Plant Cell, Tissue and Organ Culture (PCTOC)

, Volume 124, Issue 3, pp 459–469

ZmCIPK8, a CBL-interacting protein kinase, regulates maize response to drought stress

  • Fuju Tai
  • Zhiheng Yuan
  • Shipeng Li
  • Qi Wang
  • Fuyang Liu
  • Wei Wang
Original Article

DOI: 10.1007/s11240-015-0906-0

Cite this article as:
Tai, F., Yuan, Z., Li, S. et al. Plant Cell Tiss Organ Cult (2016) 124: 459. doi:10.1007/s11240-015-0906-0

Abstract

Plant CBL-interacting protein kinases (CIPKs) play an important role in stress signaling transduction and enhancing plant stress tolerance. However, the functions of most CIPKs in crop plants such as maize have not been studied. Here, a novel CIPK gene, ZmCIPK8, was cloned and characterized from maize (Zea mays). The ZmCIPK8 gene has 14 introns and its encoded protein shares high homology to Arabidopsis and rice CIPKs. Yeast two-hybrid and bimolecular fluorescence complementation assay demonstrated that ZmCIPK8 interacted with ZmCBL1, ZmCBL4 and ZmCBL9. Quantitative RT-PCR analysis revealed that the mRNA accumulation of ZmCIPK8 in maize leaves and roots was promoted by drought stress. GUS gene expression driven by the ZmCIPK8 promoter was in an organ-dependent pattern and induced in Arabidopsis seedlings under drought stress. Over-expression of ZmCIPK8 in tobacco induced the expression of the NAC, CBF, and Rd29A genes and enhanced drought tolerance of transgenic tobacco seedlings. Thus, ZmCIPK8 perhaps is involved in plant response to drought and other abiotic stress through regulating stress-related genes.

Keywords

Maize CIPK Drought stress Transgenic plants 

Introduction

To enhance survival, plants have evolved complex signal transduction networks to sense and adapt to stressful conditions. Ca2+ acts as a universal messenger in various signal transduction pathways, including biotic stress (Chung et al. 2004; Ludwig et al. 2005) and abiotic stress (Knight et al. 2001; Kim et al. 2003). It is well documented that Ca2+ transmits the primary signals into cellular responses (such as gene expression) most likely through Ca2+ regulated proteins (Ca2+ sensors and their targets). In the past decades, many Ca2+ sensors have been identified, such as calmodulin (CaM) and calmodulin-related proteins, Ca2+-dependent protein kinases (CDPKs) and calcineurin B-like proteins (CBLs) (Luan et al. 2002). Among these Ca2+ sensors, only CBLs do not have any enzymatic activity but it function through specifically interacting with a family of Ser/Thr protein kinases designated as CIPKs (CBL-interacting protein kinases) (Shi et al. 1999; Luan et al. 2002; Kim et al. 2000; Luan et al. 2009). The previous studies showed that CIPKs consist of an N-terminal kinase domain and a C-terminal regulatory domain (Batistic et al. 2004). A conserved 24-amino acid motif within the C-terminal regulatory domain of CIPKs is designated as the NAF domain (also named FISL motif), which is required to mediate CBL–CIPK interaction (Kolukisaoglu et al. 2004).

To date, 26 CIPK genes in Arabidopsis genome (Weinl et al. 2009) and 30 CIPK genes in rice genome (Kolukisaoglu et al. 2004) have been identified. Many CBL and CIPK proteins have been functionally characterized. The SOS3/SOS2 (AtCBL4/CIPK24) was shown to specifically mediate salt stress signaling and adaptation (Liu et al. 1998; Halfter et al. 2000; Liu et al. 2000). Kim et al. (2003) showed that CIPK3 plays a role in regulating abscisic acid (ABA) and cold responses during seed germination in Arabidopsis. Similarly, OsCIPK31 is also involved in seed germination and seedling growth under abiotic stress conditions (Piao et al. 2010). Overexpression two CBLs genes (PeCBL6 and PeCBL10) enhance the transgenic white poplar multiple stress tolerance (Li et al. 2012). BnCBL1/CIPK6 component was found involved in the plant response to abiotic stress and ABA signaling (Chen et al. 2012). The complex CBL1/9-CIPK23 ensures activation of AKT1 and enhances K+ uptake under low- K+ conditions (Xu et al. 2006). CBL3-CIPK9 was also proved to be a K+ homeostasis regulator under low K+ stress in Arabidopsis (Liu et al. 2013). The CBL1/9-CIPK26 complex was found that it can regulate the ROS production (Drerup et al. 2013). Except for the involvement in stress response, CBL and CIPK proteins are also reported playing roles in other signaling. For example, tomato CBL10-CIPK6 complex is involved in plant immunity signaling pathway (Torre et al. 2013). OsCBL2 plays a key role in promoting vacuolation of barley aleurone cells following treatment with GA (Hwang et al. 2005). CBL1 and CBL9 can regulate pollen germination and pollen tube growth in Arabidopsis (Mähs et al. 2013). CIPK3, CIPK9, CIPK23, and CIPK26, functionally overlapping components downstream of CBL2/3, regulate magnesium homeostasis in Arabidopsis (Tang et al. 2015). Although remarkable progresses have been made in elucidating the CBL/CIPK calcium- signaling pathway, little is known about this pathway in maize.

As far as we know, at least 10 CBLs and 43 ZmCIPK genes were in maize genome (Chen et al. 2011). All the 43 putative ZmCIPKs expressions under drought stress were analyzed by RT-PCR (Chen et al. 2011). Several ZmCIPKs expression patterns under drought stress were found involved in ABA and H2O2 signaling (Tai et al. 2013), and ZmCBL4 and ZmCIPK16 were found to be involved in maize response to salt stress (Wang et al. 2007; Zhao et al. 2009). However, most of ZmCIPKs have not been identified and characterized. In the present study, ZmCIPK8 was cloned and characterized from maize. Our results indicate ZmCIPK8 is involved in maize response to drought stress.

Materials and methods

Plant growth and drought treatment

Maize seeds (Zea mays cv. Zhengdan 958) with uniform size were surface sterilized with 0.5 % (w/v) NaClO for 15 min, rinsed with distilled water three times, soaked in water for 20 h, and germinated on moistened filter papers for 3 days. Maize seedlings were transferred to grow in Hogland’s nutrient solution at 400 μmol m−2 s−1 radiation with a 16/8 h day/night cycle, a temperature of 28/22 °C cycle and a relative humidity 75 % in a light chamber. When the second leaves were fully expanded, the seedlings were immersed in 18 % PEG (MW6000) solution for 0, 2, 6, 12 and 24 h, respectively, and leaves and roots were sampled and immediately placed in liquid nitrogen until further analyses.

ZmCIPK8 isolation and sequence analysis

Many CIPKs sequences, including CIPK8 of Arabidopsis, were used for BLAST search in NCBI (http://www.ncbi.nlm.nih.gov), and then several high homology sequences (putative CIPK) from maize were obtained. Among them, ZmCIPK8 gene (Accession No. AY104543) was found involved in response to drought stress by RT-PCR analysis (Tai et al. 2013). Nucleotide and amino acid sequence were analyzed using a software package (DNAStar and http://www.ebi.ac.uk/clustalw/). In addition, the protein sequence was manually checked for existence of the feature motifs and domains of CIPK proteins.

Semiquantitative RT-PCR analysis

Total RNA was isolated from 0.1 g maize samples using a total RNA kit (Invitrogen) according to the manufacturer’s specifications and then was purified by DNaseI (Promega) for eliminating gDNA contamination. The purified RNA (5 μg) samples were reversely transcribed into cDNAs by AMV reverse transcriptase (Promega) and were used as the template for subsequent PCR amplification. The expression pattern of the ZmCIPK8 gene in maize under PEG treatment was analyzed by semiquantitative RT-PCR with gene-specific primers (Table 1). The maize actin2 was used as a standard control in the RT-PCR reactions.
Table 1

Primer sequences of ZmCIPK8 and other genes

Accession noa

Gene name

Sequenceb (5′–3′)

Yeast two-hybrid

AY104543

ZmCIPK8

F

CGGCATATGCGCCATCCATAGAGGGA

R

CGCGGATCCTTATGAATGAGACTTTG

EU907931

ZmCBL1

F

CCATATGATGGGGTGCTTCCATTCC

R

CGGATCC TCACGTGACGAGATCGTC

EU907933

ZmCBL2

F

CGCATATGATGGTGCAGTGCCTGGACGG

R

CGGGATCCTCAGTTATCATCAACCTGAG

EU907934

ZmCBL3

F

CGGAATTCATGTTGCAGTGCCTGGAT

R

CGGAGCTCTCAGGTATCATCGACCTG

EU973091

ZmCBL4

F

AAGAATTCATGGGGTGTGTGTCCTCC

R

AAGAGCTCTTACTTGAGGTATGGGAG

EU907935

ZmCBL5

F

CCATATGATGGGCTGTCTGCAAACAAAG

R

CGAGCTCTTAGACAGCCATGTCTGTTTCA

EU907936

ZmCBL6

F

CCATATGATGGTGGACTTTGTTCGACGG

R

CCATATGATGGTGGACTTTGTTCGACGG

EU961354

ZmCBL7

F

CGGAATTCATGGTGCAGTGCCTGGAC

R

CGGAGCTCTCAGTTATCATCAACTTG

EU907937

ZmCBL8

F

ATGAATTCATGCATGCATGCATGCCA

R

ATGAGCTCCTACAACTCGTCGTCACT

EU960527

ZmCBL9

F

CGCCATATGATGGGATGCTTCCATTCC

R

CCGCTCGAGTCACGTCACGAGATCATC

EU961768

ZmCBL10

F

AAGAATTCATGCCACGAGCCACTGA

R

AAAGGATCCCTAATCTTCCACCGCC

RT-PCR

AY104543

ZmCIPK8

F

CGTTCGTAAATAACTACTGC

R

GATGTGCAGTCTAAAACATC

NM_00111251

ZmActin2

F

GTGACAATGGCACTGGAATG

R

GACCTGACCATCAGGCATCT

AB049337

Rd29A

F

TAGCGCAAACGTGGAGG

R

GCGCCACTTCCTCTGTCTT

HQ413134

NAC

F

CGCTGCTCTAGAATGATCAAAGGCGTACAC

R

GACTCACGGTACCGTAAGGTTTCTGCATGT

AF120092

NtCBF

F

AGTCTCGACATCGTCACG

R

TGACGTGGAGAACCAACC

AB158612

NtActin

F

ACTGGTGTTATGGTTGGTATGGGTC

R

ATGACCTGCCCATCTGGTAACTC

Promoter amplification

AY104543

ZmCIPK8

F

TAGGATCCTATATGCTGAGAAAGTTGG

R

GAATTCCTATGGATGGCGAAAGAGTCG

aNucleotide accession of the experimentally verified cDNA in the National Center for Biotechnology Information GenBank database (http://www.ncbi.nlm.nih.gov)

bThe bold letters in the primer sequences were restriction sites

To assay the expression of stress- and ABA-responsive genes, RT-PCR analysis was performed with the RNA samples isolated from the transgenic tobacco seedlings treated with drought stress. Total RNA was reversely transcribed into cDNAs, and PCR amplification was performed with oligo nucleotides specific for various stress-/ABA-responsive genes: Rd29A, NAC and NtCBF. Amplification of tobacco Actin2 gene was used as an internal control.

All the RT-PCR experiments were performed at least three times in each independent biological experiment (3 replicates) and the results from one representative experiment are shown.

Yeast two-hybrid (Y2H) assay

Gal4-based two-hybrid system was used as described by the manufacturer (Clontech). The coding sequence of ZmCIPK8 was cloned in the DNA binding domain vector (pGBKT7, Clontech) to make the bait vector pGBKT7-ZmCIPK8. The coding sequences of the 10 ZmCBLs were cloned in the pGADT7 (prey vector), respectively. Each pGADT7-ZmCBL (ZmCBL1-8) was separately co-transformed with pGBKT7-ZmCIPK8 into Saccharomyces cervisiae AH109 for Y2H assay. Yeast cells carrying both plasmids were selected on the synthetic medium lacking Leu and Trp (SD-Leu–Trp–). The yeast cells were then streaked onto the SD-Trp-Leu-Ade-His plate containing 15 mm 3-AT to determine the expression of HIS3 nutritional reporter. The positive clones of the ZmCIPK8/ZmCBL complexes were selected and β-galactosidase activity was analyzed by filter-lift assays (Kim et al. 2000). Primer sequences for pGBKT7-ZmCIPK8 and pGADT7-ZmCBL constructs were listed in Table 1.

BiFC assays

The coding sequence of ZmCIPK8 was cloned into pUC-SPYNE to create a fusion construct with the C-terminal fragment of yellow fluorescent protein (YFP; pUC-SPYNE- ZmCIPK8). The coding sequences of three ZmCBLs (ZmCBL1, ZmCBL4 and ZmCBL9) were individually cloned into pUC-SPYCE to create a fusion (the primers and restriction sites: Table 1) with the N-terminal fragment of YFP. Two plasmids were simultaneously co-transformed into Arabidopsis mesophyll protoplasts according to Liu et al. (2013). Fluorescence analysis was performed at 18 h later on a laser scanning confocal microscopy. YFP fluorescence was examined at 514 nm (excitation) using an argon laser with an emission band of 515–530 nm and 650 nm (Chl autofluorescence).

Construction of the ZmCIPK8p:GUS chimeric gene and Arabidopsis transformation

To generate the CIPK8 promoter–β-glucuronidase construct, the 5′ flanking DNA of CIPK8 was amplified with gene specific primers. The PCR fragment (1 kb) was cloned into PCAMBIA1391 vector. The Arabidopsis thaliana ecotypes Columbia seeds were surface-sterilized with 70 % (v/v) ethanol for 1 min and NaClO for 6 min, washed three times with sterile water, and plated on MS medium solidified with 0.8 % agar in a tissue culture room at 22 °C with a 16/8 h day/night cycle. After 2 weeks, seedlings were potted in soil and placed in a growth chamber at 22 °C with a 16/8 h day/night cycle. When the flowers appeared, the chimeric ZmCIPK8p: GUS gene was introduced into Arabidopsis by the floral dip method (Clough et al. 1998). Transformed seeds were selected on MS medium containing 50 mg/L hygromycin. Homozygous lines of the T3 and T4 generations were used for phenotypic analysis of transgenic plants.

Histochemical assay of GUS activity

Transgenic seedlings (3- and 8-days-old) and different tissues/organs from mature Arabidopsis plants were stained at 37 °C in 5-bromo-4-chloro-3-indolyl-b-d-glucuronic acid (X-Gluc) solution for 12 h (Li et al. 2010). Chlorophyll (Chl) was removed by immersing from plant tissues in 70 % ethanol. To test the induction of GUS expression by drought stress, the transgenic seedlings (8-days-old) were transferred to MS liquid medium containing 375 mM mannitol for 12 h or transferred to dry filter paper for 30 min dehydration. GUS staining patterns were confirmed by observing at least three different transgenic lines.

Over-expression of ZmCIPK8 in tobacco and drought tolerance analysis of transgenic plants

Using XbaI and SacI restriction sites, the coding sequence of ZmCIPK8 was cloned into the vector PBI121 under the control of the 35S promoter from the cauliflower mosaic virus. Tobacco (K326) plants were grown in a greenhouse under a 16 h light/8 h dark cycle for plant transformation and stress treatments. The PBI121-ZmCIPK8 construct was transformed into Agrobacterium strain GV3101 and introduced into tobacco K326. Then, through resistance screening and PCR amplification, the positive transgenic plants were obtained. In addition, the total RNA of tobacco was prepared by using TRIzol Reagent (Invitrogen). ZmCIPK8 expression in transgenic tobaccos was analyzed by RT-PCR as described above. The transgenic tobacco seeds were collected for further analysis.

Approximately 100 seeds of the wild type (WT) and the transgenic tobacco lines were surface-sterilized and plated on MS medium (1.2 %) at 25 °C under long-day light conditions. For root growth measurement, after 7 days of germination, the seedlings were transferred from normal MS to MS media plates plus 250 mM mannitol; the plates were then stood up. Root length was measured at the 12th day after the transfer. All experiments were performed in triplicate.

To test the drought tolerance of the transgenic lines, soil-grown tobacco seedlings were not watered from 7- or 8-leaf stage for continuous 30 days, and then the seedlings were re-watered. The status of seedling growth was recorded after the re-watered. The expression of stress related genes, such as Rd29A (NCBI accession no: AB049337), NAC (HQ413134) and CBF (AF120092), in transgenic tobaccos was analyzed by RT-PCR (Table 1). Chl content, superoxide dismutase (SOD), malondialdehyde (MDA), and proline content were also analyzed (Hu et al. 2012).

Results

Characterization of the ZmCIPK8

In this study, a gene belonging to the CIPK family was identified in maize. Amino acid sequence alignment revealed that the deduced ZmCIPK protein is highly homology (>75 %) to the CIPKs from Arabidopsis, rice and other higher plants. In particular, the homology to OsCIPK8 (accession no. BAD87720) is 95 % and the phylogenetic tree also displayed that the deduced ZmCIPK has the closest relationship with OsCIPK8 and AtCIPK8 (supplemental Figure. S1). Thus this maize CIPK was designated as ZmCIPK8. It has a 1356 bp coding region and encodes a polypeptide of 451 amino acids with a calculated molecular mass of 50.87 kDa. The deduced ZmCIPK8 protein contains two domains: N-terminal protein kinase domain and C-terminal regulatory domain with a CBL-interacting NAF/FISL motif, which is highly conserved in CIPK family (Fig. 1a). Based on the information derived from the maize genome database (MaizeGDB), ZmCIPK8 is located on chromosome 3 and its genomic DNA is composed of 15 exons and 14 introns spanning a 7.82 kb genomic region (Fig. 1b).
Fig. 1

Gene structure and domain comparison of ZmCIPK8 with known plant CIPKs. a Amino acid sequence alignment of the activation loop and NAF (FISL) domain of ZmCIPK8 with known Arabidopsis and rice CIPKs. Black shading indicates sequence identity; grey shading indicates sequence similarity. The proteins accession numbers in the GenBank are: AtCIPK03 (AAF86507); AtCIPK08 (AAK16683); AtCIPK09 (AAK16684); AtCIPK23 (AAK61494); AtCIPK24 (AAK72257); OsCIPK03 (BAG99485); OsCIPK08 (BAD87720); OsCIPK09 (AAM19110); OsCIPK23 (BAD30104); OsCIPK24 (BAD35529). b Schematic diagram of gene structure of ZmCIPK8. Black rectangles and black lines represent introns and exons, respectively. Grey rectangles represent 5′ untranslated region (UTR) and 3′ UTR

Identification of ZmCIPK8-interacting proteins

In order to determine which ZmCBL interacts with ZmCIPK8 in maize under drought stress, the putative interaction partners of ZmCIPK8 were firstly identified using Y2H assay. As a result, ZmCIPK8 interacts with ZmCBL1, ZmCBL4 and ZmCBL9 (Fig. 2a). The interaction between ZmCIPK8 and the three ZmCBLs in vivo was further confirmed using the BiFC method (Fig. 2b).
Fig. 2

Analysis of the interactions between ZmCIPK8 with ZmCBLs. a CIPK8 interacted with ZmCBL1, 4 and 9 in yeast two hybrid assays. +: PGADT7-7 + PGBKT7-53; −: PGADT7-7 + PGBKT7-lam; 1:CBL1 + ZmCIPK8; 2: CBL2 + ZmCIPK8; 3: CBL3 + ZmCIPK8; 4: CBL4 + ZmCIPK8; 5: CBL5 + ZmCIPK8; 6: CBL6 + ZmCIPK8; 7: CBL7 + ZmCIPK8; 8: CBL8 + ZmCIPK8; 9: CBL9 + ZmCIPK8; 10: CBL10 + ZmCIPK8. b BiFC analysis of CIPK8 interactions with ZmCBL1, 4 and 9

ZmCIPK8 is inducible by drought stress

Firstly, to investigate whether the ZmCIPK8 gene is regulated by drought stress, two-week-old maize seedlings were subjected to drought stress and the expression of ZmCIPK8 gene was analyzed with RT-PCR. As shown in Fig. 3a, the level of the ZmCIPK8 expression was greatly increased at all time points examined in leaves and roots exposed to PEG treatment. In leaves, ZmCIPK8 mRNAs were obviously accumulated at 2 h and reached a maximum at 24 h; in roots, the expression of ZmCIPK8 reached its highest level at 2 h, declined at 6 h but remained an elevated level until 24 h.
Fig. 3

Expression patterns of ZmCIPK8 gene under drought stress. a RT-PCR analysis of ZmCIPK8 in 2-week-old maize seedlings under 18 % PEG. b Analysis of ZmCIPK8 promoter activities in Arabidopsis plants. a, b staining for 3 h; c, d staining for 12 h. a control; b 100 mM mannitol; c control; d dehydration on filter paper

Secondly, to investigate whether the ZmCIPK8 promoter is inducible by drought stress, the 1 kb fragment of ZmCIPK8 5′-flanking regions (the putative promoter fragments and 5′-untranslated regions) before the translational initiation codon ATG was cloned upstream the GUS reporter gene in PCAMBIA1391 vector. The construct was introduced into Arabidopsis by Agrobacterium tumefaciens-mediated transformation. The GUS activities in the ZmCIPK8p: GUS transgenic plants under drought stress were observed (Fig. 3b). In particular, GUS activities were significantly increased in the cotyledons of the transgenic seedlings (9-d-old) after 375 mM mannitol treatment for 12 h (Fig. 3a, b) or after dehydration for 30 min on dry filter paper (Fig. 3c, d). In addition, dehydration on filter paper (Fig. 3d) induced stronger GUS expression than mannitol treatment both in cotyledons and leaves of the transgenic plants (Fig. 3c, d).

Finally, the tissue localization of the GUS gene expression under the control of the ZmCIPK8 promoter was examined in transgenic plants. Histochemical staining showed that ZmCIPK8 promoter was very active in early seedling stage (Fig. 4). The expression of GUS gene driven by ZmCIPK8 promoter was detectable in almost whole seedlings except root tip and hypocotyl (Fig. 4a–d). When the plants maturated, strong GUS activity was observed in the young silique (Fig. 4f) and calyx (Fig. 4e), weak in old silique (Fig. 4g) but no activity in petal and seeds (Fig. 4e, g). In addition, we also found that GUS activity was high in vascular bundles in particular (Fig. 4d, e).
Fig. 4

ZmCIPK8 promoter activities in Arabidopsis plants expressing the ZmCIPK8p: GUS fusion gene. a, b and c 2-, 3- and 8-d-old seedling, respectively; d root tip of 8-d-old seedling; e flower; f young silique in a flower; g old silique

Over-expression of the ZmCIPK8 gene enhances tobacco resistance to drought stress

To investigate the function of ZmCIPK8 under drought stress, we introduced ZmCIPK8 gene into tobacco. In total, 13 transgenic tobacco plants were obtained through kanamycin-resistance assay and PCR analysis (Fig. 5a). The transgenic progeny lines (T1 generation) were selected for further study. RT-PCR analysis demonstrated that ZmCIPK8 transcript was accumulated in transgenic plants. Three transgenic lines A, D and G with higher expression levels (Fig. 5b) were selected for analyzing their phenotypes under drought stress.
Fig. 5

Phenotype analysis of ZmCIPK8 over-expressed transgenic tobacco lines. A, D, G transgenic lines. a identification of positive T1 transgenic tobacco using PCR. 1-13, transgenic tobacco; 14, positive control; 15, negative control. b RT-PCR of ZmCIPK8 expression. c root length on MS medium plus 250 mM mannitol (25 °C). The photograph was taken at the 12th day after seedling transfer. d Drought for 30 days (left) and drought for 30 days, followed by 10 days re-watering (right)

The seeds of the three transgenic tobacco lines germinated in MS medium for 72 h, and then were transferred onto mannitol-containing MS medium to investigate seedling response to mannitol treatment. Root length was measured at the 15th day after transfer. The root growth was inhibited in WT; however, the root length of the transgenic seedlings was 2-fold longer than that of WT (Fig. 5c). These results showed that compared with WT, the transgenic seedlings were more tolerant at early growth stage by mannitol treatment. Then the drought tolerance of the transgenic tobacco lines was further investigated. The tobacco seedlings were treated by drought stress at 7-leaf stage for 30 days. After then, WT seedlings were on the verge of death/wilted and almost all of the leaves became chlorotic, while the transgenic plants grew well and the upper leaves remained green, especially the line G (Fig. 5d). After re-watering, two WT seedlings were dead, but all the transgenic seedlings survived (Fig. 5d). After drought treatment, the Chl and proline content and SOD activity were obviously higher, while the content of MDA (an indicator of stress-induced cell damage) was lower in transgenic lines, compared to WT (p < 0.05) (Fig. 6). Taking together, the transgenic plants had a more tolerance to drought compared with WT.
Fig. 6

Physiological parameters in WT and transgenic tobaccos under 18 % PEG stress. a Chl content; b MDA content; c SOD activity; d proline content. Mean values and standard errors (bar) were shown from three independent experiments. Different letters indicate significant difference (p value <0.05) between WT and transgenic lines

To investigate whether ZmCIPK8 affects the expression of stress- or ABA-responsive genes, three marker stress-related genes including Rd29A, CBF and NAC were analyzed in ZmCIPK8 over-expressed plants. As shown in Fig. 7, CBF and NAC were slightly increased in the three transgenic lines; Rd29A were significantly up-regulated in lines D and G (Fig. 7). These results suggested that ZmCIPK8 may involve in drought stress signaling pathway and through regulating the expression of stress-related genes in plants response to stress.
Fig. 7

Semiquantitative RT-PCR analysis of the stress related genes in transgenic tobaccos under drought stress. WT, wild type. A, D and G, transgenic lines. Total RNA was extracted from the leaves of tobaccos (Fig. 5d, left)

Discussion

Plant CIPKs play an important role in stress signaling transduction and enhance stress tolerance (Zhu et al. 1998; Qiu et al. 2002; Kim et al. 2003; Chen et al. 2012). AtCIPK3 can be induced by drought, cold, salt and ABA and acts as a cross-talk component between cold stress and ABA signaling (Kim et al. 2003). An ER-targeted calcium-binding peptide confers salt and drought tolerance mediated by AtCIPK6 (Tsou et al. 2012). However, the functions of the most ZmCIPKs have not yet been clear. In the present study, a novel gene ZmCIPK8 in maize was isolated and characterized. The physiological function of ZmCIPK8 in maize under drought stress was further characterized.

Previous reports indicated that a CBL protein has one or more potential interaction partners and a CIPK protein also interacts with a subset of CBLs (Kolukisaoglu et al. 2004). For example, AtCIPK1 strongly interacts with AtCBL1, AtCBL9 (Kolukisaoglu et al. 2004) and AtCBL2 (Albrecht et al. 2001). In this study, Y2H assay indicated that the three calcineurin B-like proteins, ZmCBL1, ZmCBL4 and ZmCBL9, were identified as ZmCIPK8-interacting proteins. This was consistent with a previous study in which AtCBL1 and AtCBL9 exhibited a significant interaction with AtCIPK8 in Y2H assay (Kolukisaoglu et al. 2004). Protein localization displayed membrane targeting of AtCBL1, AtCBL9 (Albrecht et al. 2003; Pandey et al. 2004) and ZmCBL3, ZmCBL4 and ZmCBL5 (Zhao et al. 2009). Similarly, the AtCBL1, AtCBL4, AtCBL5, and AtCBL9 all harbor a conserved myristoylation motif that plays an important role for protein-membrane localization (Batistic et al. 2004; Batistic et al. 2008). We found that four maize CBLs (ZmCBL1, ZmCBL4, ZmCBL5 and ZmCBL9) are also modified at N-terminus by the fatty acid myristate (Wang et al. 2014). In contrast to CBLs, CIPKs do not have any localization signal or the myristoylation site (Kolukisaoglu et al. 2004) and their localization may be dependent on their specific interaction partners (Batistic et al. 2004; Xu et al. 2006; Chen et al. 2012; D’Angelo et al. 2006). A previous study showed that ZmCIPK16 localized in the nucleus, plasma membrane and cytoplasm. However, it was recruited to the plasma membrane by interaction with ZmCBL3, ZmCBL4 and ZmCBL5, which localize to the plasma membrane (Zhao et al. 2009). A similar observation was also made in a study of other CIPK subcellular localization (Xu et al. 2006; D’Angelo et al. 2006). In the present study, BiFC analysis also proved that ZmCIPK8 interacted with ZmCBL1, ZmCBL4 and ZmCBL9. Thus, it is speculated that the ZmCIPK8/ZmCBLs complex may also function in maize by interacting with some membrane-localized proteins as their targets.

The present results showed that ZmCIPK8 expression was increased by drought stress and over-expression of ZmCIPK8 enhanced the transgenic tobacco drought tolerance from the phenotype. Moreover, proline content was higher in transgenic lines than in WT under drought, as observed in drought tolerance plant species and plays important role in protecting plants from drought stress (Yoshiba et al. 1997; Man et al. 2011). SOD is a major antioxidant enzyme which scavenges superoxide radicals under stress conditions (Mittova et al. 2004). In the present studies, it was found that lower levels of MDA and higher activity of SOD were observed in transgenic lines under drought stress, suggesting lower levels of lipid peroxidation in transgenic plants (Mittler et al. 2004). Our results revealed that whether from the analysis of phenotype or stress physiological indexes, ZmCIPK8 may indeed enhance plants stress tolerance.

AtCIPK8, a high homolog to ZmCIPK8, can regulate the low-affinity phase of the primary nitrate response and play a key role in nitrogen signaling (Hu et al. 2009; Castaings et al. 2011). In the study, we found that ZmCIPK8 expression was slightly changed under a certain concentration of KNO3, but not changed under KCl or ammonium succinate (Supplemental Figure.S2). Therefore, despite the conservation of the salt overly sensitive pathway observed in rice (Martínez-Atienza et al. 2007), Arabidopsis (Gong et al. 2004) and maize (Zhao et al. 2009), CIPKs functions somewhat differ in different plant species.

Stress acclimation in plants depends on changes in the molecular processes (especially gene expression), which initiate readjustment of physiology and metabolism. Many stress-related genes, such as MAPK, WRKY, NAC and Rd29A (Albrecht et al. 2003; Xiong et al. 2003; Gao et al. 2010; Li et al. 2015; Wang et al. 2015) have been proved to be induced in this process. For example, Rd29A responds to a variety of stress and ABA signals and serves as a model system for the dissection of promoter regions responsive to stress- and ABA-induced expression in plants (Shinozaki et al. 2000; Seki et al. 2001). In this study, we demonstrated that the three stress-related genes, especially for Rd29A, were significantly induced in the transgenic lines under drought stress. Therefore, ZmCIPK8 perhaps is involved in plant response to drought and other abiotic stress through regulating stress-related genes. Our results will enrich knowledge of the molecular drought response mechanisms of maize. However, whether ZmCIPK8 functions like AtCIPK1 (D’Angelo et al. 2006) in stress response by alternative complex formation with either CBL1 or CBL9 needs further study.

Acknowledgments

This work was supported by National Natural Science Foundation of China (http://www.nsfc.gov.cn/; grant no. 31100200, to FJT), Plan for Scientific Innovation Talent of Henan Province (http://www.hnkjt.gov.cn/; grant no. 144200510012, to WW), Key Project of Henan Educational Committee (http://www.haedu.gov.cn/; grant no. 14A180005, to FJT) and State Key Laboratory of Crop Biology in Shandong Agricultural University (http://klab.sdau.edu.cn/; grant no. 2014KF04, to FJT).

Supplementary material

11240_2015_906_MOESM1_ESM.ppt (225 kb)
Supplementary material 1 (PPT 225 kb)
11240_2015_906_MOESM2_ESM.ppt (3.3 mb)
Supplementary material 2 (PPT 3417 kb)

Funding information

Funder NameGrant NumberFunding Note
National Natural Science Foundation of China
  • 31100200
Plan for Scientific Innovation Talent of Henan Province
  • 144200510012
Key Project of Henan Educational Committee
  • 14A180005
State Key Laboratory of Crop Biology in Shandong Agricultural University
  • 2014KF04

Copyright information

© Springer Science+Business Media Dordrecht 2015

Authors and Affiliations

  • Fuju Tai
    • 1
  • Zhiheng Yuan
    • 1
  • Shipeng Li
    • 1
  • Qi Wang
    • 1
  • Fuyang Liu
    • 1
  • Wei Wang
    • 1
  1. 1.Collaborative Innovation Center of Henan Grain Crops, State Key Laboratory of Wheat and Maize Crop Science, College of Life ScienceHenan Agricultural UniversityZhengzhouChina

Personalised recommendations