectability of ingested plant food at different time points post-feeding. Before the feeding experiment, 3-day-old adults of A. lucorum were starved for 24 h (at 25 ± 1 °C). Tender leaves of H. scandens and M. sativa were then placed separately in plastic tubes (10 cm dia, 2.6 cm high). One adult was introduced into each tube for 3 h at room temperature and observed every 10 min to confirm feeding (Pumariño et al. 2011). After feeding, individuals were transferred to new tubes without any plant food and maintained at 25 °C for 0, 2, 4, 8, 12, 16, or 20 h (10 individuals per time point, and three repetitions per time treatment), after which they were frozen at − 20 °C. Samples of mirid bugs fed on H. scandens and M. sativa were analyzed using species-specific primers.

Insect DNA extraction

DNA extraction followed a CTAB-based protocol described in Wallinger et al. (2013). Before the experiment, each adult was cleaned of any plant material potentially adhering to its body surface following the methods used in several previous studies (Greenstone et al. 2014; Remén et al. 2010; Wallinger et al. 2013). More specifically, we placed each individual in 1 mL of 1 to 1.5% sodium hypochlorite (‘bleach’; Beijing Chemical works, Beijing, China) for 5 s. Each individual was then rinsed twice with molecular analysis-grade water. Our preliminary experiments suggested that this method could successfully remove external plant DNA contamination and did not destroy the ingested DNA in A. lucorum guts. Whole body DNA extracts were stored at − 20 °C until analyzed. Two extraction-negative controls were included in each batch of 24 samples to check for cross-sample contamination. The individual samples were screened using the newly developed specific primers with the PCR assay described above.

Molecular analysis of feeding preference

Feeding preference of adult A. lucorum was determined in field cages by non-choice and paired-choice trials on plants.

For the non-choice trials, the plants of H. scandens and M. sativa were potted in plastic pots (20 cm height, 15 cm diameter) with the soil. One potted plant of H. scandens or M. sativa at the seedling stage was selected, covered with a cage (60 × 60 × 60 cm3; 100 mesh) and maintained under field conditions. Before the trials, 3-day-old adults of A. lucorum were starved for 24 h (at 25 ± 1 °C) but provided with water. Five starved individuals were transferred into each cage at 6:00 p.m., and then removed at 9:00 p.m. Three replicates (i.e., three cages) of each treatment were established. Fifteen starved A. lucorum were then tested with each of the specific primers to determine whether H. scandens or M. sativa DNA could be detected in the insects’ guts. Two positive (plant DNA of both H. scandens and M. sativa) and two negative controls (PCR-grade water instead of insect DNA extracts) were run within each PCR assay to assure the accuracy of plant DNA molecular detection.

The paired-choice field-cage trials were conducted to determine the detailed feeding activity of A. lucorum when mirid bugs were offered the choice of feeding on either seedlings of H. scandens or flowering M. sativa, or between seedlings of M. sativa and flowering H. scandens plants. The plants of H. scandens and M. sativa were potted as above, and M. sativa was planted twice to adjust the growth periods. Potted plants of H. scandens and M. sativa at seedling or flowering stages with similar plant weights in each pot were prepared. Before the trials, 3-day-old adults of A. lucorum were starved for 24 h (at 25 ± 1 °C) but given water. One pot with a H. scandens seedling and another pot with flowering M. sativa were put together and covered with a cage (60 × 60 × 60 cm3; 100 mesh), while the pots of flowering H. scandens and seedling M. sativa were paired in other cages. Five starved adults were transferred into the cage at 6:00 p.m., and removed at 9:00 p.m. The individual sample DNA was extracted as described above and subsequently screened with the PCR assay as described above. Eight replicates were run for each treatment.

Statistical analysis

Differences in field density of A. lucorum adults were tested by t tests. The effect of digestion time (i.e., time post-feeding) on plant DNA detection success was tested for the species-specific primers using a logistic regression (PROC GENMOD). Dependent variables were binomially distributed, and SAS 9.3 software was used to estimate the DS50 values (Greenstone et al. 2007). DS50 values for the two plant species were compared using a non-parametric test (PROC NPAR1WAY). The detection rates of collected samples were compared by t tests.

Results

Population abundance

In 2006, the mean densities of A. lucorum adults on flowering H. scandens were 5.6 times higher than those on seedling M. sativa (t = 3.84, df = 1, p = 0.0033). Likewise, the density of A. lucorum adults on flowering M. sativa was 14.9 times higher than that on H. scandens at seedling period (t = − 7.09, df = 1, p < 0.0001). The mean densities of A. lucorum adults in 2007 exhibited a similar trend as in 2006, with that of A. lucorum adults on flowering H. scandens which was 5.9 times higher than that on M. sativa seedlings (t = 5.01, df = 1, p = 0.0005), and density on flowering M. sativa was 9 times higher than that on H. scandens at the seedling period (t = − 4.14, df = 1, p = 0.002) (Fig. 1).

Fig. 1

Population density of Apolygus lucorum adults on Humulus scandens (Hs) and Medicago sativa (Ms) during 2006 and 2007

Species specificity

The PCR assay with the newly designed specific primers amplified a 334 bp fragment for H. scandens and one of 280 bp for M. sativa. Band with specific size can only present in the detection of the target plant species (H. scandens and M. sativa) (Fig.S1). At the same time, all the extracted plant DNA samples exhibited a similar clear 120 bp band using the general plant primers of trnL, confirming the success of our plant DNA extraction (Fig.S2).

Detection of plant food post-feeding

The maximum detection rates achieved for plant DNA of H. scandens-fed and M. sativa-fed A. lucorum (as % bugs exposed to the plant that tested positive) were 83.3 and 86.7%, respectively (Fig. 2). Immediately after feeding, plant DNA detection gradually declined with increased digestion time. Maximum digestion time (point at which detection was no longer possible) for both plants was up to 16 h post-feeding, and this value of H. scandens DNA was much longer than that for M. sativa DNA. A significant difference in the half-life of plant DNA in the gut was present between the two plants, estimated as 6.26 h for H. scandens and 3.79 h for M. sativa (t = 4.89, df = 1, p = 0.0081) (Fig. 2).

Fig. 2

Detectability of Humulus scandens (a) and Medicago sativa (b) DNA in Apolygus lucorum at different times after ingestion. The dashed line represents the half-life of plant DNA detection. Error bars at each point on the curves represent the standard error of three replicates. The model for the relationship between ingestion time (x) and food DNA detection rate (y) was y = 100% × e(1.32−0.22x)/(1 + e(1.32−0.22x)), F = 145.88, df = 2,5, p < 0.0001 (a), and y = 100% × e(1.30−0.43x)/(1 + e(1.30−0.43x)), F = 86.81, df = 2,5, p < 0.0001 (b)

Feeding preference

The detection rate of H. scandens DNA in the A. lucorum from the cages with H. scandens plants was 80%, and that of M. sativa DNA within the treatments of M. sativa plants was 86.7%.

As expected, the results of the field-cage trial revealed a clear feeding preference between host plants at different stages (Fig. 3). For the field-cage comparison of H. scandens seedlings versus flowering M. sativa, the detection rate of M. sativa DNA in A. lucorum guts was seven times higher than that of H. scandens DNA (t = 5.63, df = 14, p < 0.0001). Notably, when the species in flower was reversed, the results switched as well, with the higher plant DNA detection rate shifting to H. scandens under the treatment of M. sativa seedlings versus flowering H. scandens (t = − 4.8, df = 14, p = 0.0003).

Fig. 3

Feeding preference of Apolygus lucorum adults between Humulus scandens (Hs) and Medicago sativa (Ms) in selective field-cage assay. Cage 1: seedling H. scandens versus flowering M. sativa; cage 2: seedling M. sativa versus flowering H. scandens

Discussion

The present study assessed the feeding preferences of mirid bug A. lucorum between two plants (H. scandens and M. sativa) at different phenological stages using a newly established molecular diagnostic method. This new molecular approach provides a rapid and cost-effective tool to assess the dietary switch of herbivorous insects between host plants. Comparable approaches have already been applied earlier to investigate food choice of herbivorous insects (Staudacher et al. 2011; Wallinger et al. 2012; Wang et al. 2016). Determining the diet profiles, host selection, and population dynamics of insects is the first step towards understanding the interactions between herbivorous insects and host plants (Bernays et al. 1994; Mitter et al. 1991). Many approaches to this have been adopted over the years, and some, especially the field survey, provide important information (Geng et al. 2012; Lu et al. 2009; Wang et al. 2016, 2017). Datasets combining both field trials and molecular detection may allow for a more comprehensive understanding of the food preferences of herbivorous insects for answering more specific questions. Our current study found a strong positive relationship between population abundance and feeding of A. lucorum for two different plants, suggesting that this preference is not just for female oviposition (Dong et al. 2013), but also for feeding. Adults and nymphs of this species share the same nutritional requirements (Jiang et al. 2015), which may explain this correlation between feeding and ovipositional preference. Pan et al. (2013) found that A. lucorum adults preferred flowering plants and switched food plants according to the phenology of flowering plant species in agricultural ecosystems; for a given plant species, adult density peaked at the flowering stage. This was also effectively supported in this study.

The trnL-region firstly promoted by Taberlet et al. (1991), as a plant barcode for ecological applications, has been widely used to assess insect–plant association (Jurado-Rivera et al. 2009; Navarro et al. 2010; Staudacher et al. 2011; Wallinger et al. 2015). Here, we aligned the trnL-region of 31 host plant species and designed specific–specific primers for two different food plants. The cross-reactivity test against the two plant species demonstrated that these two pairs of primers used are specific for H. scandens and M. sativa. The maximum DNA detection rate for both target plants in the guts of A. lucorum tested was over 80% at 0 h post-feeding. This value seems a little lower than the detectability of tomato tested in three polyphagous insects (Macrolophus pygmaeus, Helicoverpa armigera, and Tuta absoluta) using specific ITS markers (Pumariño et al. 2011), but resembles the findings of Wallinger et al. (2013, 2014) for plant DNA detection in the guts of Agriotes spp. The differences observed could be ascribed to the species-specific differences depending on both the identity of the food plant and the insect herbivore (Greenstone et al. 2010; King et al. 2008; Wallinger et al. 2014). Apart from those biological differences, methodological issues such as primer efficiency also may play a role (Sipos et al. 2007). Although detectability decreased for both food plants, significant differences were observed between the two plants in this study on their half-life detection values, suggesting that A. lucorum digested the two crops at different rates. Likewise, in the feeding experiments of Wallinger et al. (2013, 2015), it was shown that digestion rates varied by species for wireworms and carabid beetles, respectively. Pumariño et al. (2011) also revealed that different herbivores species digested the same DNA from tomato species at different rates. In our study, the molecular gut-content analysis had a short DS50 (6.26 h for H. scandens, and 3.79 h for M. sativa), which would enable this technique to provide timely evidence of feeding activity and host transfer of A. lucorum adults between crops under field conditions.

In summary, we employed a combinatorial assay by performing both field trials and a PCR-based molecular detection analysis to determine the feeding preference of A. lucorum between two host plants at different growth stages. To the best of our knowledge, this study is the first detailed report in this direction for a polyphagous mirid bug, and its findings provide evidence that A. lucorum prefers flowering plants not only for residence and oviposition but also food. These results provide an important step towards unraveling the food choice of A. lucorum under natural conditions, and are available for further developing an effective strategy to control this mirid bug by disrupting its shift to target crops.

Notes

Acknowledgements

We greatly thank Dr. Corinna Wallinger for helpful comments and suggestions on the manuscript revision. This research was supported by the National Natural Science Funds of China (Nos. 31321004, 31222046), the National Key Research and Development Program of China (2017YFD0201900), and China Agriculture Research System (CARS-15-19).

Supplementary material

11829_2018_9604_MOESM1_ESM.docx (488 kb)
Supplementary material 1 (DOCX 488 KB)

References

  1. Bernays E, Graham M (1988) On the evolution of host specificity in phytophagous arthropods. Ecology 69:886–892CrossRefGoogle Scholar
  2. Bernays EA, Bright KL, Gonzalez N, Angel J (1994) Dietary mixing in a generalist herbivore: tests of two hypotheses. Ecology 75:1997–2006CrossRefGoogle Scholar
  3. Borsch T, Hilu KW, Quandt D, Wilde V, Neinhuis C, Barthlott W (2003) Noncoding plastid trnT-trnF sequences reveal a well resolved phylogeny of basal angiosperms. J Evolution Biol 16(4):558–576CrossRefGoogle Scholar
  4. Chu HF, Meng HL (1958) Studies on three species of cotton plant bugs, Adelphocoris taeniophorus Reuter, A. lineolatus (Goeze), and Lygus lucorum Meyer-Dür (Hemiptera: Miridae). Acta Entomol Sin 8:97–118Google Scholar
  5. Dong JW, Pan HS, Lu YH, Yang YZ (2013) Nymphal performance correlated with adult preference for flowering host plants in a polyphagous mirid bug, Apolygus lucorum. (Heteroptera: Miridae). Arthropod 7:83–91CrossRefGoogle Scholar
  6. Geng HH, Pan HS, Lu YH, Yang YZ (2012) Nymphal and adult performance of Apolygus lucorum (Hemiptera: Miridae) on a preferred host plant, mungbean Vigna radiata. Appl Entomol Zool 47:191–197CrossRefGoogle Scholar
  7. Greenstone MH, Rowley DL, Weber DC, Payton ME, Hawthorne DJ (2007) Feeding mode and prey detectability half-lives in molecular gut-content analysis: an example with two predators of the Colorado potato beetle. B Entomol Res 97:201–209CrossRefGoogle Scholar
  8. Greenstone MH, Szendrei Z, Payton ME, Rowley DC, Coudron TC, Weber DC (2010) Choosing natural enemies for conservation biological control: use of the prey detectability half-life to rank key predators of Colorado potato beetle. Entomol Exp Appl 136:97–107CrossRefGoogle Scholar
  9. Greenstone MH, Payton ME, Weber DC, Simmons AM (2014) The detectability half-life in arthropod predator-prey research: what it is, why we need it, how to measure it, and how to use it. Mol Ecol 23:3799–3813CrossRefPubMedGoogle Scholar
  10. Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95–98Google Scholar
  11. Jiang YY, Lu YH, Zeng J (2015) Forecast and management of mirid bugs in multiple agroecosystem of China. China Agriculture Press, BeijingGoogle Scholar
  12. Jurado-Rivera JA, Vogler AP, Reid CA, Petitpierre E, Gomez-Zurita J (2009) DNA barcoding insect-host plant associations. Proc Biol Sci Royal Soc 276:639–648CrossRefGoogle Scholar
  13. Kennedy GG, Storer NP (2000) Life systems of polyphagous arthropod pests in temporally unstable cropping systems. Annu Rev Entomol 45:467–493CrossRefPubMedGoogle Scholar
  14. King RA, Read DS, Traugott M, Symondson WOC (2008) Molecular analysis of predation: a review of best practice for DNA-based approaches. Mol Ecol 17:947–963CrossRefPubMedGoogle Scholar
  15. Lu YH, Qiu F, Feng HQ, Li HB, Yang ZC, Wyckhuys KAG, Wu KM (2008) Species composition and seasonal abundance of pestiferous plant bugs (Hemiptera: Miridae) on Bt cotton in China. Crop Prot 27:465–472CrossRefGoogle Scholar
  16. Lu YH, Wu KM, Wyckhuys KAG, Guo YY (2009) Potential of mungbean, Vigna radiatus as a trap crop for managing Apolygus lucorum (Hemiptera: Miridae) on Bt cotton. Crop Prot 28:77–81CrossRefGoogle Scholar
  17. Lu YH, Wu KM, Wyckhuys KAG, Guo YY (2010a) Overwintering hosts of Apolygus lucorum (Hemiptera: Miridae) in northern China. Crop Prot 29:1026–1033CrossRefGoogle Scholar
  18. Lu YH, Wu KM, Jiang YY, Xia B, Li P, Feng HQ, Wyckhuys KAG, Guo YY (2010b) Mirid bug outbreaks in multiple crops correlated with wide-scale adoption of Bt cotton in China. Science 328:1151–1154CrossRefPubMedGoogle Scholar
  19. Lu Y, Jiao Z, Wu K (2012) Early season host plants of Apolygus lucorum (Heteroptera: Miridae) in northern China. J Econ Entomol 105:1603–1611CrossRefPubMedGoogle Scholar
  20. Matheson C, Muller G, Junnila A, Vernon K, Hausmann A, Miller M, Greenblatt C, Schlein Y (2008) A PCR method for detection of plant meals from the guts of insects. Org Divers Evol 7:294–303CrossRefGoogle Scholar
  21. Mitter C, Farrell B, Futuyma DJ (1991) Phylogenetic studies of insect-plant interactions: Insights into the genesis of diversity. Trends Ecol Evol 6:290–293CrossRefPubMedGoogle Scholar
  22. Navarro SP, Jurado-Rivera JA, Gómez-Zurita J, Lyal CHC, Vogler AP (2010) DNA profiling of host-herbivore interactions in tropical forests. Ecol Entomol 35(s1):18–32CrossRefGoogle Scholar
  23. Novotny V, Drozd P, Miller SE, Kulfan M, Janda M, Basset Y, Weiblen GD (2006) Why are there so many species of herbivorous insects in tropical rainforests? Science 313:1115–1118CrossRefPubMedGoogle Scholar
  24. Pan HS, Lu YH, Wyckhuys KAG, Wu KM (2013) Preference of a polyphagous mirid bug, Apolygus lucorum (Meyer-Dür) for flowering host plants. PLoS ONE 8:e68980CrossRefPubMedPubMedCentralGoogle Scholar
  25. Pompanon F, Deagle B, Symondson WOC, Brown DS, Jarman SN, Taberlet P (2012) Who is eating what: diet assessment using Next Generation Sequencing. Mol Ecol 21:1931–1950CrossRefPubMedGoogle Scholar
  26. Price PW, Bouton CE, Gross P, McPheron BA, Thompson JN (1987) Interactions among three trophic levels: influence of plants on interactions between insect herbivores and natural enemies. Annu Rev Ecol Syst 11(11):41–65Google Scholar
  27. Pumariño L, Alomar O, Agusti N (2011) Development of specific ITS markers for plant DNA identification within herbivorous insects. B Entomol Res 101:271–276CrossRefGoogle Scholar
  28. Remén C, Krüger M, Cassel-Lundhagen A (2010) Successful analysis of gut contents in fungal-feeding oribatid mites by combining body-surface washing and PCR. Soil Biol Biochem 42:1952–1957CrossRefGoogle Scholar
  29. Silberbauer L, Yee M, Del Socorro A, Wratten S, Gregg P, Bowie M (2004) Pollen grains as markers to track the movements of generalist predatory insects in agroecosystems. Int J Pest Manag 50:165–171CrossRefGoogle Scholar
  30. Sipos R, Szekely AJ, Palatinsky M, Révész S, Márialigeti K, Nikolausz M (2007) Effect of primer mismatch, annealing temperature and PCR cycle number on 16S rRNA gene-targetting bacterial community analysis. FEMS Microbiol Ecol 60:341–350CrossRefPubMedGoogle Scholar
  31. Spence KO, Rosenheim JA (2005) Isotopic enrichment in herbivorous insects: a comparative field-based study of variation. Oecologia 146:89–97CrossRefPubMedGoogle Scholar
  32. Staudacher K, Wallinger C, Schallhart N, Traugott M (2011) Detecting ingested plant DNA in soil-living insect larvae. Soil Biol Biochem 43:346–350CrossRefPubMedPubMedCentralGoogle Scholar
  33. Stephens AEA, Barrington AM, Bush VA, Fletcher NM, Mitchell VJ, Suckling DM (2008) Evaluation of dyes for marking painted apple moths (Teia anartoides Walker, Lep. Lymantriidae) used in a sterile insect release program. Aust J Entomol 47:131–136CrossRefGoogle Scholar
  34. Taberlet P, Gielly L, Pautou G, Bouvet J (1991) Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Mol Biol 17:1105–1109CrossRefPubMedGoogle Scholar
  35. Traugott M, Kamenova S, Ruess L, Seeber J, Plantegenest M (2013) Empirically characterising trophic networks: what emerging DNA-based methods, stable isotope and fatty acid analyses can offer. Adv Ecol Res 49:177–224CrossRefGoogle Scholar
  36. Valentini A, Pompanon F, Taberlet P (2009) DNA barcoding for ecologists. Trends Ecol Evol 24:110–117CrossRefPubMedGoogle Scholar
  37. Wallinger C, Juen A, Staudacher K, Schallhart N, Mitterrutzner E, Steiner EM, Thalinger B, Traugott M (2012) Rapid plant identification using species- and group-specific primers targeting chloroplast DNA. PLoS ONE 7:e29473CrossRefPubMedPubMedCentralGoogle Scholar
  38. Wallinger C, Staudacher K, Schallhart N, Peter E, Dresch P, Juen A, Traugott M (2013) The effect of plant identity and the level of plant decay on molecular gut content analysis in a herbivorous soil insect. Mol Ecol Res 13:75–83CrossRefGoogle Scholar
  39. Wallinger C, Staudacher K, Schallhart N, Mitterrutzner E, Steiner EM, Juen A, Traugott M (2014) How generalist herbivores exploit belowground plant diversity in temperate grasslands. Mol Ecol 23:3826–3837CrossRefPubMedGoogle Scholar
  40. Wallinger C, Sint D, Baier F, Schmid C, Mayer R, Traugott M (2015) Detection of seed DNA in regurgitates of granivorous carabid beetles. B Entomol Res 105:728–735CrossRefGoogle Scholar
  41. Wang Q, Bao WF, Zeng J, Yang YZ, Lu YH (2016) Tracking the tropic relationship between herbivorous insects and host plants by DNA-based technology. Acta Entomol Sin 59:472–480Google Scholar
  42. Wang Q, Bao WF, Yang F, Xu B, Yang YZ(2017)The specific host plant DNA detection suggests a potential migration of Apolygus lucorum from cotton to mungbean fields. PLoS ONE 12(6): e0177789Google Scholar
  43. Wanner H, Gu H, Gu Ènther D, Hein S, Dorn S (2006) Tracing spatial distribution of parasitism in fields with flowering plant strips using stable isotope marking. Biol Control 35:240–247CrossRefGoogle Scholar
  44. Wu KM, Li W, Feng HQ, Guo YY (2002) Seasonal abundance of the mirids, Lygus lucorum and Adelphocoris spp. (Hemiptera: Miridae) on Bt cotton in northern China. Crop Prot 21:997–1002CrossRefGoogle Scholar
  45. Wu KM, Lu YH, Feng HQ, Jiang YY, Zhao JZ (2008) Suppression of cotton bollworm in multiple crops in China in areas with Bt toxin-containing cotton. Science 321:1676–1678CrossRefPubMedGoogle Scholar

Copyright information

© Springer Science+Business Media B.V., part of Springer Nature 2018

Authors and Affiliations

  1. 1.College of Horticulture and Plant ProtectionYangzhou UniversityYangzhouChina
  2. 2.State Key Laboratory for Biology of Plant Diseases and Insect Pests, Institute of Plant ProtectionChinese Academy of Agricultural SciencesBeijingChina
  3. 3.College of AgricultureNortheast Agricultural UniversityHarbinChina

Personalised recommendations