Genetica

, Volume 138, Issue 6, pp 633–648 | Cite as

Phylogenetic relationships among the black fly species (Diptera: Simuliidae) of Thailand based on multiple gene sequences

  • Suwannee Phayuhasena
  • Donald J. Colgan
  • Chaliow Kuvangkadilok
  • Pairot Pramual
  • Visut Baimai
Article

Abstract

Simulium is a very speciose genus of the black fly family Simuliidae that includes many important pests of humans and animals. Cytotaxonomic and morphological studies have made substantial progress in Simulium systematics. 16S rRNA and ITS-1 DNA sequence studies have assisted this progress. Intensive multi-gene molecular systematic investigations will, however, be required for a comprehensive understanding of the genus’ taxonomy and evolution. Our research was conducted to investigate the relationships of Thai Simulium at the subgeneric, species group and species levels. We also examined the possibility of using mitochondrial DNA sequences to facilitate Simulium species identification. Data were collected from three mitochondrial genes (COI, ND4 and 16S rRNA) and two segments of the nuclear 28S ribosomal RNA (the D1 to D2 and the D4 expansion regions). The subgenera Simulium and Gomphostilbia were monophyletic in most analyses. Nevermannia included Montisimulium but was otherwise monophyletic in multigene analyses. In most analyses, Simulium and Nevermannia were more closely related to each other than to Gomphostilbia which was usually basal. Species groups were generally monophyletic. Within Gomphostilbia, however, the batoense species group was always paraphyletic to the other two species groups found in Thailand. Three species groups in Simulium were not monophyletic. The tendency to gill filament number reduction for some species groups in the subgenus Simulium was associated with a derived position in multigene analyses. Most species were monophyletic with two exceptions that probably represent species complexes and will present difficulties for rapid mitochondrial DNA identification.

Keywords

Black fly Simulium Multigene analyses Gomphostilbia Nevermannia 

Introduction

Black flies are medically, economically and ecologically important insects belonging to the family Simuliidae, suborder Nematocera, order Diptera. The adults are small, stout-bodied and hump-backed and apparently quite vagile (Crosskey 1990; Craig et al. 2001; Pramual et al. 2005). The eggs, larvae and pupae develop in running fresh water. Black flies can attain extremely high densities in such environments and have very important roles as prey and, through larval filter-feeding, in the removal of organic mater from the water column (Currie and Adler 2008). The most recent inventory of Adler and Crosskey (2009) lists 2,060 living described valid species in the family. These are arranged in 26 extant genera. Simulium is the largest consisting of 1,659 named species arranged in at least 36 subgenera.

Adult females of most simuliid species feed on vertebrate blood. As a consequence, some are among the most important insect pests of humans and animals. The most serious human disease associated with black flies is onchocerciasis, or river blindness, caused by the filarial worm Onchocerca volvulus Leuckart (Ottesen et al. 2008). This disease is found in many tropical regions although not yet reported in Thailand. In Africa, it is mainly transmitted by members of the Simulium damnosum species complex (Crosskey 1990; Basáñez and Boussinesq 1999) and in the Americas mainly by members of the Aspathia and Psilopelmia subgenera of Simulium (Crosskey 1990). Many black fly species, particularly in the genera Simulium, Parasimulium, Austrosimulium and Cnephia transmit other filarial worms, protozoans or arboviruses to livestock, wild mammals or birds (Adler 2005).

The taxonomic classification of black flies is principally based on the external morphology of larvae, pupae or adults. Species can be very difficult to discriminate morphologically (Crosskey 1981) so considerable effort has been devoted to the resolution of simuliid taxonomy by cytotaxonomic studies of the polytene chromosomes of larval salivary glands (Vajime and Dunbar 1975; Rothfels 1979; Bedo 1977, 1979; Boakye 1993; Procunier and Muro 1993; Kuvangkadilok et al. 1998, 1999a, b, 2003, 2008; Phasuk et al. 2005; Jitklang et al. 2008). Only a few broad cladistic phylogenetic studies of the family are available. These include Moulton (2000, 2003) using molecular sequence data and Adler et al. (2004) using morphological characters to investigate the phylogeny of Holarctic genera.

DNA sequence studies of black flies’ taxonomy began with investigations of mitochondrial 16S rRNA (Xiong and Kocher 1991) and transfer RNA genes (Pruess et al. 1992). Subsequently, portions of 16S rRNA and NADH dehydrogenase subunit 4 (ND4) have proven particularly useful in studying systematic and phylogenetic relationships among different sibling species of the S. damnosum complex (Tang et al. 1995a, b, 1996a; Higazi et al. 2001; Krüger et al. 2000). 16S rRNA has also been utilised to study other groups of black flies (Otsuka et al. 2001, 2003; Krüger and Hennings 2006). Investigations of nuclear genes in simuliids have concentrated on the internal transcribed spacers (ITS) of ribosomal DNA (Brockhouse et al. 1993; Tang et al. 1996b; Thanwisai et al. 2006).

Thai simuliids were first reported by Summer (1911) and Edwards (1928, 1934) but it was not until much later that the extent of the family’s diversity in the country was revealed. In 1984, Takaoka and Suzuki reported 19 species including seven new and five unnamed. Takaoka and Saito (1996) described one new species, S. (Byssodon) siripoomense, and listed four newly recorded species. Takaoka and Kuvangkadilok (1999) described four new species. New species continue to be recognised (e g., Takaoka and Choochote 2005a, b, 2006a, b, c, d, e; Jitklang and Kuvangkadilok 2007; Pramual and Tangkawanit 2008). The most recent compilation (Kuvangkadilok, personal observation) lists 77 Simulium species in six subgenera. Among these, Gomphostilbia and Nevermannia each has three recognized species groups and the subgenus Simulium has seven. Asiosimulium, Daviesellum and Montisimulium are not divided into species groups.

The ITS-2 research of Thanwisai et al. (2006) is the only molecular phylogenetic study focussing on black flies in Thailand. These authors found substantial corroboration of the morphological understanding of Simulium. The subgenera Simulium and Gomphostilbia were each monophyletic, with strong support for the latter. Support for monophyly of the subgenus Simulium was strong in Bayesian analysis but not in maximum parsimony. The subgenus Nevermannia was unexpectedly paraphyletic because it included the subgenus Montisimulium. Species groups within all subgenera were monophyletic with three exceptions. The varicorne and batoense species groups (subgenus Gomphostilbia) were, respectively, polyphyletic and paraphyletic, and the relationships of the griseifrons group (subgenus Simulium) were unclear.

Although morphological and cytotaxonomic studies have enabled substantial progress in Simulium systematics, the use of single gene analyses has demonstrated that molecular approaches will also be of great assistance. A great deal more research will be required before a full understanding of Simulium classification and evolution is attained. This will probably include the use of multigene analyses and involve examining the utility of many new genes. The present research was conducted to enhance understanding of phylogenetic relationships among the black flies of Thailand at the subgeneric, species group and species levels. The study had three objectives. The first was to confirm and extend the ITS results of Thanwisai et al. (2006), including determining whether the phylogenetic and taxonomic anomalies they identified remained when larger data sets based on other genes were used. The second objective was to investigate the possibility of using DNA sequence data to facilitate simuliid identification, particularly using the mitochondrial cytochrome c oxidase subunit I gene that has been widely used for this purpose in other taxa (Hebert et al. 2003). The third objective was to collect data that could assist the placement of the Thai fauna in the broader phylogeographic context of the genus Simulium.

Data were collected from COI and two other mitochondrial genes, ND4 and 16S rRNA, which have a demonstrated utility for simuliid taxonomy, as reviewed above. Data were also collected for two segments of the nuclear 28S ribosomal RNA (the D1 to D2 and the D4 expansion regions) as these have been extensively employed in molecular phylogenetics.

Materials and methods

Specimens and DNA methods

Black fly larvae, pupae and adults were collected from various locations in Thailand (Table 1). In all, 59 individuals from 37 species, in 13 species groups of five sub-genera were used. All sequenced specimens were larvae except for two adult females, one S. angulistylum from Muang Tuad waterfall and the S. sheilae specimen from Boripat waterfall. Fourteen species were represented by multiple individuals. Daviesellum was the only subgenus found in Thailand not represented. A broad indication of the regional provenance of the specimens is given in Table 1. The abbreviations for the designated regions are; N: Northern; NE: Northeastern; E: Eastern; C: Central; and S: South.
Table 1

Details of the scored species, including systematic position, sample provenance and GenBank accession numbers

Subgenus

Species group

Species

Regional designationa

Localityb

COI accessionc

16S rRNA accession

ND4 accession

D1/D2 28s rRNA accession

28S rRNA A accession

Asiosimulium

 

oblongum

NE

Pa Hin Ngam NP, Chaiyaphum

FJ477845

    

Gomphostilbia

batoense

angulistylum

NE

Haew Suwat waterfall, Nakhon Ratchasima

AY251483

GQ865984

GQ865862

GQ865905*

GQ865944

angulistylum

E

Pang Sida waterfall, Srakaeo

AY251484

 

GQ865861

GQ865904*

GQ865943

angulistylum

S

Muang Tuad waterfall, Suratthani

AY251485

GQ865985

GQ865863

GQ865906*

GQ865945

angulistylum

S

Muang Tuad waterfall, Suratthani

AY251486

 

GQ865864

  

decuplum

N

Ban Mae Tho, Chiang Rai

AY251487

GQ865986

GQ865865

GQ865907

GQ865946

decuplum

S

Muang Tuad waterfall, Suratthani

AY251488

GQ865987*

GQ865866

GQ865908

GQ865947

duolongum

S

Muang Tuad waterfall, Suratthani

AY251489

GQ865988*

GQ865867

GQ865909

GQ865948

gombakense

N

Huai Sai Luaeng waterfall, Chiang Mai

AY251490

    

parahiyangum

N

Mork Fah waterfall, Chiang Mai

AY251491

GQ865990

GQ865869

GQ865911*

GQ865950

parahiyangum

NE

Huai Luang waterfall, Ubon Ratchathani

AY251492

 

GQ865870

GQ865912

GQ865951

parahiyangum

E

Khao Soi Dao waterfall, Chantaburi

AY251493

GQ865989

GQ865868

GQ865910*

GQ865949

parahiyangum

S

Muang Tuad waterfall, Nakhon Sri Tammarat

AY251494

GQ865991

GQ865871

GQ865913

GQ865952

siamense

NE

Huai Luang waterfall, Ubon Ratchathani

AY251495

GQ865994

GQ865873

GQ865915

GQ865955

siamense

E

Khao Soi Dao waterfall, Chantaburi

FJ477843

GQ865993

  

GQ865954

siamense

C

Wang Takhrai waterfall, Nakhon Nayok

AY251496

GQ865992

GQ865872

GQ865914

GQ865953

tahanense

S

Ngao waterfall, Ranong

AY251497

 

GQ865874

  

ceylonicum

inthanonense

N

Siri Phum waterfall, Doi Inthanon NP, Chiang Mai

AY251498

GQ865995

GQ865875

GQ865916*

GQ865956

inthanonense

N

Siri Phum waterfall, Doi Inthanon NP, Chiang Mai

AY251499

 

GQ865876

  

sheilae

S

Ngao waterfall, Ranong

AY251500

GQ865996

GQ865877

GQ865917*

GQ865957

sheilae

S

Boripat waterfall, Songkhla

AY251501

 

GQ865878

  

varicorne

burtoni

N

Nam Nao waterfall, Phetchaboon

AY251502

GQ865997d

GQ865879

GQ865918*

GQ865958

chumpornense

S

Kapo waterfall, Chumporn

AY251503

GQ865998

GQ865880

GQ865919*

GQ865959

Montisimulium

 

merga

N

Ang Kha, Doi Inthanon NP, Chiang Mai

AY251530

 

GQ865881

GQ865920*

GQ865960

Nevermannia

feuerborni

feuerborni

N

Khun Wang, Doi Inthanon NP, Chiang Mai

AY251505

 

GQ865882

GQ865921*

GQ865961

ruficorne

aureohirtum

S

Ngao waterfall, Ranong

AY251506

 

GQ865883

GQ865922

 

aureohirtum

NE

Ban Sang Keaw, Sakon Nakhon

FJ477847

    

vernum

caudisclerum

N

Ang Kha, Doi Inthanon NP, Chiang Mai

AY251507

GQ865999

GQ865884

GQ865923*

GQ865962

Simulium

griseifrons

choochotei

N

Monthatharn waterfall, Suthep-Pui NP, Chiang Mai

FJ477844

    

grossifilum

S

Ngao waterfall, Ranong

AY251508

GQ866000

GQ865885

GQ865924

GQ865963

rudnicki

N

Mae Ya waterfall, Doi Inthanon NP, Chiang Mai

AY251509

GQ866001

GQ865886

GQ865925*

GQ865964

malyschevi

baimaii

NE

Phukradung NP, Loei

AY251530

GQ866002*

GQ865887

 

GQ865965

baimaii

NE

Phukradung NP, Loei

FJ477848

    

siripoomense

N

Wang Khwai waterfall, Doi Inthanon NP, Chiang Mai

AY251510

GQ866003

GQ865888

GQ865926*

GQ865966

multistriatum

chainarongi

NE

Keng Lam Duan waterfall, Ubon Ratchathani

AY251511

GQ866004

GQ865889

GQ865927*

GQ865967

chaliowae

NE

Na Ku Ha waterfall, Phrae

FJ477851

    

fenestratum

N

Khun Gorn waterfall, Chiang Rai

AY251512

GQ866005

GQ865890

GQ865928*

GQ865968

fenestratum

NE

Phukradung NP, Loei

FJ477841

GQ866006

 

GQ865929*

GQ865969

fenestratum

S

Dad Pha waterfall, Suratthani

AY251513

GQ866007

 

GQ865930

GQ865970

takense

C

Kreng Ka Via waterfall, Kanchanaburi

FJ477846

    

triglobus

N

Ton Tong waterfall, Nan

AY251514

 

GQ865891

 

GQ865971

nobile

nobile

S

Kapo waterfall, Chumporn

AY251515

GQ866008

GQ865892

GQ865931*

GQ865972

nobile

S

Bang Pae waterfall, Phuket

FJ477852

    

nodosum

N

Ban Thung Yao, Chiang Rai

AY251516

 

GQ865893

GQ865932*

GQ865973

striatum

chiangmaiense

N

Ban Thung Yao, Chiang Rai

 

GQ866009

GQ865894

GQ865933

GQ865974

nakhonense

N

Wang Khwai waterfall, Doi Inthanon NP, Chiang Mai

AY251518

GQ866010

GQ865895

 

GQ865975

nakhonense

C

Wangtakrai waterfall, Nakhon Nayok

FJ477842

GQ866011

  

GQ865976

nakhonense

S

Phrom Lok waterfall, Nakhon Sri Thammarat

AY251519

GQ866012

GQ865896

GQ865934

GQ865977

quinquestriatum

N

Mae Ya waterfall, Doi Inthanon NP, Chiang Mai

AY251520

GQ866013*

GQ865897

GQ865935*

GQ865978

quinquestriatum

S

Mae Set Thi waterfall, Nakhon Sri Thammarat

AY251521

GQ866014

 

GQ865936

GQ865979

tuberosum

yuphae

N

Sai Tip waterfall, Uttaradit

AY251522

GQ866015*

GQ865898

GQ865937*

GQ865980

rufibasis

N

Siri Phum waterfall, Doi Inthanon NP, Chiang Mai

AY251523

GQ866016*

GQ865899

GQ865938

GQ865981

tani

N

Ban Mae Tho, Chiang Rai

AY251525

GQ866017

GQ865900

GQ865939*

 

tani

E

Khoa Soi Dao waterfall, Chanthaburi

AY251526

GQ866018*

GQ865901

GQ865940*

 

tani

S

Muang Tuad waterfall, Suratthani

AY251527

GQ866019

GQ865902

GQ865941

GQ865982

weji

N

Thrn Tong waterfall, Lampang

AY251528

    

variegatum

chamlongi

N

Siri Phum waterfall, Doi Inthanon NP, Chiang Mai

AY251529

GQ866020

GQ865903

GQ865942*

GQ865983

chamlongi

N

Siri Phume waterfall, Doi Inthanon NP, Chiang Mai

FJ477849

    

Chironomus

 

tentans

  

AF110160

  

X99212

X99212

Drosophila

 

pseudoobscura

  

AF519412 & AF451073

M93993

 

AF184016

 

Culex

 

pipiens

  

GQ360492

EF033661

AY793695

X93393

X93393

aN North; NE Northeast; E East; C Central; or S South

bLocality is specified by place and province of the collection site

cCOI (most sequences), 16S rRNA and 28S segment 1 were each amplified in two separate PCR reactions. An asterisk next to an accession number indicates that the specimen was scored for only the 3′ part of the relevant gene

d16S rRNA could only be scored for the more 5′ region of the gene for the S. burtoni specimen

Larvae and pupae were found in streams of running water, normally attached to fallen leaves, trailing water grasses or stones. They were picked from the substrate with fine forceps and dried on absorbent tissue. Then they were preserved in absolute ethanol or Carnoy’s Fixative. The fixative was changed about 5 min after collection, and again after 24 h. Some living pupae were reared for identification by placing them in a vial tightly plugged with damp cotton wool and closed with netted fabric. Specimens were identified using external morphology following the keys and descriptions found in Takaoka and Suzuki (1984), Takaoka and Saito (1996), Takaoka and Adler (1997), Takaoka and Kuvangkadilok (1999) and Takaoka and Choochote (2004) and the descriptions of new species in Takaoka and Choochote (2005a, b, 2006a, b, c, d, e), Jitklang and Kuvangkadilok (2007) and Pramual and Tangkawanit (2008).

Genomic DNA was extracted from individual flies according to the protocol of Collins et al. (1987). The final pellet resulting from ethanol precipitation was washed once with absolute ethanol and once with 70% ethanol. The DNA was resuspended in 100 µl of TE (pH 8.0) with 1 unit of RNAse and kept at −80°C.

Primer pairs for amplifying various gene regions are listed in Table 2. Multiple attempts were made to amplify all studied gene segments from each individual except nine specimens amplified for COI only, using the universal primers of Folmer et al. (1994). Other COI samples, 16S rRNA and 28S rRNA were each amplified in two segments.
Table 2

Primers used to amplify cytochrome oxidase I (COI), NADH dehydrogenase subunit 4 (ND4), 16S rDNA and 28S rDNA

Gene

Primer

Position

Sequence (5′ → 3′)a

References

Mitochondrialb

 COI

CO1

1,763

TATAGCATTCCCACGAATAAATAA

Lunt et al. (1996)

CO2

2,329

ACTGTAAATATATGATGAGCTCA

Simon et al. (1994)

CO3

2,159

TTGATTTTTTGGTCATCCAGAAGT

Simon et al. (1994)

CO4

3,014

TCCAATGCACTAATCTGCCATATTA

Lunt et al. (1996)

1490F

1,514

GGTCAACAAATCATAAAGATATTGG

Folmer et al. (1994)

2198R

2,173

TAAACTTCAGGGTGACCAAAAAATCA

Folmer et al. (1994)

 ND4

ND1

8,931

AARGCTCATGTTGAAGC

Soto et al. (2001)

ND2

8,281

ATTTAAAGGYAATCAATGTAA

Soto et al. (2001)

 16S rDNA

16S1

12,883

CTCCGGTTTGAACTCAGATC

Xiong and Kocher (1991)

16S2

13,398

CGCCTGTTTATCAAAAACAT

Xiong and Kocher (1991)

16S3

13,323

ACTAATGATTATGCTACCTT

Han and McPheron (1997)

16S4

13,770

AGAAATGAAATGTTATTCGT

Han and McPheron (1997)

Nuclearc

 28SD1

D1F

47

ACCCSCTGAAYTTAAGCAT

McArthur and Koop (1999)

D1R

373

AACTCTCTCMTTCARAGTTC

Emma Beacham, Personal communication

 28SD2

CP12

308

GTGGATCCAGTCGTGTTGCTTGATAGTGCAG

Porter and Collins (1996)

CP15

789

GTGAATTCTTGGTCCGTGTTTCAAGACGGG

Porter and Collins (1996)

 28SA

28SAF

1,015

GACCCGAAAGATGGTGAACTAT

Colgan et al. (2000)

28SAR

1,400

AGCGCCAGTTCTGCTTACCAAAA

Colgan et al. (2000)

aStandard IUB codes are used for base position redundancies (R = A or G; Y = C or T, S = G or C, M = A or C)

bFor the mitochondrial genes, the position corresponds to the 3′ end of the oligonucleotide in the complete sequence of Drosophila yakuba. GenBank Accession NC001322 (Clary and Wolstenholme 1985)

cFor the nuclear genes, the position corresponds to the 3′ end of the oligonucleotide in the 28S rDNA sequence of Aedes albopictus, GenBank Accession L22060 (Kjer et al. 1994)

PCR was performed using 2 μl of template DNA in 50 μl reaction mixes made to a final concentration of lx the manufacturer’s buffer. The buffer also contained 0.2 mM dNTPs and between 1.5 and 2 mM MgCl2, 0.4 and 1 µM primers and 2.5 and 5 U Taq polymerase. Reaction mixes were adjusted as required to obtain single-banded products.

An initial denaturation step of 95°C for 5 min was used in the cycling program. This was followed by 35 cycles of denaturation at 94°C for 30 s (60 s for CP12 + CP15), annealing for 45–60 s (120 for CP12 + CP15) and extension at 72°C for 60 s (120 for CP12 + CP15) followed by a final extension at 72°C for 5 min. The annealing temperature was generally 45°C for mitochondrial sequences and 50°C for nuclear sequences, varied as necessary to obtain single-banded products.

PCR products were run on 2% agarose gels containing ethidium bromide and visualised on a UV-transilluminator. Single-banded PCR products were purified from the gels using the GENECLEAN II Kit (Bio 101, Vista, CA, USA), following the manufacturer’s instructions, and sequenced directly in both directions using the amplification primers individually. Sequencing reactions were prepared using the ABI Prism BigDye™ Terminator v3.0 Cycle Sequencing Kit (Applied Biosystems, Foster City CA, USA) according to the manufacturer’s protocol except that reactions were scaled down to 10 μl using 2 μl of BigDye. Products were sequenced on an ABI 310 Genetic Analyser (Applied Biosystems).

Sequence alignment and phylogenetic analyses

DNA sequences were edited and compiled using Sequencher v4.1 (Gene Codes Corporation, Ann Arbor, MI). Sequences for individual segments were aligned using the default parameters in CLUSTAL X (Thompson et al. 1997). To test for pseudogenes, coding sequences (COI, ND4) were translated into protein using the standard invertebrate mitochondrial genetic code with MacClade v3.02 (Maddison and Maddison 1992). No stop codons were observed. For the multigene analysis, outgroup sequences from Culex pipiens, Chironomus tentans and Drosophila pseudoobscura were obtained from GenBank (Accession numbers in Table 1).

A selection of 16S rRNA sequences representing the range of Simulium subgenera and species groups in GenBank was added to the sequences determined here to form a data set for examining the relationships of Thai species with extralimital Simulium. Most 16S rRNA Simulium sequences in GenBank were relatively short, so this alignment included only a part of the sequences collected here. Details of this dataset including outgroup genera based on Moulton’s (2000) analysis, are listed in the Electronic Supplementary Material.

McClade v3.02 (Maddison and Maddison 1992) and BioEdit (Hall 1999) were used for DNA sequence manipulation. Forcon v.1.0 1.0 (Raes and Van de Peer 1999) was used for file format interconversion.

Nucleotide composition homogeneity within genes was tested with PAUP* 4.0b10 (Swofford 2002). Kimura 2-parameter genetic distances were estimated with MEGA 4 (Tamura et al. 2007), using pairwise deletion of missing data, gamma distributed rates of variation between base positions, setting the α parameter to the default value of 1.0, and uniform substitution patterns over lineages. Five hundred bootstrap replicates were conducted to estimate the standard error of the distances.

Maximum parsimony analyses were conducted using PAUP* 4.0b10 (Swofford 2002) with parameter values set to the default, except for those specified below. Heuristic searches were conducted with 1,000 replicates, with random taxon addition and keeping no more than 200 trees longer than a given number of steps (generally nchuck = 200, chucklen = 200, but chucklen = 20 for the 28S rRNA segments because of their low divergences). Bootstrap searches were conducted with 500 pseudo-sampling replicates, for each of which 20 replicates with random taxon addition were examined. Again, no more than 200 trees longer than a given number of steps were kept (nchuck = 200, generally chucklen = 200, but chucklen = 20 for the 28S rRNA segments).

Maximum parsimony analyses were conducted for various datasets and are reported for: (1), the combined data including the specimens scored only for COI (abbreviated as AMP); (2) cytochrome c oxidase data (COIMP); and (3) the 16S rRNA data including sequences from GenBank (16SMP). Some possible areas of ambiguous alignment were identified in 28S rRNA and 16S rRNA (with a total length of less than thirty bases in the combined data). These were not excluded from reported analyses, as we did not wish to make arbitrary judgements about homologies.

Bayesian inference of phylogenetic relationships using Metropolis-Coupled Monte Carlo Markov chain simulation was performed with MrBayes version 3.1.2 (Huelsenbeck and Ronquist 2001). The general time-reversible model of substitution was selected (Nst = 6). The gamma distribution was used to accommodate between-site variation in substitution rates. The combined data set was partitioned into individual genes, and individual coding positions within genes using the “unlink” command so that parameters could be estimated separately. Markov chains were run for one million “generations” for the combined data set and ten million for the 16S rRNA dataset, with trees sampled every 100 “generations”. Tracer version 1.4 (Rambaut and Drummond 2004) was used to graph the log likelihoods of sampled trees and the point at which the simulation achieved stationarity in each run was judged by visual inspection. Trees sampled before this point were discarded as “burn-in”. The remaining trees from each of the two simultaneous runs of MrBayes 3.1.2 were included in the calculations of posterior probabilities. Bayesian analyses are reported for the combined data including the specimens scored only for COI (abbreviated as ABY) and for the 16S rRNA data including sequences from GenBank (16SBY).

Results

The alignment for the combined data contained 3,778 bases. Of these, 2,227 were invariable, 534 variable but parsimony uninformative and 1,017 parsimony informative. Details of character status for individual genes are given in Table 3, together with probability values for χ2 tests of the homogeneity of base frequencies and tree statistics for maximum parsimony analyses for individual genes. No test suggested heterogeneity of base composition for any gene segment. Average Kimura 2-parameter genetic distances within and between Simulium subgenera are shown for individual gene segments in Table 4.
Table 3

Statistics for the individual gene segments

Dataseta

Invariant

Variable uninformative

Informative

Homogeneity

Trees

CI

Length

CO1

703

76

427

0.9999

1

0.278

2,979

ND4

303

36

173

1.0000

6

0.332

999

16S rRNA

608

128

101

0.1325

2,948

0.655

605

D1/D2 28S rRNA

342

247

172

1.0000

32,189

0.831

650

28S rRNA A

280

45

57

1.0000

191,400

0.901

131

aThe columns show the numbers of bases that do not vary in the dataset, the number that are variable but not parsimony informative bases (‘Variable uninformative) and the number of parsimony informative bases. The “Homogeneity” column gives the value for the χ2 test of the homogeneity of base composition between taxa. The final three columns present details of the number of trees resulting from maximum parsimony searches for individual segments, their consistency index (CI) and length

Table 4

Net average Kimura 2-parameter pairwise genetic distances within and between Simulium subgenera

Gene segment

Simulium

Gomphostilbia

Nevermanniaa

Simulium and Gomphostilbiab

Simulium and Nevermannia

Nevermannia and Gomphostilbia

CO1

0.134 ± 0.008

0.137 ± 0.007

0.163 ± 0.011

0.035 ± 0.004

0.032 ± 0.004

0.034 ± 0.005

ND4

0.143 ± 0.013

0.126 ± 0.012

0.158 ± 0.017

0.032 ± 0.006

0.008 ± 0.004

0.019 ± 0.005

16S rRNA

0.040 ± 0.004

0.057 ± 0.005

Not computedc

0.033 ± 0.005

Not computedc

Not computedc

(0.081 ± 0.008)

(0.049 ± 0.008)

(0.052 ± 0.008)

D1/D2 28S rRNA

0.038 ± 0.005

0.012 ± 0.003

0.024 ± 0.005

0.028 ± 0.006

0.012 ± 0.006

0.031 ± 0.007

28S rRNA A

0.010 ± 0.003

0.004 ± 0.002

0.004 ± 0.002

0.014 ± 0.005

0.011 ± 0.004

0.009 ± 0.005

aM. merga was included in the subgenus Nevermannia

bThe figures for between-subgeneric comparisons are net values accommodating the intra-generic distances

cValues could not be computed for the 16S rRNA segment for Nevermannia as only one taxon in this genus was scored for this segment. The figures in brackets for 16S rRNA comparisons involving this genus are for overall pairwise distances between the genera

The AMP analysis resulted in two maximum parsimony trees, each of length 5,551 with a consistency index (CI) of 0.396. One of these trees is shown in Fig. 1. The only resolved branch in this tree not observed in the strict consensus of both AMP trees is identified. In the ABY analysis run 1, the first 300,000 “generations” were discarded after inspection of the Tracer profile. The mean log likelihood of the remaining trees was −2.8E4. This was also the mean for run 2, but for this the first 400,000 “generations” were discarded.
Fig. 1

Phylogram of a maximum parsimony topology for the combined dataset. This is one of two trees found in the AMP analysis. One branch, indicated by double asterisks, was collapsed in the strict consensus of these. Figures near branches represent bootstrap support values. The scale bar represents 30 changes. Subgenera and species groups, or parts thereof, are indicated by bars to theright of the figures. Double hatches signify that the group defined by the bar is not monophyletic. Where species have representatives from multiple regions, these are identified by Genbank accession number and/or a general regional abbreviation (N, NE, C, S, E)

The genus Simulium was monophyletic with strong support in AMP (bootstrap 98%) and ABY (posterior probability 1.00). The subgenus Gomphostilbia was monophyletic with moderate bootstrap support in AMP but paraphyletic with respect to all other species in ABY. The subgenus Simulium was monophyletic, without bootstrap support in AMP. Nevermannia was paraphyletic because it included Montisimulium merga, although this did not receive strong bootstrap support. Nevermannia + Montisimulium was the sister group of the subgenus Simulium (without bootstrap support) rather than Gomphostilbia although the shortest parsimony trees under the constraint that Nevermannia was the sister group of Gomphostilbia were not significantly longer than unconstrained trees (P = 0.27 using the Kishino–Hasegawa test). S. (Simulium) was not monophyletic in ABY, as S. chiangmaiense was the sister group to a clade with a posterior probability of 0.81 that included all other members of the subgenus, Asiosimulium and Nevermannia (this including Montisimulium merga with a posterior probability of 0.90).

Most species groups were monophyletic in the AMP trees. Within the subgenus Simulium, the exceptions were that (1) S. chiangmaiense (from the striatum species group) was included in the main multistriatum species group clade; (2) S. takense from the multistriatum species group was basal within the subgenus; and (3) the griseifrons species group was paraphyletic because S. choochotei was shown as the sister taxon to a large clade including all studied members of the malyschevi, nobile, tuberosum and variegatum species groups. Exceptions (2) and (3) involve species (S. takense and S. choochotei) scored only for COI. Most members of the striatum species group formed a basal clade within the subgenus in ABY, although the position of S. chiangmaiense mentioned above makes the group paraphyletic. The striatum group clade was the sister group of a polytomy comprising four lineages: (1) the multistriatum species group (monophyletic), (2) S. choochotei; (3) the other griseifrons group species; and (4) the malyschevi, nobile, tuberosum and variegatum species groups.

The batoense species group was paraphyletic within Gomphostilbia in both AMP and ABY because it included both other species groups found in Thailand (ceylonicum and varicorne). The latter two groups were monophyletic in both analyses but in contrast to AMP (Fig. 1), in ABY, the varicorne species group was the sister group of S. parahiyangum but with low posterior probability (0.52). The ceylonicum species group was the sister group to the varicorne species group plus S. parahiyangum (posterior probability of 0.83).

All species were monophyletic except two in AMP and three in ABY. S. nakhonense was paraphyletic with respect to S. quinquestriatum although the relevant branch (to S. nakhonense C) was very short and without bootstrap support. In ABY, S. nakhonense and S. quinquestriatum were intermingled making both species paraphyletic. Two of the four S. fenestratum specimens were shown as sister groups to other species (S. chainarongi and S. chaliowae) with some bootstrap (75 and 74%, respectively) and posterior probability support (0.71 and 1.00, respectively).

The single tree (length 2,940, CI 0.273) from the COIMP analysis showed Gomphostilbia as paraphyletic with respect to all other species in the genus Simulium (Fig. 2). Nevermannia included Montisimulium merga, placed here as the sister group of S. caudisclerum rather than S. feuerborni as in AMP and ABY. S. angulistylum was the only member of the sister group of Nevermannia + Montisimulium.
Fig. 2

The maximum parsimony tree for the cytochrome c oxidase subunit I data. The scale bar represents ten changes. Figures near branches represent bootstrap support values. Subgenera and species groups, or parts thereof, are indicated by bars to the right of the figures. Double hatches signify that the group defined by the bar is not monophyletic. Where species have representatives from multiple regions, these are identified by a general regional abbreviation (N, NE, C, S, E)

The relationships contradicting species monophyly in AMP were also observed in COIMP where S. fenestratum NE was the sister group to S. chainarongi with 91% bootstrap support and S. fenestratum S was the sister to S. chaliowae with 72% support. The short branch to S. nakhonense C making this species paraphyletic had limited bootstrap support (57%).

Six species were represented by individuals from three or more regions of Thailand. The phylogenetic relations between these supported by bootstrap values more than 70 for the AMP or COIMP analyses or posterior probabilities greater than 0.90 in the ABY analysis are detailed below. In this list, associated pairs are included in parentheses and specimens from other regions written outside. The significant relationships were: S. angulistylum: none; S. fenestratum (after pruning S. chaliowae and S. chainarongi from the clade): NE vs. (N, S)—86% in COIMP, 87% in AMP, 1.00 in ABY; S. nakhonense: none; S. parahiyangum: (E, S)—79% in COIMP, 99% in AMP, 1.00 in ABY and (N, NE)—77% in COIMP and 95% in AMP, 0.81 in ABY; S. siamense: (NE, E) versus C—82% in COIMP, 100% in AMP, 1.00 in ABY; and S. tani: (E, S) versus N—99% in COIMP, 100% in AMP, 1.00 in ABY.

The alignment for the 16S rRNA data including GenBank sequences contained 525 bases. Of these, 337 were invariable, 70 variable but parsimony uninformative and 118 parsimony informative. The chi-square test of homogeneity of the 113 sequences included gave a probability of 1.000. The 16SMP analysis resulted in 67,400 trees, each of length 698 and CI of 0.381. In the 16SBY analysis, the first 100,000 generations of both runs 1 and 2 were discarded.

No statistically significant support was found in either 16SMP or 16SBY, for the sister group pairing of one of the three major Thai subgenera (Gomphostilbia, Nevermannnia and Simulium) with each other or any extralimital subgenus. Gomphostilbia was monophyletic in both analyses, with posterior probability support of 0.88 in 16SBY. Simulium was monophyletic in 16SMP but not 16SBY where the nobile species group was placed in the polytomy found at the base of the genus Simulium and a species from another genus (Cnephia dacotensis) was anomalously included in the remainder of the subgenus with a posterior probability of 0.60. The three species groups of Nevermannnia were found in three distinct lineages in both analyses.

Most species groups in Gomphostilbia, Simulium and Nevermannia were monophyletic although only the three in Nevermannia and the nobile species group (subgenus Simulium) received strong or even moderate (>70%) bootstrap support. In both 16SMP and 16SBY analyses, the batoense species group (Gomphostilbia) was paraphyletic to the ceylonicum and varicorne species groups and in the subgenus Simulium, the venustum and griseifrons species groups were each dispersed in the topology and S. iridescens was separated from the other members of the melanopus species group. Additonally in 16SBY, S. yuphae was not resolved in the tuberosum species group.

The Thai specimens of S. nobile, S. quinquestratum, S. tani, S. rufibasis, S. siamense and S. yuphae sequenced here were found in monophyletic clades with previously sequenced conspecific specimens. However, the Thai S. grossifilum sample and the GenBank sequence of the species did not form such a clade. Another anomaly was that the two S. decuplum specimens sequenced here were not monophyletic, although placed in the correct species group. These anomalies require further investigation as they may be caused by the presence of multiple cryptic species in the one nominate form or by misidentification.

Discussion

The monophyly and inter-relationships of the subgenera of Simulium

The inclusion of multiple genes in combined analyses generally supported the monophyly of morphologically recognised sub-genera with the few counterexamples mostly indicating the need for further data. For example, monophyly of the subgenus Simulium is contradicted in our analyses only by exclusion of S. chiangmaiense (lacking COI data) in ABY and the inclusion of Asiosimulium oblongum in COIMP. More data are certainly necessary to test the placement of Asiosimulium, erected as a distinct subgenus by Takaoka and Choochote (2005b), as only COI sequences are presently available.

Gomphostilbia was monophyletic here, in AMP, with moderate bootstrap support, and 16S analyses and was strongly supported in ITS analyses (Thanwisai et al. 2006). Paraphyly was weakly supported in ABY or COIMP. An alternative rooting of the topology could make the subgenus monophyletic in both of these analyses suggesting that further data collection should emphasise more closely related outgroups such as other genera within Simuliidae.

Nevermannia includes the Montisimulium species S. merga but is otherwise monophyletic in combined analyses. The three species groups of Nevermannia are monophyletic in 16S rRNA analyses but the subgenus is not (Otsuka et al. 2003; and here). The inclusion of S. merga in Nevermannia is tentative as it is the only representative of Montisimulium included here. Morphology does not strongly associate S. merga with any of Simulium, Nevermannia and Gomphostilbia. The adult S. merga has a bare katepisternum (on the adults’ thorax), as do both Simulium and Nevermannia, in contrast to the autapomorphic, hairy condition in Gomphostilbia (Takaoka and Davies 1995). Conversely, the last segment of the pupa of S. merga has grapnel-like hooklets (Takaoka and Choochote 2005a) as do Gomphostilbia pupae but not those of Simulium or Nevermannia (Takaoka and Davies 1995).

Moulton (2003) included representatives of up to four sub-genera in his molecular analyses and found some support for the suggestion that ornithophilous, univoltine sub-genera such as Nevermannia and Hellichiella are more basal than the multivoltine mammalophilous sub-genera such as Simulium and Edwardsellum. Gomphostilbia, also suggested by morphology to be ornithophilic, was basal in AMP and ABY analyses. The present results suggest the sister pairing of Nevermannia and Simulium rather than Nevermannia and Gomphostilbia. There was notable, albeit not significant, posterior probability support (0.81) in ABY for a clade of Nevermannia (including Montisimulium), Simulium and Asiosimulium. 16S rDNA analyses (Otsuka et al. 2003) also show a sister group pairing of Nevermannia and Simulium but ITS analyses support Nevermannia plus Gomphostilbia (Thanwisai et al. 2006) There is some support for a sister group pairing of Nevermannia and Gomphostilbia from morphology. These subgenera have a basal tooth on the female claws that is absent from Simulium. The tooth is, however, thought to be an adaptive character for grasping bird feathers and might have evolved several times (Adler et al. 2004).

Relationships within subgenera

Within the subgenus Simulium, most or all members of the griseifrons, nobile, malyschevi and variegatum species groups are associated in AMP and ABY and in the Bayesian analysis of Thanwisai et al. (2006). These species groups generally have six gill filaments in contrast to the ten usually found in the striatum-species group (excepting S. chiangmaiense with eight) and the eight usually found in members of the multistriatum species group. The inclusion of S. chiangmaiense with the multistriatum group clade in AMP suggests that this character may be phylogenetically valuable. There is a tendency to further numerical reduction and for inflation of the gill filaments in the groups where most species have six. For example S. baimaii has two structures that appear to be inflated gill filaments and S. nodosum has three inflated elements (Takaoka and Suzuki 1984; Takaoka and Kuvangkadilok 1999).

Reductions in gill filaments number are associated with a derived position both here and in the Bayesian analysis of Thanwisai et al. (2006). This trend was not seen in the MP and NJ analyses of Thanwisai et al. (2006) nor in our 16S MP analysis, in which species groups with reduced numbers of gill filaments are dispersed through the subgenus. Takaoka (1996) suggests that gill number reduction and/or inflation may indicate derived positions within species groups, an example being the nobile species group where the two continental species (S. nodosum and S. nobile) are derived. Takaoka (1996) also suggests that reduction in gill filament number and a tendency for gills to become inflated is involved in adaptation for the use of specialized habitats. We do not have evidence to test this proposal but the derived position of species with reduced numbers of filaments in the subgenus Simulium in AMP (Fig. 1) is at least consistent with it.

The griseifrons species group has been contradicted by every molecular analysis. In Otsuka et al. (2003) its species were found in three distinct lineages. Thanwisai et al. (2006) suggest that S. choochotei may be quite distinct, listing eight morphological characters of the larvae, pupae or adults that distinguish this species from other members of the group. S. nigrogilvum was transferred to the griseifrons species group on the basis of 16S rRNA data (Otsuka et al. 2003). Here the species was the sister group of S. japonicum (also from the griseifrons species group), the pair being then most closely associated with the melanopus and tuberosum species groups of the subgenus Simulium.

The varicorne and ceylonicum species groups are monophyletic in all analyses but occupy a derived position within the subgenus Gomphostilbia that makes the batoense species group paraphyletic as it was in most ITS analyses (Thanwisai et al. 2006). The position of the ceylonicum species group within Gomphostilbia is particularly variable in ITS analyses and the varicorne species group is always polyphyletic (Thanwisai et al. 2006). The molecular data argue strongly that a full revision of species groups in Gomphostilbia is necessary.

No general pattern in the sister-groups of regional representatives of species scored from multiple regions within Thailand was apparent here. Only one pair of regions was associated in more than species—the eastern and southern regions for S. parahiyangum and S. tani. However, the evidence for this pattern of regionalisation in S. tani is somewhat contradictory. The eastern and southern regions formed a sister group pair to the exclusion of the northern region sample in both AMP and COIMP. Chromosomally, they are cytoform B whereas northern S. tani has cytoforms C, G or H (Pramual et al. 2005; Tangkawanit et al. 2009). However, population level analyses (Pramual et al. 2005) suggest that eastern and southern region S. tani are each more closely related to northern region S. tani than to each other. No COI haplotype is, for example, found in both the southern and the eastern region (Pramual et al. 2005).

Markers for the rapid identification of Simulium

The section of COI sequenced for most species in this study is not identical to that used for the Bar Code of Life project to use this gene as a molecular marker. There is an overlap of about 550 bases between the two segments. Neither the overlap region (results not shown) nor the extended sequence of 1,206 bases scored for many of the species included in the present study permits discrimination of all Thai Simulium species. The results are, however, encouraging that further study would make this a feasible approach to the identification of most species. This would require substantial studies to clarify the relationships between S. nakhonense and S. quinquestriatum and between S. fenestratum, S. chaliowae and S. chainarongi.

Morphologically, S. quinquestriatum and S. nakhonense larvae are similar. Chromosome analysis has shown that they are closely related, indeed homosequential species (Kuvangkadilok et al., unpublished data). Population genetic analysis based on COI sequences has provided evidence of mitochondrial DNA introgression between them but 28S rRNA D3 sequences confirm that they are distinct species, albeit closely related (Pramual et al., unpublished data).

At least one life-stage of each of S. chaliowae and S. chainarongi is morphologically distinctive within the multistriatum species group (Takaoka and Kuvangkadilok 1999). Consequently, the failure to recover a monophyletic S. fenestratum in any of the COIMP, AMP or ABY analyses suggests that this taxon may represent a species complex or that speciation has been too recent for reciprocal monophyly of mitochondrial DNA haplotypes to have evolved. S. fenestratum samples from the northeast and the north show some morphological differentiation, suggesting that they belong to distinct species (Kuvangkadilok, personal observation).

The phylogenetic context of Thai Simulium

Some Simulium species have apparently wide distributions in Southeast Asia and some are less wide-ranging. For example ten of the twelve species found by Pham (1998, 1999) in northern Vietnam have also been recorded from Thailand. In contrast, three species from Myanmar described by Takaoka (1989) have not yet been found in Thailand. The 16S rRNA results include a number of examples where supposedly conspecific individuals from different countries are indeed closely related. Our results also include possible examples of unrecognised cryptic species in the same nominal taxon (e.g. S. fenestratum and S. quinquestriatum in COI). These contrasting patterns suggest that placing the Thai fauna in the overall context of Simulium phylogenetics will be a longer, rather than a shorter, term endeavour.

Takaoka (1996) shows that patterns in the geographical distribution of Simulium become more definite at the species group and species levels than at the subgeneric level. But his general summary of subgeneric distributions is also noteworthy. Subgenera Simulium and Nevermannia have generally Holarctic/Palaearctic distributions penetrating to the Australasian region whilst S. Gomphostilbia is centred on the continental islands of Sundaland (Takaoka 1996). The basal position of Gomphostilbia in the present analyses (AMP and ABY) suggests that Sundaland was significant in the early evolution of the genus Simulium, either as a centre of origin or the recipient of ancestral migrant lineages.

Similarly, southern and eastern Asia may have been the centre of origin or the recipient of ancestral migrant lineages in the subgenus Simulium. The basal species groups of the subgenus in the multigene analyses (the griseifrons, multistriatum and striatum species groups) are concentrated in the Oriental region and nearby continental islands (Takaoka 1996). Among the derived species groups within the subgenus, the tuberosum and malyschevi species groups are widely distributed in the Holarctic and the variegatum species group occurs predominantly in the Palaearctic (Takaoka 1996).

Craig et al. (2001) suggest that the colonisation of the Pacific Islands by the genus Inseliellum may be as old as 20MA and almost certainly occurred at least several millions of years ago. DNA sequence data support the suggestion that the evolutionary divergences of the Simulium subgenera are of the order of millions of years. Using the average pairwise Kimura 2-parameter distance between subgenera (Table 4) and broad estimates of the rate of change in invertebrate mitochondrial DNA of between 0.2 and 1% per million years, the 16S rRNA results suggest that the Simulium and Gomphostilbia subgenera have been separated by 8 to 40 MA. The variability in such dating estimates is high. Yet, the genus Simulium is very likely so ancient that its evolution can be understood only in the context of the complex geological history of Southeast Asia, Sundaland and the archipelagos of the Western Pacific (Hall 1998, 2002; Craig et al. 2001).

Notes

Acknowledgments

We thank Professor Hiroyuki Takaoka of the Department of Infectious Disease Control, Faculty of Medicine, Oita Medical University, Oita, Japan for advice about larval identification and with the clarification of taxonomic issues. We thank Sue Livingston and Denis O’Meally of the Australian Museum for electrophoresis of the sequencing reactions on an automatic capillary sequencer. This research was supported by the Thailand Research Fund (RDG 4530034), the TRF/BIOTEC Special Program for Biodiversity Research and Training grant BRT R_250003 and the Australian Museum.

References

  1. Adler PH (2005) Black flies, the Simuliidae. In: Marquardt WC (ed) Biology of disease vectors, 2nd edn. Elsevier, San Diego, pp 127–140Google Scholar
  2. Adler PH, Crosskey RW (2009) World blackflies (Diptera: Simuliidae): a fully revised edition of the taxonomic and geographical inventory. Available at: http://entweb.clemson.edu/biomia/pdfs/blackflyinventory.pdf
  3. Adler PH, Currie DC, Wood DM (2004) The black flies (Simuliidae) of North America. Cornell University Press, IthacaGoogle Scholar
  4. Basáñez M-G, Boussinesq M (1999) Population biology of human onchocerciasis. Philos Trans R Soc Lond B 354:809–826CrossRefGoogle Scholar
  5. Bedo DG (1977) Cytogenetics and evolution of Simulium ornatipes Skuse (Diptera: Simuliidae). I. Sibling speciation. Chromosoma 64:37–65CrossRefGoogle Scholar
  6. Bedo DG (1979) Cytogenetics and evolution of Simulium ornatipes Skuse (Diptera: Simuliidae). II. Temporal variation in chromosomal polymorphism and homosequential sibling species. Evolution 33:296–308CrossRefGoogle Scholar
  7. Boakye DA (1993) A pictorial guide to the chromosomal identification of members of the Simulium damnosum Theobald complex in West Africa with particular reference to the Onchocerciasis Control Programme Area. Trop Med Parasitol 44:233–244Google Scholar
  8. Brockhouse CL, Vajime CG, Marin R, Tanguay RM (1993) Molecular identification of onchocerciasis vector sibling species in black flies (Diptera: Simuliidae). Biochem Biophys Res Commun 194:628–634CrossRefPubMedGoogle Scholar
  9. Clary DO, Wolstenholme DR (1985) The mitochondrial DNA molecule of Drosophila yakuba: nucleotide sequence, gene organization, and genetic code. J Mol Evol 22:252–271CrossRefPubMedGoogle Scholar
  10. Colgan DJ, Ponder WF, Eggler PE (2000) Gastropod evolutionary rates and phylogenetic relationships assessed using partial 28S rDNA and histone H3 sequences. Zool Scr 29:29–63CrossRefGoogle Scholar
  11. Collins FH, Mendez MA, Rasmussen MO, Mehaffey PC, Besanky NJ, Finnerty V (1987) A ribosomal RNA gene probe differentiates member species of the Anopheles gambiae complex. Am J Trop Med Hyg 37:37–41PubMedGoogle Scholar
  12. Craig DA, Currie DC, Joy DA (2001) Geographical history of the central-western pacific black fly subgenus Inseliellum (Diptera: Simuliidae: Simulium) based on a reconstructed phylogeny of the species, hot-spot archipelagoes and hydrological considerations. J Biogeogr l28:1101–1127CrossRefGoogle Scholar
  13. Crosskey RW (1981) Simuliid taxonomy. In: Laird M (ed) Blackflies: the future for biological methods in integrated control. Academic Press, London, pp 3–18Google Scholar
  14. Crosskey RW (1990) The natural history of black flies. Wiley, LondonGoogle Scholar
  15. Currie DC, Adler PH (2008) Global diversity of black flies (Diptera: Simuliidae). Hydrobiologia 595:469–475CrossRefGoogle Scholar
  16. Edwards FW (1928) Diptera Nematocera from the Federated Malay States Museums. J Fed Malay Mus 14:1–139Google Scholar
  17. Edwards FW (1934) Deutsche Limnologische Sunda-Expedition: the Simuliidae (Diptera) of java and sumatra. Arch Hydrobiol Stuttg Suppl 13:92–138Google Scholar
  18. Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol Mar Biol Biotechnol 3:294–299PubMedGoogle Scholar
  19. Hall R (1998) The plate tectonics of cenozoic SE Asia and the distribution of land and sea. In: Hall R, Holloway JD (eds) Biogeography and geological evolution of SE Asia. Backhuys, Leiden, pp 99–132Google Scholar
  20. Hall R (2002) Cenozoic geologic and plate tectonic evolution of SE Asia and the SW Pacific: computer-based reconstructions, model and animations. J Asian Earth Sci 20:353–431CrossRefGoogle Scholar
  21. Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser 41:95–98Google Scholar
  22. Han HY, McPheron BA (1997) Molecular phylogenetic study of Tephritidae (Insecta: Diptera) using partial sequences of the mitochondrial 16S ribosomal DNA. Mol Phylogenet Evol 7:17–32CrossRefPubMedGoogle Scholar
  23. Hebert PDN, Cywinska A, Ball SL, deWaard JR (2003) Biological identifications through DNA barcodes. Proc R Soc Lond B 270:313–321CrossRefGoogle Scholar
  24. Higazi TB, Boakye DA, Wilson MD, Mahmoud BM, Baraka OZ, Mukhtar MM, Unnasch TR (2001) Cytotaxonomic and molecular analysis of Simulium (Edwardsellum) damnosum sensu lato (Diptera: Simuliidae) from Abu Hamed, Sudan. J Med Entomol 37:547–553Google Scholar
  25. Huelsenbeck JP, Ronquist FR (2001) MRBAYES: Bayesian inference of phylogeny. Bioinformatics 17:754–755CrossRefPubMedGoogle Scholar
  26. Jitklang S, Kuvangkadilok C (2007) A new species of Simulium (Gomphostilbia) (Diptera: Simuliidae) from southern Thailand, with description of its polytene chromosomes. Stud Dipterol 14:369–375Google Scholar
  27. Jitklang S, Kuvangkadilok C, Baimai V, Takaoka H, Adler PH (2008) Cytogenetics and morphotaxonomy of the Simulium (Gomphostilbia) ceylonicum species group (Diptera: Simuliidae) in Thailand. Zootaxa 1917:1–28Google Scholar
  28. Kjer KM, Baldridge GD, Fallon AM (1994) Mosquito large subunit ribosomal RNA: simultaneous alignment of primary and secondary structure. Biochem Biophys Acta 1217:147–155PubMedGoogle Scholar
  29. Krüger A, Hennings IC (2006) Molecular phylogenetics of blackflies of the Simulium damnosum complex and cytophylogenetic implications. Mol Phylogenet Evol 39:83–90CrossRefGoogle Scholar
  30. Krüger A, Gelhaus A, Garms R (2000) Molecular identification and phylogeny of East African Simulium damnosum s.l. and their relationship with West African species of the complex (Diptera: Simuliidae). Insect Mol Biol 9:101–108CrossRefPubMedGoogle Scholar
  31. Kuvangkadilok C, Boonkemtong C, Phayuhasena S (1998) C-banding in polytene chromosomes of six Simulium species (Diptera: Simuliidae) from Doi Inthanon National Park, northern Thailand. J Sci Soc Thail 24:215–230CrossRefGoogle Scholar
  32. Kuvangkadilok C, Phayuhasena S, Boonkemtong C (1999a) Larval polytene chromosomes of five species of blackflies (Diptera: Simuliidae) from Doi Inthanon National Park, northern Thailand. Cytologia 64:197–207Google Scholar
  33. Kuvangkadilok C, Phayuhasena S, Baimai V (1999b) Population cytogenetic studies on Simulium feuerborni Edwards (Diptera: Simuliidae) from northern Thailand. Genome 42:80–86CrossRefGoogle Scholar
  34. Kuvangkadilok C, Boonkemtong C, Phayuhasena S, Baimai V (2003) Larval polytene chromosomes of black flies (Simulium) from Thailand. I. Comparison among five species in the subgenus Gomphostilbia Enderlein. Genetica 118:69–81CrossRefPubMedGoogle Scholar
  35. Kuvangkadilok C, Lualon U, Baimai V (2008) Cytotaxonomy of Simulium siamense Takaoka and Suzuki (Diptera: Simuliidae) in Thailand. Genome 51:972–987CrossRefPubMedGoogle Scholar
  36. Lunt DH, Zhang DX, Szymura JM, Hewitt GM (1996) The insect cytochrome oxidase I gene: evolutionary patterns and conserved primers for phylogenetic studies. Insect Mol Biol 5:153–165CrossRefPubMedGoogle Scholar
  37. Maddison WP, Maddison DR (1992) MacClade: analysis of phylogeny and character evolution. Vers 3. Sinauer, SunderlandGoogle Scholar
  38. McArthur AG, Koop BF (1999) Partial 28S rDNA sequences and the antiquity of the hydrothermal vent endemic gastropods. Mol Phylogenet Evol 13:255–274CrossRefPubMedGoogle Scholar
  39. Moulton JK (2000) Molecular sequence data resolves basal divergences within Simuliidae (Diptera). Syst Entomol 25:95–113CrossRefGoogle Scholar
  40. Moulton JK (2003) Can the current molecular arsenal adequately track rapid divergence events within Simuliidae (Diptera)? Mol Phylogenet Evol 27:45–57CrossRefPubMedGoogle Scholar
  41. Otsuka Y, Aoki C, Saito K, Hadi UK, Takaoka H (2001) Phylogenetic analyses of a blackfly subgenus Simulium (Nevermannia) based on mitochondrial 16S ribosomal RNA gene sequences. Jpn J Trop Med Hyg 29:261–266Google Scholar
  42. Otsuka Y, Takaoka H, Aoki C, Choochote W (2003) Phylogenetic analysis of the subgenus Himalayum within the genus Simulium s.l. (Diptera: Simuliidae) using mitochondrial 16S rRNA gene sequences. Med Entomol Zool 54:113–120Google Scholar
  43. Ottesen EA, Hooper PJ, Bradley M, Biswas G (2008) The global programme to eliminate lymphatic filariasis: health impact after 8 years. PLOS Negl Trop Dis 2 (10). doi: 10.1371/journal.pntd.0000317. Available at http://www.plosntds.org/article/info:doi%2F10.1371%2Fjournal.pntd.0000317
  44. Pham XD (1998) New records of six black fly species (Diptera: Simuliidae) from Vietnam. Med Entomol Zool 49:121–123Google Scholar
  45. Pham XD (1999) Additional record of three black fly species from Vietnam (Diptera: Simuliidae). Med Entomol Zool 50:335–336Google Scholar
  46. Phasuk J, Chanpaisaeng J, Adler PH, Courtney GW (2005) Chromosomal and morphological taxonomy of larvae of Simulium (Gomphostilbia) (Diptera: Simuliidae) in Thailand. Zootaxa 1052:49–60Google Scholar
  47. Porter CH, Collins FH (1996) Phylogeny of Nearctic members of the Anopheles aculipennis species group derived from the D2 variable region of 28S ribosomal RNA. Mol Phylogenet Evol 6:178–188CrossRefPubMedGoogle Scholar
  48. Pramual P, Tangkawanit U (2008) A new species of Simulium (Gomphostilbia) (Diptera: Simuliidae) from Northeastern Thailand. Med Entomol Zool 59:297–303Google Scholar
  49. Pramual P, Kuvangkadilok C, Baimai V, Walton C (2005) Phylogeography of the black fly Simulium tani (Diptera: Simuliidae) from Thailand as inferred from mtDNA sequences. Mol Ecol 14:3989–4001CrossRefPubMedGoogle Scholar
  50. Procunier WS, Muro AI (1993) Cytotaxonomy of the Simulium damnosum complex from central and northeastern Tanzania. Genome 36:112–130CrossRefPubMedGoogle Scholar
  51. Pruess KP, Zhu X, Powers TO (1992) Mitochondrial transfer RNA genes in a black fly, Simulium vittatum (Diptera: Simuliidae), indicate long divergence from mosquito (Diptera: Culicidae) and fruit fly (Diptera: Drosophilidae). J Med Entomol 29:644–651PubMedGoogle Scholar
  52. Raes J, Van de Peer Y (1999) ForCon: a software tool for the conversion of sequence alignments. Available at: http://www.es.embnet.org/embnet_common/embnet.news/vol6_1/ForCon/body_forcon.html
  53. Rambaut A, Drummond AJ (2004) Tracer 1.3. Available from http://beastbioedacuk/Tracer
  54. Rothfels RH (1979) Cytotaxonomy of black flies (Simuliidae). Ann Rev Entomol 24:507–539CrossRefGoogle Scholar
  55. Simon C, Frati F, Beckenbach A, Crespi B, Liu H, Flook P (1994) Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Ann Entomol Soc Am 87:651–701Google Scholar
  56. Soto SIU, Lehmann T, Bowton ED, Vélez BID, Porter CH (2001) Speciation and population structure in the morphospecies Lutzomyia longipalpis (Lutz & Neiva) as derived from the mitochondrial ND4 gene. Mol Phylogenet Evol 18:84–93CrossRefPubMedGoogle Scholar
  57. Summer SLM (1911) Note from Entomological Department of the London School of Tropical Medicine No. II. Description of a new species of Simulium from the Siamese hills. Ann Mag Nat Hist 8:586–588Google Scholar
  58. Swofford DL (2002) PAUP*: phylogenetic analysis using parsimony (*and other methods), vers. 4.b.10. Sinauer, SunderlandGoogle Scholar
  59. Takaoka H (1989) Notes on blackflies (Diptera: Simuliidae) from Myanmar (formerly Burma). Jpn J Trop Med Hyg 17:243–257Google Scholar
  60. Takaoka H (1996) The geographical distribution of the genus Simulium Latreille in the Oriental and Australasian regions. Jpn J Trop Med Hyg 24:113–124Google Scholar
  61. Takaoka H, Adler PH (1997) A new subgenus, Simulium (Daviesellum), and a new species, S. (D.) courtneyi, (Diptera: Simuliidae) from Thailand and Peninsular Malaysia. Jpn J Trop Med Hyg 25:17–27Google Scholar
  62. Takaoka H, Choochote W (2004) A list of and keys to black flies (Diptera: Simuliidae) in Thailand. Trop Med Health 32:189–197CrossRefGoogle Scholar
  63. Takaoka H, Choochote W (2005a) Two new species of Simulium (Montisimulium) (Diptera: Simuliidae) from Thailand. Med Entomol Zool 56:21–34Google Scholar
  64. Takaoka H, Choochote W (2005b) A new subgenus and a new species of Simulium s. l. (Diptera: Simuliidae) from Thailand. Med Entomol Zool 56:33–41Google Scholar
  65. Takaoka H, Choochote W (2006a) A new species of the subgenus Simulium (Asiosimulium) (Diptera: Simuliidae) from Thailand. Med Entomol Zool 57:45–48Google Scholar
  66. Takaoka H, Choochote W (2006b) Description of adults of Simulium (Simulium) baimaii from Thailand (Diptera: Simuliidae) and its assignment to the malyschevi species-group. Med Entomol Zool 57:49–53Google Scholar
  67. Takaoka H, Choochote W (2006c) A new species of the griseifrons species-group of Simulium (Simulium) (Diptera: Simuliidae) in northern Thailand. Med Entomol Zool 57:115–124Google Scholar
  68. Takaoka H, Choochote W (2006d) A new species of Simulium (Nevermannia) from northern Thailand (Diptera: Simuliidae). Med Entomol Zool 57:83–92Google Scholar
  69. Takaoka H, Choochote W (2006e) A new species of Simulium (Gomphostilbia) (Diptera: Simuliidae) from northern Thailand. Med Entomol Zool 57:229–233Google Scholar
  70. Takaoka H, Davies DM (1995) The black flies (Diptera: Simuliidae) of West Malaysia. Kyushu University Press, FukuokaGoogle Scholar
  71. Takaoka H, Kuvangkadilok C (1999) Four new species of black flies (Diptera: Simuliidae) from Thailand. Jpn J Trop Med Hyg 4:497–509Google Scholar
  72. Takaoka H, Saito K (1996) A new species and new records of black flies (Diptera: Simuliidae) from Thailand. Jpn J Trop Med Hyg 24:163–169Google Scholar
  73. Takaoka H, Suzuki H (1984) The blackflies (Diptera: Simuliidae) from Thailand. Jpn J Sanit Zool 36:7–45Google Scholar
  74. Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol Biol Evol 24:1596–1599CrossRefPubMedGoogle Scholar
  75. Tang J, Toè L, Back C, Unnasch TR (1995a) Mitochondrial alleles of Simulium damnosum sensu lato infected with Onchocerca volvulus. Int J Parasitol 25:1251–1254CrossRefPubMedGoogle Scholar
  76. Tang J, Toè L, Back C, Zimmerman PA, Pruess K, Unnasch TR (1995b) The Simulium damnosum species complex: phylogenetic analysis and molecular identification based upon mitochondrially encoded gene sequences. Insect Mol Biol 4:79–88CrossRefPubMedGoogle Scholar
  77. Tang J, Pruess K, Cupp EW, Unnasch TR (1996a) Molecular phylogeny and typing of black flies (Diptera: Simuliidae) that serve as vectors of human or bovine onchocerciasis. Med Vet Entomol 10:228–234CrossRefPubMedGoogle Scholar
  78. Tang J, Toè L, Back C, Unnasch TR (1996b) Intra-specific heterogeneity of the rDNA internal transcribed spacer in the Simulium damnosum (Diptera: Simuliidae) complex. Mol Biol Evol 13:244–252PubMedGoogle Scholar
  79. Tangkawanit U, Kuvangkadilok C, Baimai V, Adler PH (2009) Cytosystematics of the Simulium tuberosum group (Diptera: Simuliidae) in Thailand. Zool J Linn Soc Lond 155:289–315CrossRefGoogle Scholar
  80. Thanwisai A, Kuvangkadilok C, Baimai V (2006) Molecular phylogeny of black flies (Diptera: Simuliidae) from Thailand, using ITS2 rDNA. Genetica 128:177–204CrossRefPubMedGoogle Scholar
  81. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG (1997) The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 24:4876–4882CrossRefGoogle Scholar
  82. Vajime CG, Dunbar RW (1975) Chromosomal identification of eight species of the subgenus Edwardsellum near and including Simulium (Edwardsellum) damnosum Theobald (Diptera: Simuliidae). Trop Med Parasitol 26:111–138Google Scholar
  83. Xiong B, Kocher TD (1991) Comparison of mitochondrial DNA sequences of seven morphospecies of black flies (Diptera: Simuliidae). Genome 34:306–311PubMedGoogle Scholar

Copyright information

© Springer Science+Business Media B.V. 2010

Authors and Affiliations

  • Suwannee Phayuhasena
    • 1
  • Donald J. Colgan
    • 2
  • Chaliow Kuvangkadilok
    • 1
  • Pairot Pramual
    • 3
  • Visut Baimai
    • 1
  1. 1.Department of Biology, Faculty of ScienceMahidol UniversityBangkokThailand
  2. 2.Ken and Yasuko Myer Molecular Evolutionary Biology UnitThe Australian MuseumSydneyAustralia
  3. 3.Department of Biology, Faculty of ScienceMahasarakham UniversityKantharawichai districtThailand

Personalised recommendations