Abstract
The gene encoding an alkaline lipase of Penicillium cyclopium PG37 was cloned with four steps of PCR amplification based on different principles. The cloned gene was 1,480 nucleotides in length, consisted of 94 bp of promoter region, and had 6 exons and 5 short introns ranging from 50 to 70 nucleotides. The open reading frame encoded a protein of 285 amino acid residues consisting of a 27-AA signal peptide and a 258-AA mature peptide, with a conserved motif of Gly-X-Ser-X-Gly shared by all types of alkaline lipases. However, this protein had a low homology with lipases of P. camembertii (22.9%), Humicola lanuginosa (25.6%), and Rhizomucor miehei (22.3%) at the amino acid level. The mature peptide-encoding cDNA was cloned and expressed in Escherichia coli on pET-30a for confirmation. A distinct band with a M.W. of 33 kDa was detected on SDS-PAGE. Results of a Western blot analysis and an enzyme activity assay verified the recombinant 33-kDa protein as an alkaline lipase. Its catalytic properties were not changed when compared with its natural counterpart.
Similar content being viewed by others
Abbreviations
- Primer AP:
-
GGATCCCTTCACTCTCAAGTGC
- primer CE3:
-
GCGCGGCCGCTCAGCTCAGATAGCCAC
- primer CE5:
-
GGAATTCGCAACTGCTGACGCCG
- primer G3:
-
AACTGCAGTCAGCTCAGATAGCCAC
- primer G5:
-
ATGTTGTTCAACTACCAATC
- primer N1:
-
GA(C/T)GC(C/T)GC(C/T)GC(C/T)TTCCC
- primer N2:
-
CC(C/T)GA(C/T)CT(G/C/T)CA(C/T)CG(C/T)GC(A/G/C/T)GC
- primer OT:
-
oligo dT-M13 primer M4
- primer PR1:
-
GAAGGCTGCTGGACCGTTGT
- primer PR2:
-
CCGTTGTCTTTGGCTGC
- primer RM1:
-
CTCTCATGATCTTCACATCAG
- primer S5:
-
AAGCAGTGGTAACAACGCAGCAGTACGCGGG
- PVA:
-
polyvinyl alcohol
- RACE:
-
rapid amplification of cDNA end
References
Klibanov, A.M. (1989) Enzymatic Catalysis in Anhydrous Organic Solvents, Trends Biochem. Sci. 14, 141–144.
Kirchner, G., Scollar, M.P., and Klibanov, A.M. (1985) Resolution of Racemic Mixture via Lipase Catalysis in Organic Solvents, J. Am. Chem. Soc. 107, 7072–7076.
Marlot, C., Langrand, G., Triantaphylides, C., and Baratti, J. (1985) Ester Synthesis in Organic Solvent Catalyzed by Lipases Immobilized on Hydrophilic Supports, Biotechnol. Lett. 7, 647–649.
Saad, R.R. (1995) Production of Lipase from Aspergillus tamarii and Its Compatibility with Commercial Detergents, Folia Microbiol. 40, 263–266.
Macrae, A., Roehl, E.L., and Brand, H.M. (1990) Bio-esters in Cosmetics, J. Drug Cosmet. Ind. 147, 36–39.
Ghosh, P.K., Saxena, R.X., Gupta, R., Yadav, R.P., and Davidson, S. (1996) Microbial Lipase: Production and Applications, Sci. Prog. 79, (Pt. 2), 119–157.
Gandhi, N.N. (1997) Applications of Lipase, J. Am. Oil Chem. Soc. 74, 621–634.
De Caro, J., Ferrato, F., Verger, R., and De Caro, A. (1995) Purification and Molecule Characterization of Lamb Pregastric Lipase, Biochim. Biophys. Acta 1252, 321–329.
Lin, S.F., Chiou, C.M., and Yeh, C.M. (1996) Purification and Partial Characterization of an Alkaline Lipase from Pseudomonas pseudoalcaligenes F-111, Appl. Environ. Microbiol. 62, 1093–1095.
Hiol, A., Jonzo, M.D., Rugani, N., Druet, D., Sarda, L., and Comeau, L.C. (2000) Purification and Characterization of an Extracellular Lipase from a Thermophilic Rhizopus oryzae Strain Isolated from Palm Fruit, Enzyme Microb. Technol. 26, 421–430.
Hassanien, F.R., and Mukherjee, K.D. (1986) Isolation of Lipase from Germinating Oilseeds for Biotechnological Processes, J. Am. Oil. Chem. Soc. 63, 893–897.
Ollis, D.L., Cheah, E., Cygler, M., Dijkstra, B., Frolow, F., Franken, S.M., Harel, M., Remington, S.J., Silman, I., Schrag, J.D., et al. (1992) The α/β Hydrolase Fold, Protein Eng. 5, 197–211.
Schrag, J.D., and Cygler, M. (1997) Lipase and the α/β Fold, in Methods in Enzymology (Rubin, B. and Dennis, E.A., eds.), Vol. 284, pp. 85–106, Academic Press, New York.
Brady, L., Brzozowski, A.M., Derewenda, Z.S., Dodson, E., Dodson, G., Tolley, S., Turkenburg, J.P., Christiansen, L., Huge-Jensen, B., Norskov, L., et al. (1990) A Serine Protease Triad Forms the Catalytic Centre of a Triacylglycerol Lipase, Nature 343, 767–770.
Boston, M., Requadt, C., Danko, S., Jarnagin, A., Ashizawa, E., Wu, S., Poulose, A.J., and Bott, R. (1997) Structure and Function of Engineered Pseudomonas mendocina Lipase, in Methods in Enzymology (Rubin, B., and Dennis, E.A., eds.), Vol. 284, pp. 298–317, Academic Press, New York.
Patkar, S.A., Svendsen, A., Kirk, O., Clausen, I.G., and Borch, K. (1997) Effect of Mutation in Non-consensus Sequence Thr-X-Ser-X-Gly of Candida antarctica Lipase B on Lipase Specificity, Specific Activity and Thermostability, J. Mol. Catal. B: Enzymatic 3, 51–54.
Shinkai, A., Hirano, A., and Aisaka, K. (1996) Substitutions of Ser for Asn-163 and Pro for Leu-264 Are Important for Stabilization of Lipase from Pseudomonas aeruginosa, J. Biochem. 120, 915–921.
Batenburg, A.M., Egmond, M.R., and Frenken, L.G.J. (1990) Enzymes and Enzymatic Detergent Compositions, European Patent EP 0 407 225 A1.
Huge-Jensen, B., Andreasen, F., Christensen, T., Christensen, M., Thim, L., and Boel, E. (1989) Rhizomucor miehei Triglyceride Lipase Is Processed and Secreted from Transformed Aspergillus oryzae, Lipids 24, 781–785.
Wu, M.C., Wang, S., Huang, W.D., and Sun, C.R. (1999) Purification and Characterization of an Alkaline Lipase from Penicillium cyclopium PG37, Acta Biochim. Biophys. Sin. 31, 664–668.
Ibrik, A., Chahinian, H., Rugani, N., Sarda, L., and Comeau, L.C. (1998) Biochemical and Structural Characterization of Triacylglycerol Lipase from Penicillium cyclopium, Lipids 33, 377–384.
Chahinian, H., Nini, L., Boitard, E., Dubes, J.P., Sarda, L., and Comeau, L.C. (2000) Kinetic Properties of Penicillium cyclopium Lipases Studied with Vinyl Esters, Lipids 35, 919–925.
Garber, R.C., and Yoder, O.C. (1983) Isolation of DNA from Filamentous Fungi and Separation into Nuclear, Mitochondrial, Ribosomal, and Plasmid Components, Anal. Biochem. 135, 416–422.
Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd edn., Cold Spring Harbor Laboratory Press, New York.
Mourey, A., and Kilbertus, G.J. (1976) Simple Media Conditioning Stabilized Tributyrin for Demonstrating Lipolytic Bacteria in Foods and Soils, J. Appl. Bacteriol. 40, 47–51.
Harlow, E., and Lane, D. (1988) Antibodies: A Laboratory Manual, pp. 92–112, Cold Spring Harbor Laboratory Press, New York.
Verma, I.M. (1977) Reverse Transcriptase, in The Enzymes (Boyer, P.D., ed.) Vol. 14A, pp. 87–104, Academic Press, New York.
Schmidt-Dannert, C. (1999) Recombinant Microbial Lipases for Biotechnological Applications, Bioorg. Med. Chem. 7, 2123–2130.
Herrgard, S., Gibas, C.J., and Subramaniam, S. (2000) Role of an Electrostatic Network of Residues in the Enzymatic Action of the Rhizomucor miehei Lipase Family, Biochemistry 39, 2921–2930.
Chahinian, H., Vanot, G., Ibrik, A., Rugani, N., Sarda, L., and Comeau, L.C. (2000) Production of Extracellular Lipases by Penicillium cyclopium Purification and Characterization of a Partial Acylglycerol Lipase, Biosci. Biotechnol. Biochem. 64, 215–222.
Iwai, M., Okumura, S., and Tsujisaka, Y. (1975) The Comparison of the Properties of Two Lipases from Penicillium cyclopium Westring, Agric. Biol. Chem. 39, 1063–1070.
Okumura, S., Iwa, M., and Tsujisaka, Y. (1980) Purification and Properties of Partial Glyceride Hydrolase of Penicillium cyclopium M1, J. Biochem. 87, 205–211.
Druet, D., El Abbadi, N., and Comeau, L.C. (1992) Purification and Characterization of the Extracellular and Cell-Bound Lipases from Penicillium cyclopium Variety, Appl. Microbiol. Biotechnol. 37, 745–749.
Author information
Authors and Affiliations
Corresponding author
Additional information
Zhikang Qian and Peihong Jiang are equal contributors as first author of this paper.
About this article
Cite this article
Wu, M., Qian, Z., Jiang, P. et al. Cloning of an alkaline lipase gene from Penicillium cyclopium and its expression in Escherichia coli . Lipids 38, 191–199 (2003). https://doi.org/10.1007/s11745-003-1051-7
Received:
Revised:
Accepted:
Issue Date:
DOI: https://doi.org/10.1007/s11745-003-1051-7