Genome editing in potato plants by agrobacterium-mediated transient expression of transcription activator-like effector nucleases

  • Jin Ma
  • Heng Xiang
  • Danielle J. Donnelly
  • Fan-Rui Meng
  • Huimin Xu
  • Dion Durnford
  • Xiu-Qing Li
Original Article

Abstract

Genome editing (also known as targeted mutation) has promise for molecular breeding. Compared with the CRISPR/Cas9 system, the transcription activator-like effector nucleases (TALENs) have likely a lesser off-target rate in genome editing. Both a rapid test system for the functionality of designed TALENs and an effective delivery system for introducing the TALENs to plants are critical for successful target mutation. TALENs have usually been tested in protoplasts or introduced to plants with viral vectors. However, plant regeneration from protoplast culture can generate extensive somatic variation. Viral vectors are not always available, and plants edited by these vectors usually require virus elimination. Here, we used a non-viral, Agrobacterium-mediated transient expression approach, to serve both rapid test and effective delivery of TALENs into two vegetatively propagated potato cultivars, Solanum tuberosum Russet Burbank and Shepody. Two TALENs with different molecular weights (22 and 27 aa-repeat modules) were expressed to target two endogenous genes (starch branching enzyme and an acid invertase) by Agrobacterium-mediated infiltration (agroinfiltration) into leaves of potato plants. The infiltrated leaf DNA was analyzed using restriction site loss assay and subsequent DNA sequencing. Deep sequencing of these tetraploid cultivars was also conducted to determine the zygosity at the targeted chromosomal loci. TALENs, with different molecular weights, successfully agroinfiltrated and induced mutations at both targeted loci.

Keywords

Non-transgenic Agroinfiltration Site-specific mutagenesis Polyploid plants Allele specificity Vegetatively propagated plants Somatic genome manipulation Molecular breeding 

Introduction

Sequence-specific nucleases are powerful enzymes/proteins for generating double-strand break (DSB) of nucleic acid (DNA) in living cells. Engineered sequence-specific nucleases, including zinc-finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and RNA-guided nucleases (CRISPRs), have all been reported to induce double-strand DNA breaks (DSBs) (Jinek et al. 2012; Puchta and Fauser 2014; Voytas and Gao 2014). A TALEN consists of a DNA-binding domain transcription activator-like effector (TALE) and a FokI endonuclease (Boch et al. 2009; Moscou and Bogdanove 2009; Boch and Bonas 2010; Christian et al. 2010). The TALEN approach has greater efficiency than the ZFN approach (Chen and Gao 2014) and likely a lesser off-target rate than the conventional CRISPR approach (Chen and Gao 2014; De Lange et al. 2014; Fichtner et al. 2014). Wang et al. (2015b) found that TALENs have higher target specificity over CRISPR–Cas9 in human cells. TALENs’ greater accuracy underlines its importance among targeted mutation technologies.

The TALE, a part of the engineered TALEN, was initially described in plant pathogenic Xanthomonas bacteria (Kay and Bonas 2009; Boch and Bonas 2010). Each TALE carries a central DNA-binding domain of tandem, repeated modules with typically no acid residues (102 nt at the gene level) (Boch et al. 2009; Kay and Bonas 2009; Moscou and Bogdanove 2009; Boch and Bonas 2010). These modules are very similar, with variation only at the 12th and 13th amino acids. At the gene level, this two-codon region is hypervariable. These two amino acid residues are called repeated-variable di-residues (RVD); each module has an RVD (Deng et al. 2012; Mak et al. 2012). Different RVDs can bind with different nucleotides of the targeted gene. The four most common di-residues of RVDs include NI, HD, NG and NN which can bind to adenine, cytosine, thymine and either guanine or adenine, respectively. Both di-residue NH and NN can bind to guanine, but NH has greater binding specificity than NN (Cong et al. 2012; Streubel et al. 2012), while NH and NK have similar specificity for binding to guanine (Streubel et al. 2012). The functional FokI endonuclease is a dimer (Kim et al. 1996).

The artificially engineered TALEN construct in the current experiments has two nearly identical TALEN monomers (TALEN right and TALEN left; Fig. 1). Each TALEN monomer has a TALE (containing the aa-repeat modules) and a monomer of FokI. After introduction to the cell, the co-transcribed mRNA of the two parts is translated into two monomers that can combine to form a functional TALEN.
Fig. 1

Expression constructs and TALEN structures. a pK7FWG2. b vector pK7FWG2–TALEN. c 18–20 aa-repeat modules of the TAL effector array showing the amino acid repeat modules. LB left border, RB right border, nptII neomycin phosphotransferase II, T35S cauliflower mosaic virus 35S terminator, eGFP enhanced green fluorescent protein, aatR1 and aatR2 recombination site. ccdB gene: control of cell death B gene; CmR chloramphenicol resistance gene, p35S cauliflower mosaic virus 35S promoter, T2A ribosome skipping peptide that allows translation of multiple ORFs from a single transcript. TALEN left and TALEN right two TALEN monomers, which combine in the cell to form a functional TALEN. aatB1 and aatB2 recombination sites generated by LR reaction of the Gateway system. FokI, a modified FokI endonuclease. The number of nucleotides of the DNA encoding 18–20 RVD modules is 3084–3288 nt, respectively. The length of the RVD modules in the functional TALEN is 6576 nt if the TALEN left and TALEN right each has 20 RVD modules

The TALEN approach to genome editing involves protein-based targeting because the TALEN-produce- protein in the cytoplasm is translocated to the nucleus to bind to the targeted site for inducing mutations. Various methods to deliver TALENs into plant cells have been tested. A very effective approach is to insert the designed TALEN gene into the plant genome and let its protein product continuously induce mutations, thereby increasing the effectiveness of genome editing. This stable transformation approach has been successfully used in Arabidopsis thaliana (Christian et al. 2013), rice (Oryza sativa) (Li et al. 2012b; Shan et al. 2013), Brachypodium distachyon (Shan et al. 2013) barley (Hordeum vulgare) (Wendt et al. 2013), cabbage (Brassica oleracea) (Sun et al. 2013), soybean (Glycine max) (Haun et al. 2014) and potato (Solanum tuberosum L.) (Wang et al. 2015a).

In the case of diploid cereals, these inserted genes can be removed by genetic segregation in the progeny. However, this genetic segregation approach cannot be used in vegetatively propagated crops such as potato, because sexual reproduction would totally change the clone genotype. In addition, transgenic approaches have a strong negative public perception. A transient expression system that does not insert genes into the crop genome, but transiently produces proteins in the cytoplasm, may find greater public acceptance.

Two transient expression systems tested in plant genome editing are the viral vector approach (Baltes et al. 2014) and DNA uptake by protoplasts (Shan et al. 2013; Zhang et al. 2013; Clasen et al. 2015; Nicolia et al. 2015). Coexpression of two TALEN plasmids by agroinfiltration into tobacco plants has been used to test the efficiency of TALENs at the plasmid level, but the study did not address whether the endogenous gene was mutated (Mahfouz et al. 2011; Li et al. 2012a). Protoplast culture is time consuming and likely induces a greater extent of random somatic variation than micropropagation (Li et al. 1988b), while the agroinfiltration approach may result in faster regeneration from leaf explants.

Success has been reported in TALEN-induced genome editing in various diploid species including Arabidopsis, tobacco (Nicotiana tabacum), barley, cabbage, Brachypodium and rice (Carroll 2014), as well as recently in soybean (diploid-like in chromosome pairing) (Haun et al. 2014). Potato is one of the most important vegetable and food crops in the world. Research is required to effectively mutate genes on targeted potato genome loci. However, potato is a highly heterozygous autotetraploid, with up to four alleles at each locus. It is unknown whether TALENs can target the alleles selectively or nonselectively.

In this study, we designed TALENs to target two endogenous genomic loci (two genes) of two potato cultivars (Russet Burbank and Shepody) and transiently delivered the constructs to potato leaves through agroinfiltration. Endogenous genomic DNA mutation was confirmed at both loci using a restriction site loss assay, DNA clone sequencing and potato genomic deep sequencing.

Materials and methods

Potato genes targeted

Two potato genes targeted in this study were represented by the following genes/cDNAs: 1,4-alpha-glucan branching enzyme gene (SBE1, GenBank accession Y08786) (Khoshnoodi et al. 1996) and StvacINV2 (GenBank accession XM_006355428) (Liu et al. 2011). BLASTn search was performed against the potato reference genome through the RefSeq Genome Database (refseq_genomes) at NCBI (http://www.ncbi.nlm.nih.gov/). The potato reference genome had identical sequences to these two originally published gene sequences. Since this study mainly focused on whether the agroinfiltration method could induce mutation and not on the biochemical function of the genes, we tested one locus (target site) per gene.

Plant materials

Two potato cultivars, Shepody and Russet Burbank, were used for the Agrobacterium tumefaciens-mediated transient expression experiments. In vitro plantlets were transplanted into a computerized greenhouse and grown for 4 weeks (before flowering) in a controlled environment (16 h light/8 h cool white fluorescent; 23/18 °C day/night cycle; 60% relative humidity).

TALEN gene design and expression vector construction

TALEN genes were designed using the “TAL Effector Nucleotide Targeter 2.0” program (Doyle et al. 2012) through the website https://tale-nt.cac.cornell.edu/. The TALENs were assembled using the Golden Gate assembly method (Cermak et al. 2011). All the plasmids used for TALEN assembly were bought from Addgene (http://www.addgene.org/TALeffector/goldengateV2). The TALENs and target sites are listed in Table 1. The assembled TALENs were constructed in vectors with the truncated N152/C63 backbone architecture (pZHY500 and pZHY501) (Zhang et al. 2013). The Gateway compatible entry clone-pZHY013 (Zhang et al. 2010), which contained two heterodimeric FokI nuclease monomers separated by a T2A translational skipping sequence (Halpin et al. 1999), was used as an intermediate vector to reconstruct TALEN expression vectors. TALEs in the plasmids pZHY500 and pZHY501 were digested with XbaI/BamHI. The left TALE was cloned into pZHY013 as an XbaI/BamHI fragment. The right TALE was cloned into NheI/BglII sites (which had ends compatible with XbaI and BamHI). A Gateway LR reaction was performed to clone TALEN coding sequences into the destination vector, pK7FWG2 (Karimi et al. 2002), obtained from Ghent University, Belgium. The expression vector pK7FWG2 contained a 35S promoter from cauliflower mosaic virus and a 35S terminator with C-terminal enhanced green fluorescent protein (GFP) fusion in the expression cassette (Fig. 1a).
Table 1

Description of engineered TALENs and target sites

Targeted gene

Left TALE modules (RVD)

Right TALE modules (RVD)

Spacer length

RVDs of left TALE modules

RVDs of right TALE modules

Target sitea

StvacINV2

20

18

22

NH NH NI NI HD NG NG NI NG NH NI NG NH HD NI NH NH NH NH HD

NI HD HD NI NI HD NI NG HD NI NI NG NG NI NG NG NH NH

GGAACTTATGATGCAGGGGCaggaaaatgggtacctgataatCCAATAATTGATGTTGGT

SBE1

20

20

27

NH NI NG NI NG NG NH NH HD HD NI NI NH NH NG NG HD NG HD NI

HD HD HD NI HD NI NI HD NG NG NI NG NH NH NG NI HD HD HD NG

GATATTGGCCAAGGTTCTCAagaatcctactttcatgctggagagcgAGGGTACCATAAGTTGTGGG

aSequences recognized and bound by the modules are in uppercase letters and the spacer sequences (the region to be mutated) are in lowercase letters

RVD repeated-variable di-residues

Agrobacterium tumefaciens-mediated transient expression in potato

All the recombinant vectors were introduced into A. tumefaciens strain GV3101 by the freeze–thaw method (Hofgen and Willmitzer 1988). A single colony of the Agrobacterium strain was cultured in 5 ml of LB liquid medium (10 g/l tryptone, 5 g/l yeast extract, and 5 g/l NaCl; pH 7.0) containing the antibiotics spectinomycin (50 mg/ml) and rifamycin (25 mg/ml) and grown overnight (28 °C at 225 rpm). The 5 ml suspension was then transferred to 50 ml LB liquid medium for overnight culture at 28 °C to an OD600 of 1.0. The bacteria were harvested by centrifugation at 5500 rpm for 15 min and resuspended in 1 ml of infiltration buffer (10 mM MgCl2, 10 mM MES-K, pH 5.6) supplemented with 100 µM acetosyringone. This step was repeated at least once and the final OD600 was adjusted to approximately 0.2–0.4. The bacterial suspension was taken up into in a 1-ml syringe without a needle. The infiltration leaf area was gently pressured with a thin pipet tip to facilitate infiltration without damage to the leaves. The infiltration was through the abaxial (lower) surface of the leaves.

Illumina deep sequencing of the two potato cultivars

Plants of cv. Russet Burbank and cv. Shepody, without Agrobacterium infiltration, were sequenced. Total DNA was extracted from leaves, roots and stems/or tubers using the Qiagen kit “DNeasy Plant Maxi Kit (Qiagen Gmbh, D-40724, Hilden, Germany), and the OD 260/280 ratio was measured using a NanoDrop 1000 Spectrophotometer (Thermo Scientific, Wilmington, DE, USA). DNA quantity was estimated using a Qubit Fluorometer (Invitrogen, USA) with PicoGreen. The genomic DNA samples were used to construct TruSeq genomic DNA libraries and sequenced with a 100 bp paired-end Illumina HiSeq 2000 sequencer. The Illumina reads were analyzed using the software Trimmomatic (Lohse et al. 2012) (v 0.25, http://www.usadellab.org/cms/in-dex.php?page=trimmomatic), BWA (Li and Durbin 2009) (v 0.6.2, http://bio-bwa.sourceforge.net/), Samtools (Li et al. 2009) (v0.1.18, http://samtools.sourceforge.net/) and Picard (v 1.82, http://picard.sourceforge.net/). All the high-quality reads (passed the quality check of Trimmomatic) at the genome editing sites were selected and aligned to determine the allele numbers at each site in each control (unmutated) cultivar. The sequences were deposited to NCBI Sequence Read Archive (SRA) (www.ncbi.nlm.nih.gov/sra). More details of the Illumina sequencing and related bioinformatic pipeline can be found in Xiang and Li (2015). The run accessions of the cv. Russet Burbank genomic DNA sequencing are SRR1501275, SRR1501287 and SRR1501288. The run accessions of the cv. Shepody genomic DNA sequencing are SRR1501290, SRR1501291 and SRR1501293.

PCR amplification of the targeted genomic mutation region after agroinfiltration

Genomic DNA was extracted from agroinfiltrated leaves 7 days post-infiltration by the DNeasy Plant Mini Kit (Qiagen, Cat. No.69106), digested with that enzyme selected for the target size according to Zhang et al. (2010) and used to amplify target regions using primers across TALEN target sites (Table 2). A 50 µl PCR reaction mix contained 5 µl of 10× buffer, 1.5 µl of 50 mM MgCl2, 1 µl of 10 mM dNTP mixture, 1 µl of 10 µM forward primer, 1 µl of 10 µM reverse primer, 50–100 ng genomic DNA and 0.2 µl of Platinum Taq DNA polymerase (Invitrogen Life Technologies, Cat. No.10966-026). The polymerase chain reaction was performed as follows: pre-denature at 94 °C for 10 min; 35 cycles of denaturing at 94 °C for 30 s, annealing at 56 °C for 30 s and extending at 72 °C for 1 min. The final extension was at 72 °C for 10 min followed by maintenance at 4 °C.
Table 2

Primers used for amplifying the target mutation regions

Primer name

Sequence (5′ to 3′)

StvacINV2-F

TGGATCAAGTATGAGGGCAACCC

StvacINV2-R

TGCAAATATCAGCAGCTTCAC

SBE1-F

ATGCAAGCAATAATGCCACTG

SBE1-R

ATGATGAACATACAGCATAGA

Restriction site loss assay for detection of targeted DNA mutation

The PCR products were digested with appropriate restriction enzymes to cut into the spacer (i.e., the TALEN target site) between the two TALE-binding sequences. The digestions were size separated by electrophoresis on 2% agarose gels and viewed under UV light. If a DNA molecule is not mutated at the restriction site, the DNA is cleaved by the enzyme and generates two smaller fragments. If the DNA molecule is mutated at the endonuclease restriction site, the molecule cannot be cleaved and therefore remains in the original PCR fragment size. On the electrophoresis gel, the digestion products of the restriction site loss assay would show three fragments, in which the largest fragment is the mutated one.

The agroinfiltrations were repeated four times on different dates. The restriction resistant band (residual, original size band on agarose gel) in the restriction site loss assay was detected every time. We conducted DNA sequencing of this resistant band to verify whether some DNA in the restriction resistant band was from incomplete digestion and to characterize where the mutations happen in the targeted site region. Since the resistant band was faint, we pulled the DNA of this resistant band from all four experiments, established the DNA library and sequenced 7–8 DNA clones for each gene.

Results

Design of TALENs targeting endogenous potato genes

One TALEN was designed and reconstructed to a pK7FWG2 vector (Fig. 1a) for each potato gene (Table 1; Fig. 1b). Each TALEN was named by adding a T to its gene name, as indicated by the following: T-SBE and T-StvacINV2 (Fig. 1c). The TALENs had 18–20 modules in the TALE of each right TALEN monomer and left TALEN monomer (Fig. 1c). PCR primers (Table 2) were designed for each of the two TALEN-targeted regions. The genome editing results, as confirmed by the results of sequencing, are presented as follows for each of the two targeted loci.

Induced mutation at the targeted site of the SBE1 gene

All the Illumina reads from non-infiltrated cv Russet Burbank (eight reads shown in Fig. 2a, and 18 reads shown in Fig. S1a) and all the Illumina reads from cv Shepody (six reads shown in Fig. 2b, and 12 reads shown in Fig. S1b) were identical to the reference sequence at the NIaIII restriction site of the SBE1 gene. Several short additional reads were also detected in the Illumina-based genome sequencing and the sequence alignment (Fig. S1), because we set up the similarity threshold to 70% to allow detection up to 20 bp deletions in the 67 bp SBE analyzed sequence region. These short reads either started or ended in the region. None of the short reads of the region had deletion in the middle. The data suggested that the targeted NIaIII four-nucleotide site (CATG, no means the entire gene) of the SBE1 gene was homozygous in both cv. Russet Burbank and cv. Shepody. After infiltration and PCR product sequencing, cv. Russet Burbank showed three mutation types including two SNPs and one 17 bp deletion (SBEMR1) (Fig. 2c), and cv. Shepody showed three mutation types (Fig. 2d). This 17 bp deletion did not exist in the wild-type alleles of cv. Russet Burbank according to the genome sequencing results (Fig. S1a). The results clearly indicated that the target site in SBE1 had induced mutation in both cvs Russet Burbank and Shepody.
Fig. 2

Detection of TALEN-induced mutations at the targeted site of SBE1. a, b Illumina deep sequencing reads at the target site of the SBE1 gene in wild-type Russet Burbank and Shepody, respectively. Russet Burbank Illumina raw reads 20,637,968; Shepody Illumina raw reads 15,956,505. c Restriction site and the sizes of restriction-generated fragments. c, d Sequences of DNA clones from the restriction site loss assay from Russet Burbank and Shepody, respectively, of the TALEN-induced mutation treatment. The first sequence numbered as “0” is the sequence of a DNA clone from the wild-type plant. catg, the NIaIII restriction site used for the restriction site loss assay. The two wild-type sequences (SBE-S6 and SBE-S7) listed at the bottom ine were likely from incompletely digested residual DNA molecules. The uppercase and underlined letters of nucleotides on the left and right sides inc and d were the genomic DNA sequences for the binding by the TAL aa-repeat modules of the left and right TALEN monomers, respectively. The lowercase (red) letters in the middle region in c and d are the targeted site region (called spacer in Table 1) for mutation. A dot in the sequence means that the nucleotide was identical with that in the wild-type sequence (the first row of DNA sequence in each panel). Note that the NIaIII restriction site CATG was homozygous in the wild-type Russet Burbank (Panela) and Shepody (Panelb). There were three mutation types detected in Russet Burbank (Panelc) and three mutation types in Shepody (Paneld)

Induced mutation at the targeted site of the StvacINV2 gene

Both the reference sequence and all the Russet Burbank Illumina reads of the analyzed StvacINV2 gene region had the KpnI restriction site (GGTACC) (10 reads shown in Fig. 3a; 16 reads shown in Fig. S1c). The SNPs at the right DNA-binding site clearly showed that there were at least two alleles for this region (Fig. 3a). Three reads were identical to the reference sequence and six reads were different from the reference genome. In cv Shepody, all Illumina reads were identical at the KpnI restriction site (six reads in Fig. 3b; 17 reads shown in Fig. S1d). The data suggested that KpnI recognized six nucleotide sequences at the target site of the StvacINV2 gene that were homozygous in both cvs Russet Burbank and Shepody.
Fig. 3

Detection of TALEN-induced mutations at the targeted site of StvacINV2. a, b Illumina deep sequencing reads at the target site of the StvacINV2 gene in wild-type Russet Burbank and Shepody, respectively. c, d Sequences of DNA clones from the restriction site loss assay from Russet Burbank and Shepody, respectively, of the TALEN-induced mutation treatment. The first sequence numbered “0” is of a DNA clone from the wild-type plant. GGTACC: the KpnI restriction site used for the restriction site loss assay. The uppercase and underlined letters of nucleotides on the left and right sides in c and d were the genomic DNA sequences for the binding by the TAL aa-repeat modules of the left and right TALEN monomers, respectively. The lowercase letters in the middle region in c and d are the targeted site region (called spacer in Table 1) for mutation. A dot in the sequence means that the nucleotide is identical to that in the wild-type sequence (the first row inc or d). The two wild-type sequences listed at the bottom in b and c were likely from incompletely digested residual DNA molecules. Note that the KpnI restriction site GGTACC was homozygous in the wild-type Russet Burbank (a) and likely also in Shepody (b). There were five mutation types detected in Russet Burbank (c) and four mutation types in Shepody (d)

After cloning this KpnI-resistant fragment, five of the seven sequenced DNA clones in infiltrated Russet Burbank and four of the six sequenced clones from infiltrated Shepody were detected to have DNA mutation at the KpnI restriction site. Russet Burbank showed five mutation types (Fig. 3c), and Shepody showed four mutation types (Fig. 3d). One DNA clone (INV2MR4) among the five mutated Russet Burbank DNA clones and one DNA clone (INV2MS4) in mutated Shepody also showed an SNP mutation on the left DNA-binding region. The results clearly indicated that the target site in StvacINV2 had induced mutation in both Russet Burbank and Shepody. To ensure that the mutations were from the mutation treatment and not due to the PCR process, we isolated DNA from non-treated and treated leaves separately and conducted PCR and KpnI digestion simultaneously for the two types of DNA samples under exactly the same conditions. The PCR-amplified fragment covering the targeted site was designed to generate 387 and 154 bp after KpnI digestion (Fig. 4a, b). Electrophoresis of the PCR product digestion showed two fragments with the expected size in the controls (DNA from non-agroinfiltrated leaves; see Fig. 4a, CK) and a digestion-resistant fragment (indicated by an arrow in Fig. 4a) in the DNA from leaf regions of targeted mutation treatments, suggesting that some DNA molecules were mutated at least on these KpnI-recognized six nucleotides.
Fig. 4

Agarose gel electrophoresis image showing the existence of a KpnI-resistant DNA fragment in the targeted mutation treatments, but not the controls in two potato cultivars. a Agarose gel electrophoresis for size separation of the restriction-generated fragments of the PCR-amplified DNA from the targeted site region. Potato cultivars: ‘Shepody’ and ‘Russet Burbank’. CK: the DNA from tissues without any agroinfiltration. DNA 100 bp: New England Biolabs 100 bp DNA ladder (https://www.neb.com/products/n3231-100-bp-dna-ladder). In this DNA ladder lane, the upper fragment with increased intensity is of 1000 bp, and the lower fragment with increased intensity is 517 bp. b A graph showing the restriction site and the sizes of restriction-generated fragments

Discussion

The results presented here clearly confirm that agroinfiltration with non-viral TAEN vectors can effectively introduce TALENs into potato leaf cells and can allow TALENs to induce mutation at specific targeted sites. It is known that plant defense reactions are different in different plants (Higgins et al. 1998; Bhaskar et al. 2009; Xing and Laroche 2011). Cultivar differences were observed in Agrobacterium-mediated transient expression of binary vector-carried protein genes (Bhaskar et al. 2009). The agroinfiltration was used for CRISPR/Cas9-mediated genome editing in plants (Li et al. 2013; Bortesi and Fischer 2015). In the present study, agroinfiltration effectively delivered the TALENs and induced mutation in both Russet Burbank and Shepody. The A. tumefaciens GV3101 used in this study is a strain widely used in genetic transformation of commercial potato cultivars (Bhaskar et al. 2009; Guo et al. 2010). GV3101 showed a higher efficiency for transient expression than LBA4404 in potato leaf agroinfiltration (Bhaskar et al. 2009). The mutation efficiency is usually difficult to determine in agroinfiltration approaches, because agroinfiltration treats intact plant tissues and not individual cells. However, as indicated by Bhaskar et al. (2009), the indirect efficiency, such as the transient gene expression activity represented by the fluorescent light intensity under microscope in the infiltrated tissues, is known to be affected by the type of vectors, infiltration methods and plant cultivars.

The success in this study with non-viral vectors suggests that the agroinfiltration approach can be used to replace the protoplast approach at least for testing TALEN constructs. Further research about how to increase deletions or amino acid changes in non-viral agroinfiltration approaches may make the targeted genome editing more effective to meet research needs. The remaining step is the regeneration from leaf tissues and screening for mutants. Plant regeneration from leaf explants is expected to be easier than from protoplasts. It is known that the extent of somaclonal variation is very large from protoplast culture (Li et al. 1988a) and much smaller in non-protoplast-culture somatic embryogenesis (Nassar et al. 2011). It is important to avoid the use of a protoplast culture approach in genome editing-based molecular breeding if random mutations are unwanted, even though somaclonal variation is also useful for breeding. An agroinfection approach was used to deliver RNA viral vectors of ZFNs to tobacco plants (Marton et al. 2010) and DNA viral vectors of TALENs (Baltes et al. 2014); an angroinfiltration method was used to deliver CRISPR/cas9 to Nicotiana benthamiana (Li et al. 2013; Nekrasov et al. 2013). Compared with the protoplast culture approach, agroinfiltration is expected to save time, be more cost-effective and less laborious, and increase the chance of obtaining genetically improved plants with mutation only at the target site in the genome with less somaclonal variation.

Both INV2 and SBE TALENs successfully induced mutations in this study. The targeted genes included key genes affecting the degree of starch branching (SBE1) and potato cold sweetening (two acid invertase genes). The Effector Nucleotide Targeter 2.0” program (Doyle et al. 2012) can be used to design TALENs from nearly every nucleotide or every few nucleotides of the input DNA sequences. Therefore, the TALEN approach is powerful and can likely target nearly any gene in potato if needed. Potato is an important food and vegetable crop and the targeted mutation provides a very promising technology for non-GMO-based molecular breeding. Potato cultivars are vegetatively propagated clones and therefore the progeny segregation approach cannot be used to eliminate off-target mutations. Since it is known that TALENs have less off-target mutation than some conventional versions of CRISPRs (De Lange et al. 2014; Fichtner et al. 2014; Wang et al. 2015b), there is likely an advantage to using the TALEN technology in terms of avoiding off-target mutations in further improving elite potato cultivars such as Russet Burbank and Shepody as well as advanced clones in breeding programs.

This work shows several novel aspects in TALEN-induced genome editing in plants. This study (1) confirmed that Agrobacterium-mediated transient expression can effectively induce targeted mutation in plants without using a viral vector and (2) used the second-generation deep sequencing (Illumina) to characterize the zygosity of the targeted genome sites. The development of agrobacterium-mediated/infiltration TALEN approach can stimulate research and facilitate improvement of commercial plant cultivars and advanced breeding lines through TALEN-based genome editing without changing the general genetic makeup of valuable cultivars and advanced lines.

Notes

Acknowledgements

We thank Muhammad Haroon, Agriculture and Agri-Food Canada, for his general support in the laboratory and his technical support in plant and DNA preparation. The research funding was from Agriculture and Agri-Food Canada A-base, the Natural Sciences and Engineering Research Council of Canada (NSERC), and the deep sequencing was supported by the New Brunswick Agricultural Innovation Program.

Compliance with ethical standards

Conflict of interest

The authors declare that they have no conflict of interest.

Supplementary material

11816_2017_448_MOESM1_ESM.pdf (358 kb)
Supplementary material 1 (PDF 358 kb)

References

  1. Baltes NJ, Gil-Humanes J, Cermak T, Atkins PA, Voytas DF (2014) DNA replicons for plant genome engineering. Plant Cell 26:151–163CrossRefPubMedPubMedCentralGoogle Scholar
  2. Bhaskar PB, Venkateshwaran M, Wu L, Ané JM, Jiang J (2009) Agrobacterium-mediated transient gene expression and silencing: a rapid tool for functional gene assay in potato. PLoS One 4:e5812CrossRefPubMedPubMedCentralGoogle Scholar
  3. Boch J, Bonas U (2010) Xanthomonas AvrBs3 family-type III effectors: discovery and function. Annu Rev Phytopathol 48:419–436CrossRefPubMedGoogle Scholar
  4. Boch J, Scholze H, Schornack S, Landgraf A, Hahn S, Kay S, Lahaye T, Nickstadt A, Bonas U (2009) Breaking the code of DNA binding specificity of TAL-type III effectors. Science 326:1509–1512CrossRefPubMedGoogle Scholar
  5. Bortesi L, Fischer R (2015) The CRISPR/Cas9 system for plant genome editing and beyond. Biotechnol Adv 33:41–52CrossRefPubMedGoogle Scholar
  6. Carroll D (2014) Genome engineering with targetable nucleases. Annu Rev Biochem 83:409–439CrossRefPubMedGoogle Scholar
  7. Cermak T, Doyle EL, Christian M, Wang L, Zhang Y, Schmidt C, Baller JA, Somia NV, Bogdanove AJ, Voytas DF (2011) Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. Nucleic Acids Res 39:e82CrossRefPubMedPubMedCentralGoogle Scholar
  8. Chen K, Gao C (2014) Targeted genome modification technologies and their applications in crop improvements. Plant Cell Rep 33:575–583CrossRefPubMedGoogle Scholar
  9. Christian M, Cermak T, Doyle EL, Schmidt C, Zhang F, Hummel A, Bogdanove AJ, Voytas DF (2010) Targeting DNA double-strand breaks with TAL effector nucleases. Genetics 186:756–761CrossRefGoogle Scholar
  10. Christian M, Qi Y, Zhang Y, Voytas DF (2013) Targeted mutagenesis of Arabidopsis thaliana using engineered TAL effector nucleases. G3 Genes Genomes, Genet 3:1697–1705Google Scholar
  11. Clasen BM, Stoddard TJ, Luo S, Demorest ZL, Li J, Cedrone F, Tibebu R, Davison S, Ray EE, Daulhac A, Coffman A, Yabandith A, Retterath A, Haun W, Baltes NJ, Mathis L, Voytas DF, Zhang F (2015) Improving cold storage and processing traits in potato through targeted gene knockout. Plant Biotechnol J 14:169–176CrossRefPubMedGoogle Scholar
  12. Cong L, Zhou R, Kuo YC, Cunniff M, Zhang F (2012) Comprehensive interrogation of natural TALE DNA-binding modules and transcriptional repressor domains. Nat Commun 3:968CrossRefPubMedPubMedCentralGoogle Scholar
  13. De Lange O, Binder A, Lahaye T (2014) From dead leaf, to new life: TAL effectors as tools for synthetic biology. Plant J 78:753–771CrossRefPubMedGoogle Scholar
  14. Deng D, Yan C, Pan X, Mahfouz M, Wang J, Zhu JK, Shi Y, Yan N (2012) Structural basis for sequence-specific recognition of DNA by TAL effectors. Science 335:720–723CrossRefPubMedPubMedCentralGoogle Scholar
  15. Doyle EL, Booher NJ, Standage DS, Voytas DF, Brendel VP, Vandyk JK, Bogdanove AJ (2012) TAL effector-nucleotide targeter (TALE-NT) 2.0: tools for TAL effector design and target prediction. Nucleic Acids Res 40:W117–W122CrossRefPubMedPubMedCentralGoogle Scholar
  16. Fichtner F, Urrea Castellanos R, Ülker B (2014) Precision genetic modifications: a new era in molecular biology and crop improvement. Planta 239:921–939CrossRefPubMedGoogle Scholar
  17. Guo JL, Yu CL, Fan CY, Lu QN, Yin JM, Zhang YF, Yang Q (2010) Cloning and characterization of a potato TFL1 gene involved in tuberization regulation. Plant Cell Tissue Organ Cult 103:103–109CrossRefGoogle Scholar
  18. Halpin C, Cooke SE, Barakate A, El Amrani A, Ryan MD (1999) Self-processing 2A-polyproteins—a system for co-ordinate expression of multiple proteins in transgenic plants. Plant J 17:453–459CrossRefPubMedGoogle Scholar
  19. Haun W, Coffman A, Clasen BM, Demorest ZL, Lowy A, Ray E, Retterath A, Stoddard T, Juillerat A, Cedrone F, Mathis L, Voytas DF, Zhang F (2014) Improved soybean oil quality by targeted mutagenesis of the fatty acid desaturase 2 gene family. Plant Biotechnol J 12:934–1140CrossRefPubMedGoogle Scholar
  20. Higgins VJ, Lu H, Xing T, Gelli A, Blumwald E (1998) The gene-for-gene concept and beyond: interactions and signals. Can J Plant Pathol 20:150–157CrossRefGoogle Scholar
  21. Hofgen R, Willmitzer L (1988) Storage of competent cells for agrobacterium transformation. Nucleic Acids Res 16:9877CrossRefPubMedPubMedCentralGoogle Scholar
  22. Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier E (2012) A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337:816–821CrossRefPubMedGoogle Scholar
  23. Karimi M, Inzé D, Depicker A (2002) GATEWAY™ vectors for Agrobacterium-mediated plant transformation. Trends Plant Sci 7:193–195CrossRefPubMedGoogle Scholar
  24. Kay S, Bonas U (2009) How Xanthomonas type III effectors manipulate the host plant. Curr Opin Microbiol 12:37–43CrossRefPubMedGoogle Scholar
  25. Khoshnoodi J, Blennow A, Ek B, Rask L, Larsson H (1996) The multiple forms of starch-branching enzyme I in Solanum tuberosum. Eur J Biochem 242:148–155CrossRefPubMedGoogle Scholar
  26. Kim YG, Cha J, Chandrasegaran S (1996) Hybrid restriction enzymes: zinc finger fusions to Fok I cleavage domain. Proc Natl Acad Sci USA 93:1156–1160CrossRefPubMedPubMedCentralGoogle Scholar
  27. Li H, Durbin R (2009) Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 25:1754–1760CrossRefPubMedPubMedCentralGoogle Scholar
  28. Li X-Q, Chetrit P, Mathieu C, Vedel F, De Paepe R, Remy R, Ambard-Bretteville F (1988a) Regeneration of cytoplasmic male sterile protoclones of Nicotiana sylvestris with mitochondrial variations. Curr Genet 13:261–266CrossRefGoogle Scholar
  29. Li X-Q, Prat D, De Paepe R, Pernes J (1988b) Variability induced in Nicotiana sylvestris by two successive cycles of protoplast culture. In: IRRIaA Sinica (ed) Genetic manipulation in crops. Cassell Tycooly, London, pp 131–133Google Scholar
  30. Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, Marth G, Abecasis G, Durbin R (2009) The sequence alignment/map format and SAMtools. Bioinformatics 25:2078–2079CrossRefPubMedPubMedCentralGoogle Scholar
  31. Li L, Piatek MJ, Atef A, Piatek A, Wibowo A, Fang X, Sabir JSM, Zhu JK, Mahfouz MM (2012a) Rapid and highly efficient construction of TALE-based transcriptional regulators and nucleases for genome modification. Plant Mol Biol 78:407–416CrossRefPubMedPubMedCentralGoogle Scholar
  32. Li T, Liu B, Spalding MH, Weeks DP, Yang B (2012b) High-efficiency TALEN-based gene editing produces disease-resistant rice. Nat Biotechnol 30:390–392CrossRefPubMedGoogle Scholar
  33. Li JF, Norville JE, Aach J, McCormack M, Zhang D, Bush J, Church GM, Sheen J (2013) Multiplex and homologous recombination-mediated genome editing in Arabidopsis and Nicotiana benthamiana using guide RNA and Cas9. Nat Biotechnol 31:688–691CrossRefPubMedPubMedCentralGoogle Scholar
  34. Liu X, Zhang C, Ou Y, Lin Y, Song B, Xie C, Liu J, Li X-Q (2011) Systematic analysis of potato acid invertase genes reveals that a cold-responsive member, StvacINV1, regulates cold-induced sweetening of tubers. Mol Genet Genomics 286:109–118CrossRefPubMedGoogle Scholar
  35. Lohse M, Bolger AM, Nagel A, Fernie AR, Lunn JE, Stitt M, Usadel B (2012) RobiNA: a user-friendly, integrated software solution for RNA-Seq-based transcriptomics. Nucleic Acids Res 40:W622–W627CrossRefPubMedPubMedCentralGoogle Scholar
  36. Mahfouz MM, Li L, Shamimuzzaman M, Wibowo A, Fang X, Zhu JK (2011) De novo-engineered transcription activator-like effector (TALE) hybrid nuclease with novel DNA binding specificity creates double-strand breaks. Proc Natl Acad Sci USA 108:2623–2628CrossRefPubMedPubMedCentralGoogle Scholar
  37. Mak ANS, Bradley P, Cernadas RA, Bogdanove AJ, Stoddard BL (2012) The crystal structure of TAL effector PthXo1 bound to its DNA target. Science 335:716–719CrossRefPubMedPubMedCentralGoogle Scholar
  38. Marton I, Zuker A, Shklarman E, Zeevi V, Tovkach A, Roffe S, Ovadis M, Tzfira T, Vainstein A (2010) Nontransgenic genome modification in plant cells. Plant Physiol 154:1079–1087CrossRefPubMedPubMedCentralGoogle Scholar
  39. Moscou MJ, Bogdanove AJ (2009) A simple cipher governs DNA recognition by TAL effectors. Science 326:1501CrossRefPubMedGoogle Scholar
  40. Nassar AMK, Abdulnour J, Leclerc Y, Li X-Q, Donnelly DJ (2011) Intraclonal selection for improved processing of NB “Russet Burbank” potato. Am J Potato Res 88:387–397CrossRefGoogle Scholar
  41. Nekrasov V, Staskawicz B, Weigel D, Jones JDG, Kamoun S (2013) Targeted mutagenesis in the model plant Nicotiana benthamiana using Cas9 RNA-guided endonuclease. Nat Biotechnol 31:691–693CrossRefPubMedGoogle Scholar
  42. Nicolia A, Proux-Wéra E, Åhman I, Onkokesung N, Andersson M, Andreasson E, Zhu LH (2015) Targeted gene mutation in tetraploid potato through transient TALEN expression in protoplasts. J Biotechnol 204:17–24CrossRefPubMedGoogle Scholar
  43. Puchta H, Fauser F (2014) Synthetic nucleases for genome engineering in plants: prospects for a bright future. Plant J 78:727–741CrossRefPubMedGoogle Scholar
  44. Shan Q, Wang Y, Chen K, Liang Z, Li J, Zhang Y, Zhang K, Liu J, Voytas DF, Zheng X, Zhang Y, Gao C (2013) Rapid and efficient gene modification in rice and brachypodium using TALENs. Mol Plant 6:1365–1368CrossRefPubMedPubMedCentralGoogle Scholar
  45. Streubel J, Blücher C, Landgraf A, Boch J (2012) TAL effector RVD specificities and efficiencies. Nat Biotechnol 30:593–595CrossRefPubMedGoogle Scholar
  46. Sun Z, Li N, Huang G, Xu J, Pan Y, Wang Z, Tang Q, Song M, Wang X (2013) Site-specific gene targeting using transcription activator-like effector (TALE)-based nuclease in Brassica oleracea. J Integr Plant Biol 55:1092–1103CrossRefPubMedGoogle Scholar
  47. Voytas DF, Gao C (2014) Precision genome engineering and agriculture: opportunities and regulatory challenges. PLoS Biol 12:1–6CrossRefGoogle Scholar
  48. Wang S, Zhang S, Wang W, Xiong X, Meng F, Cui X (2015a) Efficient targeted mutagenesis in potato by the CRISPR/Cas9 system. Plant Cell Rep 34:1473–1476CrossRefPubMedGoogle Scholar
  49. Wang X, Wang Y, Wu X, Wang J, Wang Y, Qiu Z, Chang T, Huang H, Lin RJ, Yee JK (2015b) Unbiased detection of off-target cleavage by CRISPR-Cas9 and TALENs using integrase-defective lentiviral vectors. Nat Biotechnol 33:175–179CrossRefPubMedGoogle Scholar
  50. Wendt T, Holm PB, Starker CG, Christian M, Voytas DF, Brinch-Pedersen H, Holme IB (2013) TAL effector nucleases induce mutations at a pre-selected location in the genome of primary barley transformants. Plant Mol Biol 83:279–285CrossRefPubMedGoogle Scholar
  51. Xiang H, Li X-Q (2015) Development of TBSPG pipelines for refining unique mapping and repetitive sequence detection using the two halves of each Illumina sequence read. Plant Mol Biol Rep 34:172–181CrossRefGoogle Scholar
  52. Xing T, Laroche A (2011) Revealing plant defense signaling getting more sophisticated with phosphoproteomics. Plant Signal Behav 6:1469–1474CrossRefPubMedPubMedCentralGoogle Scholar
  53. Zhang F, Maeder ML, Unger-Wallaced E, Hoshaw JP, Reyon D, Christian M, Li X, Pierick CJ, Dobbs D, Peterson T, Joung JK, Voytas DF (2010) High frequency targeted mutagenesis in Arabidopsis thaliana using zinc finger nucleases. Proc Natl Acad Sci USA 107:12028–12033CrossRefPubMedPubMedCentralGoogle Scholar
  54. Zhang Y, Zhang F, Li X, Baller JA, Qi Y, Starker CG, Bogdanove AJ, Voytas DF (2013) Transcription activator-like effector nucleases enable efficient plant genome engineering. Plant Physiol 161:20–27CrossRefPubMedGoogle Scholar

Copyright information

© UKCrown: Agriculture and Agri-Food Canada; Her Majesty the Queen in Right of Canada 2017

Authors and Affiliations

  • Jin Ma
    • 1
    • 2
  • Heng Xiang
    • 1
    • 3
  • Danielle J. Donnelly
    • 4
  • Fan-Rui Meng
    • 2
  • Huimin Xu
    • 5
  • Dion Durnford
    • 6
  • Xiu-Qing Li
    • 1
  1. 1.Fredericton Research and Development CentreAgriculture and Agri-Food CanadaFrederictonCanada
  2. 2.Faculty of Forestry and Environmental ManagementUniversity of New BrunswickFrederictonCanada
  3. 3.College of Animal Science and TechnologySouthwest UniversityBeibeiChina
  4. 4.Plant Science DepartmentMcGill UniversitySte Anne de BellevueCanada
  5. 5.Canadian Food Inspection Agency, Charlottetown LaboratoryCharlottetownCanada
  6. 6.Department of BiologyUniversity of New BrunswickFrederictonCanada

Personalised recommendations