Advertisement

Plant Cell, Tissue and Organ Culture (PCTOC)

, Volume 105, Issue 3, pp 309–316 | Cite as

Cloning and characterization of an AtNHX2-like Na+/H+ antiporter gene from Ammopiptanthus mongolicus (Leguminosae) and its ectopic expression enhanced drought and salt tolerance in Arabidopsis thaliana

  • Q. Wei
  • Y. J. Guo
  • H. M. Cao
  • B. K. KuaiEmail author
Original Paper

Abstract

An orthologue of the vacuolar Na+/H+ antiporter gene, AmNHX2, was isolated from a desert plant, Ammopiptanthus mongolicus, by RACE-PCR. It has a total length of 1,986 bp, with an open reading frame of 1,632 bp, encoding a predicted polypeptide of 543 amino acids. Sequence similarity and exon constituent analysis clearly suggested that AmNHX2 encoded an AtNHX2 (an antiporter from Arabidopsis) like vacuolar Na+/H+ antiporter. AmNHX2 could be strongly induced by both drought and salt stress. Heterologous expression in the yeast mutant nhx1 indicated that AmNHX2 was the orthologue of ScNHX1, and the complementation effect was almost the same as AtNHX1. Over-expressing AmNHX2 resulted in enhanced tolerances to both drought and salt stresses in transgenic Arabidopsis plants. The transgenic plants accumulated lower Na+ content in their leaves, showing healthier root system after salt stress, and retained more water during the drought stress. Our work suggested that AmNHX2 was a salt tolerance determinant in A. mongolicus, but might not be a contributor to the difference in salt sensitivity between A. thaliana and A. mongolicus.

Keywords

Na+/H+ antiporter Ammopiptanthus mongolicus Salt tolerance Drought tolerance 

Introduction

Salt as well as drought stress are two main abiotic stresses with adverse effects on plant growth, development and productivity (Huai et al. 2009; Jin et al. 2010). Salt toxicity can mainly be attributed to Na+ specific damage to the cytoplasm of plant cells (Zhao et al. 2007).There are two important ways to reduce the sodium damage. One way is to exclude the sodium from the cytoplasm by the plasma Na+/H+ antiporter, the other is to pump the sodium to the vacuole via vacuolar Na+/H+ antiporters (Zhu 2003). Pumping sodium ions into vacuole via vacuolar Na+/H+ antiporters has two advantages:(1) reducing the toxic levels of sodium in the cytosol; and (2) increasing the vacuolar osmotic potential with the concomitant generation of a more negative water potential that favors water uptake by the cell and better tissue water retention under high soil salinity (He et al. 2005). In addition to the known role of Na+/H+ antiporter gene family in ion homeostasis, recent researches indicated that it was also involved in other cellular processes. Sottosanto et al. (2004) found that AtNHX1, one of the vacuolar Na+/H+ antiporter genes of Arabidopsis, might play a significant role in intracellular vesicular trafficking, protein targeting, and other cellular processes, using DNA array analysis. Yamaguchi et al. (2001) discovered that the purple flower of Japanese morning glory was caused by a recessive mutation in a Na+/H+ antiporter gene. Hanana et al. (2007) also found that a vacuolar NHX protein is associated with Berry ripening.

As expected, over-expression of antiporter genes results in enhanced tolerances to salt stress in different plant species (Apse et al. 1999; Chen et al. 2008; He et al. 2005; Ohta et al. 2002; Wu et al. 2005; Xue et al. 2004; Zhang and Blumwald 2001a; Zhang et al. 2001b). There are six Na+/H+ antiporter genes in Arabidopsis, three of them (AtNHX1, AtNHX2 and AtNHX3) displayed the great potential to improve plant salt tolerance (Apse et al. 1999; Liu et al. 2008; Yokoi et al. 2002).

A. mongolicus is the relics of the Tertiary Period, distinctively distributed in the northwestern desert area of China, where is marked by seasonally extreme drought and temperatures (over 40°C in the summer and under −30°C in the winter), poor soil quality with high salinity, and extraordinarily high ultraviolet irradiation (Wang et al. 2007). However, in the early period of the Tertiary Period, it mainly distributed in the coast of Ancient Mediterranean, indicating that it was once adapted to the wet and warm climate. Therefore, the afterwards evolvement of its extreme tolerances to a combination of abiotic stresses could be logically attributed to the gradual climate change (e.g. from warm and wet to extremely hot/cold and dry/salty), incurred by the geological change. The distinctive character makes A. mongolicus a valuable system for exploiting the mechanistic evolvement of abiotic stress tolerances in plants. However, there are only two reports attempting to address its antifreezing mechanism in literature (Cao et al. 2009a; Liu et al. 2010). Our previous work (unpublished) revealed that A. mongolicus seedlings could grow well in the presence of 200 mM sodium chloride (NaCl). This result, as well as its high salinity habit, suggested that A. mongolicus is a typical halophyte. Nevertheless, it has no salt secreting structures, such as salt gland or bladder cells. We speculated that its extreme salt tolerance might be due to its other capacities, such as its strong Na+ compartmentalization capability. In this paper, we presented our work on the cloning and molecular characterization of a new AtNHX2 like antiporter gene from A. mongolicus, its expression pattern under drought and salt stress, a comparative study of complementation efficiency of AmNHX2 and AtNHX1 using nhx1 yeast mutant and finally its functional characterization by over-expression in Arabidopsis.

Materials and methods

Isolation of AmNHX2

A pair of degenerate PCR primers, AmNHX2CR (forward: 5′CTTGGTGGGTC TTCTATGGCT3′; reverse:5′AGGCAAGGCCAAATATAACATT3′) were designed for amplification of partial cDNAs of Na+/H+ antiporter analogue gene from A. mongolicus basing on multi-alignment of the full-length mRNA sequences from different species of plants. Two primers (forward: 5′CTGAGTGGCATTCTAACTG TATTCTTTTCT3′; reverse: 5′ACTTGGCATAATGTGACTGAGAGC3′) were designed to perform 3′-RACE cDNA synthesis using the Smart™ RACE cDNA Amplification Kit (Clontech, Palo Alto, CA, USA). Five primers [AmNHX25RRT (5′TGCTCCAGGTCAAAG3′), AmNHX25RA1 (5′GCAGGTGCTAAATCAGGAT GA3′), AmNHX25RS1 (5′TGACACCCAAAGTTATGACGG3′), AmNHX25RA2 (5′GGGAGGGTGTTGTGAATGA3′), AmNHX25RS2 (5′AATGTACCAACAGCA CCAAAC3′)] were designed to perform 5′-RACE cDNA synthesis using 5′-RACE Amplification Kit (Takara, Japan). The clones obtained were sequenced and the overlapping region with the first clone was confirmed. After re-construction of the open reading frame, a fragment containing the open reading frame was re-obtained by PCR with primer AmNHX2EL (forward: 5′TGCTTATTGGTTGGAGAGTGGAC3′, reverse: 5′CACAGCCTTCTCAGTTCGCAC3′) from the root cDNA library and sequenced for further confirmation.

Exon constituent analysis

Two pairs of primers, AmNHX2GF (forward: 5′TGCTTATTGGTTGGAGAGT GGAC3′, reverse: 5′GCTCTCAGTCACATTATGCCAAGT3′) and AmNHX2GB (forward: 5′ACTTGGCATAATGTGACTGAGAGC3′, reverse: 5′CACAGCCTT CTCAGTTCGCAC 3′), were designed to amplify the partial genomic DNA of AmNHX2. After sequenced, the two sequences were linked from the overlapping region. Intron–exon structure of AmNHX2 was constructed by manual alignment of cDNA sequence with the genomic sequence. The gene structure information of AtNHX1 and AtNHX2 was obtained from the TAIR website (http://www.arabidopsis.org/).

Real-time PCR

Seeds of A. mongolicus were surface-sterilized with HgCl2, and grown on MS medium plate. Ten days after sowing, seedlings were carefully pulled out and moved to the liquid MS medium contained 200 mM NaCl to incubate for various time periods (0, 1, 2, 4, 8, 12, and 24 h) before sampled for RNA extraction. For drought treatment, seedlings were moved to a 13 cm-filter paper, and kept in a chamber for 1 h and 1.5 h respectively. Total RNAs were extracted from the root of salt and drought treated seedlings and non-treated seedlings using TRIzol reagent (Invitrogen). First-strand cDNA synthesis was performed with 5 μg of total RNA using a first-strand cDNA synthesis kit (Shenergy Biocolor). The products were subsequently used as templates for Real-time PCR analysis. The Real-time PCR was performed using SYBR Green I PCR kit (Toyobo) on an iCycler (Bio-Rad) according to the manufacturer’s suggestions with AmACTIN2 as a reference. Fold changes of RNA transcripts were calculated by the 2−ΔΔCt method (Livak and Schmittgen 2001). The entire experiments were repeated at least 3 times.

Partial cDNA fragment of internal control AmACTIN2 was obtained by PCR with degenerate primers: (forward: 5′GAAGCACAATCCAAAAGAGGTAT3′, reverse: 5′GAGCCTCCGATCCAGACACT3′). The resulting fragment was cloned to pMD19-T and sequenced by Invitrogen Inc. (USA).

Specific primers for real-time PCR to respective genes were as follows: AmNHX2 (forward: 5′CCATCCAGCATTCGTGCCTTAC3′, reverse: 5′GACCATTGCGTTCA GATGGTGAG3′), AmACTIN2 (forward: 5′CCATCCAGGCTGTGCTTTCT3′, reverse: 5′AGATCACGCCCTGCAAGGT3′).

Yeast expression vectors construction

The AmNHX2 and AtNHX1(GenBank accession no. NM_122597) ORFs were amplified with primer AmNHX2EL (forward:5′TGCTTATTGGTTGGAGAGTG GAC 3′, reverse: 5′CACAGCCTTCTCAGTTCGCAC 3′) and primer AtNHX1Y (forward: 5′ TCTGGATCCATGTTGGATTCTCTAGT3′, reverse:5′ATGGTCGAC TCAAGCCTTACTAAGATC3′), respectively, using KOD-Plus polymerase (TOYOBO Inc., Japan).The resulting fragment were cloned into pMD19-T vector and sequenced by Invitrogen Inc(USA). The DNA fragments of AtNHX1 and AmNHX2 were then digested from the pMD19-T vector by BamHI/SalI and subcloned into the BamHI/SalI site of the p426ADH vector between the ADH promoter and the CYC1 terminator.

Functional assays using the yeast mutant

The nhx1 yeast mutant (kindly presented by Professor Zhang Hong-Xia) was transformed with p426ADH-AmNHX2, p426ADH-AtNHX1, and p426ADH as a control using LiAc/polyethylene glycol method. All yeast strains including the wild type were grown at 28°C for 16–18h to reach OD600 1.5–2.0 in SD Ura or YPD liquid medium (wild type). After adjusting OD600 to 1.0, aliquots (2.5 μl) of adjusted cultures and two fivefold serial dilution of the cultures were spotted onto YPD medium supplemented with or without 50 mg L−1 hygromycin. Growth status was compared after culturing the strains at 28°C for 3 days.

Generation of transgenic arabidopsis plants

The AmNHX2 ORF was digested from the AmNHX2/pMD19-T vector by BamHI/SalI and sub-cloned into the BamH1/Sal1 site of pCHF3 plasmid between the 35 s promoter and rubisco terminator. The resulting construct of AmNHX2/pCHF3 was introduced into LBA4404 Agrobacterium tumefaciens by freeze–thaw method. Arabidopsis (Columbia-0) was transformed using floral-dipping method. Putative transgenic plants were selected on the plate supplemented with 50 mg l−1 Kanamycin, and were further verified by PCR.

Semi-quantitative PCR

Total RNA extraction and First-strand cDNA synthesis were carried out as described previously. Using AtACTIN2 as an inter control, RT–PCR was performed with following primers, AmNHX2RT (forward: 5′ATGGAGGTTTGTCAGTGATAG CC3′, reverse: 5′AATGCTGGATGGACGAGGAA3′) and AtACT2 (forward: 5′ ACT GTGCCA ATCTACGAGGGT 3′, reverse: 5′AGCGATACCTGAGAACATAGTGG 3′).

Salt and drought stress treatment

T3 seeds of transgenic plants were surface-sterilized by HgCl2, and germinated on the MS plate containing 50 mg l−1 Kanamycin. Seeds of wild type plants were germinated on the MS plate. Seven days after sowing, well-rooted seedlings were moved to 10-cm-side square pots with soil (peat soil:vermiculite:pearlite [v/v/v] 3:9:0.5 purchased from Shanghai Institute of Landscape Science) presoaked with plant nutrient medium, and grown in a 10-h light/14-h dark cycle(salt tolerance test) or 16-h light/8-h dark cycle (drought tolerance test) at 24°C. The pots were flooded for 2 h every 5 days. Twenty-four wild-type plants and twenty-four of each of the two AmNHX2-overexpressing transgenic lines (MN-2, MN-3) were selected for salt stress treatment at day of 30. The water was supplemented with NaCl, incrementally increasing with each successive watering from 100 through 150, and 200 to a final concentration of 250 mM NaCl. Twenty-four wild-type plants and twenty-four of each of the two AmNHX2-overexpressing transgenic lines (MN-2, MN-3) were selected for drought stress treatment at day of 20. Plants were flooded for 2 h and then kept for 16-day water deprivation.

Determination of lipid peroxidation

MDA measurement was carried out as described in the reference (Cao et al. 2009b).

Determination of Na+ and K+ content

Leaves were carefully excised from the rosette to determine the Na+ and K+ concentrations. After 24 h at 75°C, the dry weight was measured. Na+ and K+ were extracted with 0.001 N HAc at 90°C for 3 h. The supernatants were analyzed by atomic absorption.

Measurements of relative water content (RWC)

RWC measurements were carried out as described in the reference (Gaxiola et al. 2001).

Results

Isolation and molecular characterization of AmNHX2

To facilitate isolation of salt stress responsive genes, a cDNA library was constructed using mRNA isolated from salt-treated radicals of A. mongolicus. A cDNA of 1986 nucleotides in length, with an open reading frame of 1,632 bp, was then obtained by RACE PCR from the cDNA library. It encodes a polypeptide of 544aa, with 12 putative transmembrane helixes, predicted by online programme TMpred (http://www.ch.embnet.org/software/TMPRED_form.html). NCBI blast showed that it belonged to the vacuolar Na+/H+ antiporter gene family, and has 86%, 87% identity with AtNHX1 and AtNHX2, respectively. Phylogenic relationship analysis with Na+/H+ antiporter gene family of Arabidopsis indicated that it clustered with the subfamily of AtNHX1 and AtNHX2, and was much closer to AtNHX2, consequently tentatively named as AmNHX2 (Fig. 1a). According to the PCR amplified genomic DNA sequence, it contained 14 exons and 13 introns (Fig. 1b). The expression of AmNHX2 could be induced by both drought and salt stress, being more responsive to drought stress. After 1 h exposure to the air, its transcript level in the root increased about fivefold, and then decreased to about threefold at the time point of 1.5 h, compared to a 2–3 fold increase after salt treatment. Its transcript level remained stable and high between 2 and 8 h (2.7-fold averagely), but decreased to about 1.5-fold between 12 and 24 h after salt treatment (Fig. 2).
Fig. 1

The phylogenetic and exon constituent analysis of AmNHX2. a The phylogenetic analysis of AmNHX2 with six Arabidopsis Na+/H+ antiporters and a plasma membrane Na+/H+ antiporter. The accession numbers obtained from GenBank were followed with Na+/H+ antiporters’ names. b Exon constituent of AtNHX1, AtNHX2 and AmNHX2. Accession numbers obtained from GenBank are given for CDS. Exons are represented by boxes, and introns by lines, with length (bp) displayed above exons and below introns. Purple boxes indicated the split exon of NHX2

Fig. 2

Expression patterns of AmNHX2 under stresses. For salt treatment, 10-day-old seedlings growing on MS plate were carefully pulled out and moved into the liquid MS medium containing 200 mM NaCl to incubate for different periods (0, 1, 2, 4, 8, 12, and 24 h) (a). For drought treatment, the pulled out seedlings were kept in a chamber on the 13-cm filter papers for 1 and 1.5 h (b). Total RNA extracted from the root of treated and untreated seedlings (as a control) was used for the real time RT–PCR analysis, with AmACTIN2 as an internal control. Fold changes of RNA transcripts were calculated by the 2−ΔΔCt method. The entire experiments were repeated at least three times

Functional characterization of AmNHX2 using yeast mutant nhx1

Previous work showed that hetero-expressions of Na+/H+ antiporter genes in yeast mutant nhx1 could partly suppress its hypersensitivity to hygromycin. The similar method was exploited to initially characterize the function of AmNHX2. As shown in Fig. 3a, both AmNHX2 and AtNHX1 (as a positive control) could partly restore the hygromycin tolerance of nhx1, with almost the same efficiency.
Fig. 3

Functional characterization of AmNHX2 using yeast mutant and identification as well as phenotypic analysis of AmNHX2 transgenic Arabidopsis plants. Functional characterization of AmNHX2 using nhx1 yeast mutant (a). RT–PCR analysis of AmNHX2 expression in representative transgenic lines, MN-2, MN-3 and MN-9; (−), H2O; Wt, wild type (b). Phenotypes of transgenic plants under salt stress (c). AmNHX2 transgenic plants displayed more vigorous root system after salt stress (d). Phenotypes of transgenic plants after water-deprivation for 16 days (upper row) and after re-watering for 24 h (below row) (e)

Ectopic over-expression of AmNHX2 resulted in enhanced tolerance to salt stress in Arabidopsis

To characterize AmNHX2 functionally in planta, its open reading frame (ORF), driven by 35S promoter, was introduced into Arabidopsis using floral-dipping method. Twenty putative transgenic lines were obtained and eight leaves from each of the lines were taken to determine the transcript levels of AmNHX2 by reverse transcription RT–PCR. A 500 bp AmNHX2 specific fragment was detected in all the putative transgenic lines, but not in the wild type. A higher AmNHX2 transcript level was accumulated in MN-2 than in MN-3 and MN-9, with AtACTIN2 as an internal control (Fig. 3b). MN-2 and MN-3 were representatively used in the following analyses.

Six rosette leaves from each of the above lines were used for determining the MDA contents. Both of the two lines accumulated lower MDA contents (MN-2, an average of about 27% lower; MN-3, an average of about 18% lower) after salt stress than wild type plants (Fig. 4a). Eight rosette leaves from each of the lines were used for determining the Na+ and K+ contents. As shown in Fig. 4c, d, transgenic plants accumulated about 30% lower Na+ content but slightly higher K+ content (an average of about 4% higher) in their leaves after salt stress. The K+/Na+ ratio in the transgenic plants (about 0.2) was significantly higher than that in the wild type (about 0.13).
Fig. 4

Physiological variations of transgenic plants under stresses. a, MDA contents in the wild type plants (Wt) and AmNHX2 transgenic plants after salt stress. Values are means ± SD (n = 6 for each). b Relative water content in plants under a water deficit stress. Values are means ± SD (n = 8 for each). c, d, Na+ and K+ contents in wild type and AmNHX2 transgenic plants after salt stress (NaCl). Values are means ± SD (n = 8 for each)

The transgenic plants, grown under 10 h-light/14 h-dark photoperiod for 30 days, were subjected to salt stress treatment. The growth of all the plants was inhibited in 250 mM NaCl solution. However, MN-2 and MN-3 grew better than the control plants. After 14 days in the solution, the wild type exhibited inhibitory growth state and severer chlorosis, whereas the transgenic plants remained healthier and greener (Fig. 3c) as well as showing more vigorous root system (Fig. 3d).

AmNHX2 transgenic plants are also drought tolerant

Both transgenic and control plants, grown under 16 h-light/8 h-dark photoperiod for 30 days, were water-deprived for 16 days at 24°C before re-watered. As shown in Fig. 3e, after 15-day water deprivation, the control plants were severely wilted and could not be recovered by re-watering, while the two transgenic lines were lightly wilted and fully recovered 24 h after re-watering. The level of drought tolerance of the two transgenic lines correlated with the transcript level of AmNHX2, with MN-2 being more tolerant. The drought resistance of the transgenic plants precisely correlated with their water loss during the drought stress, either in comparison with the control or between them (Fig. 4b). Ten days after water deprivation, the control plants began to lose water, with their RWC values dropping to 0.88, and a sharp reduction in their RWCs was observed at days 12 and 14 (0.76 and 0.42 respectively). However, no significant water losses were observed in the two transgenic lines until day 12, with their RWCs dropping to 0.64 (MN-2) and 0.61 (MN-3) respectively at day 14 (Fig. 4b).

Discussion

In this report, a new salt and drought induced Na+/H+ antiporter gene was isolated from the salt-treated root cDNA library of a leguminous plant, A. mongolicus, by RACE-PCR. Sequence analysis revealed that it encoded an AtNHX2-like antiporter protein, consequently named as AmNHX2. AmNHX2 is the first orthologue of AtNHX2 isolated from the halophyte.

Further structural analysis revealed that AmNHX2 contained 14 exons and 13 introns, the same numbers as those in AtNHX2, in contrast to 13 exons and 12 introns in AtNHX1. AtNHX1 shares the similar constituent of exons with AtNHX2 except the 10th exon, which was seemingly split into two exons (the tenth and eleventh exons) in AtNHX2 sometime and somehow during the evolution process (Fig. 1b). Although AtNHX1-like antiporters and AtNHX2-like antiporters share a high degree of similarity in the amino acid, the differentiation in their structures implies that they may undergo a functional diversification process.

Previous studies reveal that the transcript level of the Na+/H+ antiporter genes is responsive to salt stress and high temperature (Porat et al. 2002; Yokoi et al. 2002). In this study, it was not only observed that AmNHX2 was significantly responsive to salt stress, but also found that it could be strongly induced by drought stress (up to fivefold). This indicated that AmNHX2 might play a dual role in both the detoxification of Na+ and the adjustment of osmosis. The rapid response to salt stress as well as the sustained high transcriptional level during the salt stress treatment suggested that AmNHX2 was quite likely a salt tolerance determinant in A. mongolicus.

As far as NHX genes are concerned, it is still an open question whether there are more efficient NHX orthologues in extremely stress-tolerant resource plants. Vacuolar Na+/H+ antiporter gene was first isolated from yeast, and many orthologues genes have been obtained from different species of higher plants (Brini et al. 2005; Fukuda et al. 2004; Hamada et al. 2001; Hanana et al. 2007; Li et al. 2007; Porat et al. 2002; Qiao et al. 2007; Tang et al. 2010; Wu et al. 2004; Xia et al. 2002; Yamaguchi et al. 2001). However, there have been no reports on the difference in the efficiency of NHX genes isolated from glycophyte and halophyte. In this study, AtNHX1, which is a typical glycophyte vacuolar antiporter gene from Arabidopsis (Apse et al. 1999), was introduced to compare the functional efficiency with AmNHX2. To facilitate the analysis, AmNHX2 and AtNHX1 were hetero-expressed in nhx yeast mutant. As shown in Fig. 2a, AmNHX2 could functionally complement nhx1, and the complementation effect was almost the same as AtNHX1. This might suggest that AtNHX1 and AmNHX2 have almost the same efficiency as far as their biochemical functions are concerned. Therefore, the difference in salt sensitivity between A. thaliana and A. mongolicus may not be attributed to the function of AmNHX2.

It has been reported that over-expression of a Na+/H+ antiporter gene from wheat increases both salt and drought tolerances in Arabidopsis (Brini et al. 2007). In this study, ectopic over-expression of AmNHX2 also enhanced salt tolerance, with much lower MDA detected after salt stress as well as lower sodium accumulated in leaves, and drought tolerance, with stronger water-retaining capability during drought stress. Previous reports showed that over-expression of the Na+/H+ antiporter gene in plant resulted in more Na+ content in leaves after salt stress in some cases (Apse et al. 1999; Brini et al. 2007; Zhang et al. 2001b), but not in the other (Fukuda et al. 2004; Xue et al. 2004; Zhang et al. 2008; Zhao et al. 2007). In our work, lower Na+ content in the leaves of transgenic plants was observed. It was tentatively ascribed to the more vigorous root system of transgenic plants under high salt stress (Fig. 2d). Most of superfluous Na+ was possibly pumped into the vacuole of roots and less Na+ transferred to leaves. In contrast, wild type plants have weak and less extensive root system under high salt growth condition, the superfluous Na+ has to be translocated into leaves to alleviate the toxicity of Na+. In fact, Saqib et al. (2005) also reported that salt-resistant wheat with higher expression of vacuolar Na+/H+ antiporter displayed a lower Na+ translocation from roots to shoots, compared with the salt-sensitive genotypes. Zhang et al. (2008) proposed a possible salt tolerance mechanism by which superfluous Na+ is restricted in the roots in order to alleviate Na+ toxicity to leaves. Our result suggested that AmNHX2- like antiporter genes may exhibit a salt tolerant role via a similar mechanism.

AtNHX1 is one of the most effective genes in improving plant salt tolerance. However, Apse et al. (2003) found that AtNHX1 played a dominant role mainly in leaf. The nhx1 Arabidopsis plants showed an altered leaf development, with reduction in the frequency of large epidermal cells and a reduction in overall leaf area compared to wild-type plants, while no significant differences in root growth between wild-type and nhx1 plants were observed when the seedlings were grown for a week in the absence or presence of 100 mM NaCl (Apse et al. 2003). Our result suggested that AmNHX2-like antiporter genes might play an important role in the root resistance to Na+ toxity. Therefore, we could assume that co-overexpression of AtNHX1-like antipoters with AmNHX2-like antiporters might create much more salt tolerant plants in a synergistic way.

Notes

Acknowledgments

We are grateful to Renjie Tang and Dr. Hongxia Zhang of the Institute of Plant Physiology & Ecology, who generously offered the yeast mutant nhx1. We thank Wei Wang and Dr. Hongxuan Lin of the Institute of Plant Physiology & Ecology for their help in the measurement of Na+ and K+ contents. This work was supported by a grant from the Science and Technology Committee of the Shanghai Municipal Government (Grant no. 08DZ2270800) and grants (2008ZX08009-004, 2009ZX08009-061B) from the National Program of Transgenic Variety Development of China.

References

  1. Apse MP, Aharon GS, Snedden WA, Blumwald E (1999) Salt tolerance conferred by overexpression of a vacuolar Na +/H + antiport in Arabidopsis. Science 285:1256–1258PubMedCrossRefGoogle Scholar
  2. Apse MP, Sottosanto JB, Blumwald E (2003) Vacuolar cation/H + exchange, ion homeostasis, and leaf development are altered in a T-DNA insertional mutant of AtNHX1, the Arabidopsis vacuolar Na +/H + antiporter. Plant J 36:229–239PubMedCrossRefGoogle Scholar
  3. Brini F, Gaxiola RA, Berkowitz GA, Masmoudi K (2005) Cloning and characterization of a wheat vacuolar cation/proton antiporter and pyrophosphatase proton pump. Plant Physiol Biochem 43:347–354PubMedGoogle Scholar
  4. Brini F, Hanin M, Mezghani I, Berkowitz GA, Masmoudi K (2007) Overexpression of wheat Na +/H + antiporter TNHX1 and H + -pyrophosphatase TVP1 improve salt- and drought-stress tolerance in Arabidopsis thaliana plants. J Exp Bot 58:301–308PubMedCrossRefGoogle Scholar
  5. Cao PX, Song J, Zhou CJ, Weng ML, Liu J, Wang FX, Zhao F, Feng DQ, Wang B (2009a) Characterization of multiple cold induced genes from Ammopiptanthus mongolicus and functional analyses of gene AmEBP1. Plant Mol Biol 69:529–539PubMedCrossRefGoogle Scholar
  6. Cao YJ, Wei Q, Liao Y, Song HL, Li X, Xiang CB, Kuai BK (2009b) Ectopic overexpression of AtHDG11 in tall fescue resulted in enhanced tolerance to drought and salt stress. Plant Cell Rep 28:579–588PubMedCrossRefGoogle Scholar
  7. Chen LH, Zhang B, Xu ZQ (2008) Salt tolerance conferred by overexpression of Arabidopsis vacuolar Na +/H + antiporter gene AtNHX1 in common buckwheat (Fagopyrum esculentum). Transgenic Res 17:121–132PubMedCrossRefGoogle Scholar
  8. Fukuda A, Nakamura A, Tagiri A, Tanaka H, Miyao A, Hirochika H, Tanaka Y (2004) Function, intracellular localization and the importance in salt tolerance of a vacuolar Na +/H + antiporter from rice. Plant Cell Physiol 45:146–159PubMedCrossRefGoogle Scholar
  9. Gaxiola RA, Li JS, Undurraga S, Dang LM, Allen GJ, Alper SL, Fink GR (2001) Drought- and salt-tolerant plants result from overexpression of the AVP1 H + -pump. Proc Natl Acad Sci USA 98:11444–11449PubMedCrossRefGoogle Scholar
  10. Hamada A, Shono M, Xia T, Ohta M, Hayashi Y, Tanaka A, Hayakawa T (2001) Isolation and characterization of a Na +/H + antiporter gene from the halophyte Atriplex gmelini. Plant Mol Biol 46:35–42PubMedCrossRefGoogle Scholar
  11. Hanana M, Cagnac O, Yamaguchi T, Hamdi S, Ghorbel A, Blumwald E (2007) A grape berry (Vitis vinifera L.) cation/proton antiporter is associated with berry ripening. Plant Cell Physiol 48:804–811PubMedCrossRefGoogle Scholar
  12. He CX, Yan JQ, Shen GX, Fu LH, Holaday AS, Auld D, Blumwald E, Zhang H (2005) Expression of an arabidopsis vacuolar sodium/proton antiporter gene in cotton improves photosynthetic performance under salt conditions and increases fiber yield in the field. Plant Cell Physiol 46:1848–1854PubMedCrossRefGoogle Scholar
  13. Huai JL, Zheng J, Wang GY (2009) Overexpression of a new Cys(2)/His(2) zinc finger protein ZmZF1 from maize confers salt and drought tolerance in transgenic Arabidopsis. Plant Cell Tissue Org 99:117–124CrossRefGoogle Scholar
  14. Jin TC, Chang Q, Li WF, Yin DX, Li ZJ, Wang DL, Liu B, Liu LX (2010) Stress-inducible expression of GmDREB1 conferred salt tolerance in transgenic alfalfa. Plant Cell Tissue Org 100:219–227CrossRefGoogle Scholar
  15. Li JY, Jiang GQ, Huang P, Ma J, Zhang FC (2007) Overexpression of the Na +/H + antiporter gene from Suaeda salsa confers cold and salt tolerance to transgenic Arabidopsis thaliana. Plant Cell Tissue Org 90:41–48CrossRefGoogle Scholar
  16. Liu H, Wang QQ, Yu MM, Zhang YY, Wu YB, Zhang HX (2008) Transgenic salt-tolerant sugar beet (Beta vulgaris L.) constitutively expressing an Arabidopsis thaliana vacuolar Na +/H + antiporter gene, AtNHX3, accumulates more soluble sugar but less salt in storage roots. Plant Cell Environ 31:1325–1334PubMedCrossRefGoogle Scholar
  17. Liu RL, Liu MQ, Liu J, Chen YZ, Chen YY, Lu CF (2010) Heterologous expression of a Ammopiptanthus mongolicus late embryogenesis abundant protein gene (AmLEA) enhances Escherichia coli viability under cold and heat stress. Plant Growth Regul 60:163–168CrossRefGoogle Scholar
  18. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(T)(-Delta Delta C) method. Methods 25:402–408PubMedCrossRefGoogle Scholar
  19. Ohta M, Hayashi Y, Nakashima A, Hamada A, Tanaka A, Nakamura T, Hayakawa T (2002) Introduction of a Na +/H + antiporter gene from Atriplex gmelini confers salt tolerance to rice. Febs Lett 532:279–282PubMedCrossRefGoogle Scholar
  20. Porat R, Pavoncello D, Ben-Hayyim G, Lurie S (2002) A heat treatment induced the expression of a Na +/H + antiport gene (cNHX1) in citrus fruit. Plant Sci 162:957–963CrossRefGoogle Scholar
  21. Qiao WH, Zhao XY, Li W, Luo Y, Zhang XS (2007) Overexpression of AeNHX1, a root-specific vacuolar Na +/H + antiporter from Agropyron elongatum, confers salt tolerance to Arabidopsis and Festuca plants. Plant Cell Rep 26:1663–1672PubMedCrossRefGoogle Scholar
  22. Saqib M, Zorb C, Rengel Z, Schubert S (2005) The expression of the endogenous vacuolar Na +/H + antiporters in roots and shoots correlates positively with the salt resistance of wheat (Triticum aestivum L.). Plant Sci 169:959–965CrossRefGoogle Scholar
  23. Sottosanto JB, Gelli A, Blumwald E (2004) DNA array analyses of Arabidopsis thaliana lacking a vacuolar Na +/H + antiporter: impact of AtNHX1 on gene expression. Plant J 40:752–771PubMedCrossRefGoogle Scholar
  24. Tang R, Li C, Xu K, Du YH, Xia T (2010) Isolation, Functional Characterization, and Expression Pattern of a Vacuolar Na +/H + Antiporter Gene TrNHX1 from Trifolium repens L. Plant Mol Biol Rep 28:102–111CrossRefGoogle Scholar
  25. Wang W, Chen JJ, Li JN, Zhang YH, Shao ZY, Kuai B (2007) Extraordinary accumulations of antioxidants in Ammopiptanthus mongolicus (Leguminosae) and Tetraena mongolica (Zygophyllaceae) distributed in extremely stressful environments. Bot Stud 48:55–61Google Scholar
  26. Wu CA, Yang GD, Meng QW, Zheng CC (2004) The cotton GhNHX1 gene encoding a novel putative tonoplast Na +/H + antiporter plays an important role in salt stress. Plant Cell Physiol 45:600–607PubMedCrossRefGoogle Scholar
  27. Wu YY, Chen QJ, Chen M, Chen J, Wang XC (2005) Salt-tolerant transgenic perennial ryegrass (Lolium perenne L.) obtained by Agrobacterium tumefaciens-mediated transformation of the vacuolar Na +/H + antiporter gene. Plant Sci 169:65–73CrossRefGoogle Scholar
  28. Xia T, Apse MP, Aharon GS, Blumwald E (2002) Identification and characterization of a NaCl-inducible vacuolar Na +/H + antiporter in Beta vulgaris. Physiol Plant 116:206–212PubMedCrossRefGoogle Scholar
  29. Xue ZY, Zhi DY, Xue GP, Zhang H, Zhao YX, Xia GM (2004) Enhanced salt tolerance of transgenic wheat (Tritivum aestivum L.) expressing a vacuolar Na +/H + antiporter gene with improved grain yields in saline soils in the field and a reduced level of leaf Na+. Plant Sci 167:849–859CrossRefGoogle Scholar
  30. Yamaguchi T, Fukada-Tanaka S, Inagaki Y, Saito N, Yonekura-Sakakibara K, Tanaka Y, Kusumi T, Iida S (2001) Genes encoding the vacuolar Na +/H + exchanger and flower coloration. Plant Cell Physiol 42:451–461PubMedCrossRefGoogle Scholar
  31. Yokoi S, Quintero FJ, Cubero B, Ruiz MT, Bressan RA, Hasegawa PM, Pardo JM (2002) Differential expression and function of Arabidopsis thaliana NHX Na +/H + antiporters in the salt stress response. Plant J 30:529–539PubMedCrossRefGoogle Scholar
  32. Zhang HX, Blumwald E (2001) Transgenic salt-tolerant tomato plants accumulate salt in foliage but not in fruit. Nat Biotechnol 19:765–768PubMedCrossRefGoogle Scholar
  33. Zhang HX, Hodson JN, Williams JP, Blumwald E (2001) Engineering salt-tolerant Brassica plants: Characterization of yield and seed oil quality in transgenic plants with increased vacuolar sodium accumulation. Proc Natl Acad Sci USA 98:12832–12836PubMedCrossRefGoogle Scholar
  34. Zhang GH, Su Q, An LJ, Wu S (2008) Characterization and expression of a vacuolar Na +/H + antiporter gene from the monocot halophyte Aeluropus littoralis. Plant Physiol Biochem 46:117–126PubMedCrossRefGoogle Scholar
  35. Zhao JS, Zhi DY, Xue ZY, Liu H, Xia GM (2007) Enhanced salt tolerance of transgenic progeny of tall fescue (Festuca arundinacea) expressing a vacuolar Na +/H + antiporter gene from Arabidopsis. J Plant Physiol 164:1377–1383PubMedCrossRefGoogle Scholar
  36. Zhu JK (2003) Regulation of ion homeostasis under salt stress. Curr Opin Plant Biol 6:441–445PubMedCrossRefGoogle Scholar

Copyright information

© Springer Science+Business Media B.V. 2010

Authors and Affiliations

  1. 1.State Key Laboratory of Genetic Engineering, Institute of Plant Biology, School of Life SciencesFudan UniversityShanghaiChina
  2. 2.Bamboo Research Institute of Nanjing Forestry UniversityNanjingChina

Personalised recommendations