Fine-scale genetic structure in a salamander with two reproductive modes: Does reproductive mode affect dispersal?

Abstract

Reproduction is intimately linked with dispersal, but the effects of changes in reproductive strategies on dispersal have received little attention. Such changes have occurred in many taxonomic groups, resulting in profound alterations in life-history. In amphibians, many species shifted from oviparous/larviparous aquatic reproduction (deposition of eggs or pre-metamorphic larvae in water) to pueriparous terrestrial reproduction (parturition of terrestrial juveniles). The latter provides greater independence from water by skipping the aquatic larval stage; however, the eco-evolutionary implications of this evolutionary step have been underexplored, largely because reproductive modes rarely vary at the intraspecific level, preventing meaningful comparisons. We studied the effects of a transition to pueriparity on dispersal and fine-scale genetic structure in the fire salamander (Salamandra salamandra), a species exhibiting two co-occurring reproductive modes: larviparity and pueriparity. We performed genetic analyses (parentage and genetic spatial autocorrelation) using 11 microsatellite loci to compare dispersal and fine-scale genetic structure in three larviparous and three pueriparous populations (354 individuals in total). We did not find significant differences between reproductive modes, but in some larviparous populations movement patterns may be influenced by site-specific features (type of water bodies), possibly due to passive water-borne dispersal of larvae along streams. Additionally, females (especially larviparous ones) appeared to be more philopatric, while males showed greater variation in dispersal distances. This study also points to future avenues of research to better understand the eco-evolutionary implications of changes in reproductive modes in amphibians.

This is a preview of subscription content, access via your institution.

We’re sorry, something doesn't seem to be working properly.

Please try refreshing the page. If that doesn't work, please contact support so we can address the problem.

Fig. 1
Fig. 2
Fig. 3
Fig. 4
Fig. 5
Fig. 6

Data availability

The microsatellite genotype data set generated during the current study will be deposited on Dryad upon acceptance of this manuscript.

References

  1. Álvarez D, Lourenço A, Oro D, Velo-Antón G (2015) Assessment of census (N) and effective population size (N e) reveals consistency of N e single-sample estimators and a high N e/N ratio in an urban and isolated population of fire salamanders. Conserv Genet Resour 7:705–712

    Article  Google Scholar 

  2. Amigo J, Rodríguez-Guitián MA, Honrado JJP, Alves P (2017) The lowlands and midlands of northwestern Atlantic Iberia. In: Loidi J (ed) The vegetation of the Iberian Peninsula, vol 1. Springer, Switzerland, pp 191–250

    Google Scholar 

  3. Banet AI, Svendsen JC, Eng KJ, Reznick DN (2016) Linking reproduction, locomotion, and habitat use in the Trinidadian guppy (Poecilia reticulata). Oecologia 181:87–96

    Article  Google Scholar 

  4. Banks SC, Peakall R (2012) Genetic spatial autocorrelation can readily detect sex-biased dispersal. Mol Ecol 21:2092–2105

    Article  Google Scholar 

  5. Benjamini Y, Hochberg Y (1995) Controlling the false discovery rate: a practical and powerful approach to multiple testing. J R Stat Soc B 57:289–300

    Google Scholar 

  6. Bennett A, Garland T, Else P (1989) Individual correlation of morphology, muscle mechanics, and locomotion in a salamander. Am J Physiol 256:R1200–R1208

    CAS  PubMed  Google Scholar 

  7. Blackburn DG (2015) Evolution of vertebrate viviparity and specializations for fetal nutrition: a quantitative and qualitative analysis. J Morphol 276:961–990

    Article  Google Scholar 

  8. Blaustein L, Segev O, Rovelli V et al (2018) Compassionate approaches for the conservation and protection of fire salamanders. Isr J Ecol Evol. https://doi.org/10.1163/22244662-06303001

    Article  Google Scholar 

  9. Bonte D, van Dyck H, Bullock JM et al (2012) Costs of dispersal. Biol Rev 87:290–312

    Article  Google Scholar 

  10. Bowler DE, Benton TG (2005) Causes and consequences of animal dispersal strategies: relating individual behaviour to spatial dynamics. Biol Rev 80:205–225

    Article  Google Scholar 

  11. Buckley D, Alcobendas M, García-París M, Wake MH (2007) Heterochrony, cannibalism, and the evolution of viviparity in Salamandra salamandra. Evol Dev 9:105–115

    Article  Google Scholar 

  12. Carvalho F, Lourenço A, Carvalho R, Alves PC, Mira A, Beja P (2018) Behavioural disturbance and gene flow across a motorway in a forest carnivore: joint evidence from road mortality, radio tracking and genetics. Landsc Urban Plan 178:217–227

    Article  Google Scholar 

  13. Chybicki IJ, Burczyk J (2009) Simultaneous estimation of null alleles and inbreeding coefficients. The J Hered 100:106–113

    CAS  Article  Google Scholar 

  14. Clobert J, Le Galliard JF, Cote J, Meylan S, Massot M (2009) Informed dispersal, heterogeneity in animal dispersal syndromes and the dynamics of spatially structured populations. Ecol Lett 12:197–209

    Article  Google Scholar 

  15. Cosgrove AJ, McWhorter TJ, Maron M (2018) Consequences of impediments to animal movements at different scales: a conceptual framework and review. Divers Distrib 24:448–459

    Article  Google Scholar 

  16. Cote J, Bestion E, Jacob S, Travis J, Legrand D, Baguette M (2017) Evolution of dispersal strategies and dispersal syndromes in fragmented landscapes. Ecography 40:56–73

    Article  Google Scholar 

  17. Denton RD, Greenwald KR, Gibbs HL (2017) Locomotor endurance predicts differences in realized dispersal between sympatric sexual and unisexual salamanders. Funct Ecol 31:915–926

    Article  Google Scholar 

  18. Dinis M, Velo-Antón G (2017) How little do we know about the reproductive mode in the north African salamander, Salamandra algira? Pueriparity in divergent mitochondrial lineages of S. a. tingitana. Amphibia-Reptilia 38:540–546

    Article  Google Scholar 

  19. Ficetola GF, Manenti R, De Bernardi F, Padoa-Schioppa E (2012) Can patterns of spatial autocorrelation reveal population processes? An analysis with the fire salamander. Ecography 35:693–703

    Article  Google Scholar 

  20. Galán P (2007) Viviparismo y distribución de Salamandra salamandra bernardezi en el norte de Galicia. B Asoc Herp Espan 18:44–49

    Google Scholar 

  21. García-París M, Alcobendas M, Buckley D, Wake D (2003) Dispersal of viviparity across contact zones in Iberian populations of Fire salamanders (Salamandra) inferred from discordance of genetic and morphological traits. Evolution 57:129–143

    Article  Google Scholar 

  22. Gibbs JP (1998) Distribution of woodland amphibians along a forest fragmentation gradient. Landsc Ecol 13:263–268

    Article  Google Scholar 

  23. Grant AH, Liebgold EB (2017) Color-biased dispersal inferred by fine-scale genetic spatial autocorrelation in a color polymorphic salamander. J Hered 108:588–593

    Article  Google Scholar 

  24. Halliwell B, Uller T, Holland BR, While GM (2017) Live bearing promotes the evolution of sociality in reptiles. Nat Commun 8:2030

    Article  Google Scholar 

  25. Helfer V, Broquet T, Fumagalli L (2012) Sex-specific estimates of dispersal show female philopatry and male dispersal in a promiscuous amphibian, the alpine salamander (Salamandra atra). Mol Ecol 21:4706–4720

    CAS  Article  Google Scholar 

  26. Helmstetter AJ, Papadopulos AST, Igea J, Van Dooren TJM, Leroi AM, Savolainen V (2016) Viviparity stimulates diversification in an order of fish. Nat Commun 7:11271

    CAS  Article  Google Scholar 

  27. Hendrix R, Hauswaldt JS, Veith M, Steinfartz S (2010) Strong correlation between cross-amplification success and genetic distance across all members of ‘True salamanders’ (Amphibia: Salamandridae) revealed by Salamandra salamandra-specific microsatellite loci. Mol Ecol Resour 10:1038–1047

    CAS  Article  Google Scholar 

  28. Hendrix R, Schmidt BR, Schaub M, Krause ET, Steinfartz S (2017) Differentiation of movement behaviour in an adaptively diverging salamander population. Mol Ecol 26:6400–6413

    Article  Google Scholar 

  29. Jones O, Wang J (2010) COLONY: a program for parentage and sibship inference from multilocus genotype data. Mol Ecol Resour 10:551–555

    Article  Google Scholar 

  30. Keenan K, McGinnity P, Cross TF, Crozier WW, Prodӧhl PA (2013) diveRsity: an R package for the estimation of population genetics parameters and their associated errors. Methods Ecol Evol 4:782–788

    Article  Google Scholar 

  31. Liebgold EB, Brodie ED, Cabe PR (2011) Female philopatry and male-biased dispersal in a direct-developing salamander, Plethodon cinereus. Mol Ecol 20:249–257

    Article  Google Scholar 

  32. Liedtke HC, Müller H, Hafner J, Penner J, Gower DJ, Mazuch T, Rӧdel M-O, Loader SP (2017) Terrestrial reproduction as an adaptation to steep terrain in African toads. Proc R Soc B 284:20162598

    Article  Google Scholar 

  33. Lourenço A, Álvarez D, Wang IJ, Velo-Antón G (2017) Trapped within the city: integrating demography, time since isolation and population-specific traits to assess the genetic effects of urbanization. Mol Ecol 26:1498–1514

    Article  Google Scholar 

  34. Marsh DM, Thakur KA, Bulka KC, Clarke LB (2004) Dispersal and colonization through open fields by a terrestrial, woodland salamander. Ecology 85:3396–3405

    Article  Google Scholar 

  35. Martínez-Solano I, Jockusch EL, Wake DB (2007) Extreme population subdivision throughout a continuous range: phylogeography of Batrachoseps attenuatus (Caudata: Plethodontidae) in western North America. Mol Ecol 16:4335–4355

    Article  Google Scholar 

  36. Measey GJ, Galbusera P, Breyne P, Matthysen E (2007) Gene flow in a direct-developing, leaf litter frog between isolated mountains in the Taita Hills, Kenya. Conserv Genet 8:1177–1188

    Article  Google Scholar 

  37. Ousterhout BH, Semlitsch RD (2018) Effects of conditionally expressed phenotypes and environment on amphibian dispersal in nature. Oikos 127:1142–1151

    Article  Google Scholar 

  38. Peakall R, Smouse PE (2012) GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and research—an update. Bioinformatics 28:2537–2539

    CAS  Article  Google Scholar 

  39. Peakall R, Ruibal M, Lindenmayer DB (2003) Spatial autocorrelation analysis offers new insights into gene flow in the Australian bush rat, Rattus Fuscipes. Evolution 57:1182–1195

    Article  Google Scholar 

  40. Pereira RJ, Martínez-Solano I, Buckley D (2016) Hybridization during altitudinal range shifts: nuclear introgression leads to extensive cyto-nuclear discordance in the fire salamander. Mol Ecol 25:1551–1565

    CAS  Article  Google Scholar 

  41. Peterman WE, Connette GM, Semlitsch RD, Eggert LS (2014) Ecological resistance surfaces predict fine-scale genetic differentiation in a terrestrial woodland salamander. Mol Ecol 23:2402–2413

    Article  Google Scholar 

  42. QGIS Development Team (2017) QGIS Geographic Information System. Open Source Geospatial Foundation Project. http://qgis.osgeo.org

  43. R Development Core Team (2017) R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. https://www.R-project.org/

  44. Rebelo R, Caetano MH (1995) Use of the skeletochronological method for ecodemographical studies on Salamandra salamandra gallaica from Portugal. In: Llorente GA, Montori A, Santos X, Carretero MA (eds) Scientia Herpetologica: papers submitted from the 7th Ordinary General Meeting of Societas Europaea Herpetologica, Barcelona, September 1993. Asociación Herpetológica Española, Barcelona, pp 135–140

  45. Rebelo R, Leclair MH (2003) Site tenacity in the terrestrial salamandrid Salamandra salamandra. J Herpetol 37:440–445

    Article  Google Scholar 

  46. Reinhardt T, Bauldauf L, Ilić M, Fink P (2018) Cast away: drift as the main determinant for larval survival in western fire salamanders (Salamandra salamandra) in headwater streams. J Zool. https://doi.org/10.1111/jzo.12581

    Article  Google Scholar 

  47. Richards-Zawacki CL, Wang IJ, Summers K (2012) Mate choice and the genetic basis for colour variation in a polymorphic dart frog: inferences from a wild pedigree. Mol Ecol 21:3879–3892

    Article  Google Scholar 

  48. Ronce O, Clobert J (2012) Dispersal syndromes. In: Clobert J, Baguette J, Benton TG, Bullock JM (eds) Dispersal ecology and evolution. Oxford University Press, Oxford, pp 119–138

    Google Scholar 

  49. Rousset F (2008) GENEPOP’007: a complete re-implementation of the GENEPOP software for Windows and Linux. Mol Ecol Resour 8:103–106

    Article  Google Scholar 

  50. Russell AP, Bauer AM, Johnson MK (2005) Migration in amphibians and reptiles: an overview of patterns and orientation mechanisms in relation to life history strategies. In: Elewa AMT (ed) Migration of organisms. Springer, Berlin, pp 151–203

    Google Scholar 

  51. Saastamoinen M, Bocedi G, Cote J et al (2018) Genetics of dispersal. Biol Rev 93:574–599

    Article  Google Scholar 

  52. Sánchez-Montes G, Ariño AH, Vizmanos JL, Wang J, Martínez-Solano I (2017) Effects of sample size and full sibs on genetic diversity characterization: a case study of three syntopic Iberian pond-breeding amphibians. J Hered 108:535–543

    Article  Google Scholar 

  53. Sandberger-Loua L, Rödel MO, Feldhaar H (2018) Gene-flow in the clouds: landscape genetics of a viviparous, montane grassland toad in the tropics. Conserv Genet 19:169–180

    Article  Google Scholar 

  54. Schmidt BR, Itin E, Schaub M (2014) Seasonal and annual survival of the salamander Salamandra salamandra salamandra. J Herpetol 48:20–23

    Article  Google Scholar 

  55. Schulte U, Küsters D, Steinfartz S (2007) A PIT tag based analysis of annual movement patterns of adult fire salamanders (Salamandra salamandra) in a Middle European habitat. Amphibia-Reptilia 28:531–536

    Article  Google Scholar 

  56. Segev O, Blaustein L (2014) Influence of water velocity and predation risk on fire salamander (Salamandra infraimmaculata) larval drift among temporary pools in ephemeral streams. Freshw Sci 33:950–957

    Article  Google Scholar 

  57. Semlitsch RD (2008) Differentiating migration and dispersal processes for pond-breeding amphibians. J Wildlife Manag 72:260–267

    Article  Google Scholar 

  58. Shine R (1980) “Costs” of reproduction in reptiles. Oecologia 46:92–100

    Article  Google Scholar 

  59. Shine R (2015) The evolution of oviparity in squamate reptiles: an adaptationist perspective. J Exp Zool B Mol Dev Evol 324:487–492

    Article  Google Scholar 

  60. Smith MA, Green DM (2005) Dispersal and the metapopulation in amphibian and paradigm ecology are all amphibian conservation: populations metapopulations? Ecography 28:110–128

    Article  Google Scholar 

  61. Smouse PE, Peakall R (1999) Spatial autocorrelation analysis of individual multiallele and multilocus genetic structure. Heredity 82:561–573

    Article  Google Scholar 

  62. Smouse PE, Peakall R, Gonzales E (2008) A heterogeneity test for fine-scale genetic structure. Mol Ecol 17:3389–3400

    Article  Google Scholar 

  63. Steinfartz S, Kuesters D, Tautz D (2004) Isolation and characterization of polymorphic tetranucleotide microsatellite loci in the Fire salamander Salamandra salamandra (Amphibia: Caudata). Mol Ecol Resour 4:626–628

    CAS  Article  Google Scholar 

  64. Stevens VM, Pavoine S, Baguette M (2010) Variation within and between closely related species uncovers high intra-specific variability in dispersal. PLoS ONE 5:e11123

    Article  Google Scholar 

  65. Thiesmeier B, Schuhmacher H (1990) Causes of larval drift of the fire salamander, Salamandra salamandra terrestris, and its effects on population dynamics. Oecologia 82:259–263

    Article  Google Scholar 

  66. Tilley SG (2016) Patterns of genetic differentiation in woodland and dusky salamanders. Copeia 104:8–20

    Article  Google Scholar 

  67. Trochet A, Courtois EA, Stevens VM, Baguette M, Chaine A, Schmeller DS, Clobert J (2016) Evolution of sex-biased dispersal. Q Rev Biol 91:297–320

    Article  Google Scholar 

  68. van Dyke JU, Brandley MC, Thompson MB (2014) The evolution of viviparity: molecular and genomic data from squamate reptiles advance understanding of live birth in amniotes. Reproduction 147:R15–R26

    Article  Google Scholar 

  69. van Etten J (2017) R Package gdistance: distances and routes on geographical grids. J Stat Softw 76:1–21

    Google Scholar 

  70. Velo-Antón G, Buckley D (2015) Salamandra común – Salamandra salamandra. In: Carrascal LM, Salvador A (eds) Enciclopedia Virtual de los Vertebrados Españoles. Museo Nacional de Ciencias Naturales, Madrid. http://www.vertebradosibericos.org/anfibios/salsal.html

  71. Velo-Antón G, Cordero-Rivera A (2017) Ethological and phenotypic divergence in insular fire salamanders: Diurnal activity mediated by predation? Acta Ethol 20:243–253

    Article  Google Scholar 

  72. Velo-Antón G, García-París M, Galán P, Cordero Rivera A (2007) The evolution of viviparity in holocene islands: ecological adaptation versus phylogenetic descent along the transition from aquatic to terrestrial environments. J Zool Syst Evol Res 45:345–352

    Article  Google Scholar 

  73. Velo-Antón G, Zamudio KR, Cordero-Rivera A (2012) Genetic drift and rapid evolution of viviparity in insular fire salamanders (Salamandra salamandra). Heredity 108:410–418

    Article  Google Scholar 

  74. Velo-Antón G, Parra JL, Parra-Olea G, Zamudio KR (2013) Tracking climate change in a dispersal-limited species: reduced spatial and genetic connectivity in a montane salamander. Mol Ecol 22:3261–3278

    Article  Google Scholar 

  75. Velo-Antón G, Santos X, Sanmartín-Villar I, Cordero-Rivera A, Buckley D (2015) Intraspecific variation in clutch size and maternal investment in pueriparous and larviparous Salamandra salamandra females. l 29:185–204

    Google Scholar 

  76. Wang J (2011) Coancestry: a program for simulating, estimating and analysing relatedness and inbreeding coefficients. Mol Ecol Resour 11:141–145

    Article  Google Scholar 

  77. Wang IJ (2013) Examining the full effects of landscape heterogeneity on spatial genetic variation: a multiple matrix regression approach for quantifying geographic and ecological isolation. Evolution 67:3403–3411

    Article  Google Scholar 

  78. Wang J, Santure AW (2009) Parentage and sibship inference from multilocus genotype data under polygamy. Genetics 181:1579–1594

    CAS  Article  Google Scholar 

  79. Wang IJ, Shaffer HB (2017) Population genetic and field ecological analyses return similar estimates of dispersal over space and time in an endangered amphibian. Evol Appl 10:630–639

    Article  Google Scholar 

  80. Wang Y, Lane A, Ding P (2012) Sex-biased dispersal of a frog (Odorrana schmackeri) is affected by patch isolation and resource limitation in a fragmented landscape. PLoS ONE 7:e47683

    CAS  Article  Google Scholar 

Download references

Acknowledgements

We thank B. Correia, M. Dinis, M. Henrique, P. Pereira, and P. Alves for help during field work, and S. Lopes for laboratory assistance. We also thank Dr. Rod Peakall, Dr. Peter Smouse, and Dr. Jinliang Wang for their advice on statistical analyses. Fieldwork for obtaining tissue samples was done with the corresponding permits from the regional administrations (Xunta de Galicia, Ref. 410/2015; Gobierno del Principado de Asturias, Ref. 2016/001092). Sampling procedures were carried out following the Guidelines for Use of Live Amphibians and Reptiles in Field and Laboratory Research, 2nd Edition, revised by the Herpetological Animal Care and Use Committee (HACC) of the American Society of Ichthyologists and Herpetologists, 2004. Lab work was supported by FEDER funds through the Operational Programme for Competitiveness Factors – COMPETE (FCOMP-01-0124-FEDER-028325 and POCI-01-0145-FEDER-006821); and by National Funds through FCT – Foundation for Science and Technology (PTDC/BIA-EVF/3036/2012). Field work was supported by a Student Grant Scheme granted by the British Herpetological Society (2016-12-01). GVA and AL are supported by FCT (IF/01425/2014 and PD/BD/106060/2015, respectively). The authors declare no conflicts of interest. We thank the editor in chief Dr. Matthew Symonds, the associate editors and three anonymous referees for constructive comments on earlier versions of the manuscript.

Author information

Affiliations

Authors

Corresponding authors

Correspondence to André Lourenço or Guillermo Velo-Antón.

Appendices

Appendix 1: Detailed PCR conditions and allele scoring procedures

Each PCR reaction contained a total volume of 10–11 µl: 5 µl of Multiplex PCR Kit Master Mix (QIAGEN), 3 µl of distilled water, 1 µl of primer multiplex mix and 1–2 µl of DNA extract (~ 50 ng/µl). To identify possible contaminations, a negative control was employed. PCR touchdown cycling conditions were equal in all multiplexes: the reaction started with an initial step at 95 °C for 15 min, 19 cycles at 95 °C for 30 s, 90 s of annealing at 65 °C (decreasing 0.5 °C each cycle), 72 °C for 40 s, followed by 25 cycles of 95 °C for 30 s, 56 °C for 60 s, 72 °C for 40 s, and ended with a final extension of 30 min at 60 °C.

Prior to allele scoring in GENEMAPPER, allele fragment length binning was performed on a set of tissue samples of very high quality (ca. 50 samples) collected across northern Spain. The DNA Size Standard LIZ 500 DSMO-100 (MCLAB) was employed to determine the relative size of fragments. Following binning procedures, genotypes were checked and corrected by two persons to avoid potential erroneous scoring of alleles. Additionally, to reduce the potential influence of allele dropout and false alleles, we scored only alleles exhibiting clear fluorescence peaks higher than 100 relative fluorescent units. Microsatellite markers that failed to amplify or exhibited dubious allelic profiles (e.g. with high prevalence of peak artefacts) in samples containing more than 25% of missing data were reamplified in uniplex reactions (i.e. for a single microsatellite locus) to increase the likelihood of amplification. Each uniplex PCR contained a total volume of 10–11 µl: 5 µl of Multiplex PCR Kit Master Mix (QIAGEN), 2.8 µl of distilled water, 0.4 µl of forward primer (1 µM), 0.4 µl of reverse primer (10 µM), 0.4 µl of the respective fluorescently labelled oligonucleotides (10 µM; see Appendix 2), and 1–2 µl of DNA extract. Cycling conditions are the same as those described for multiplexes.

Appendix 2: Details of the 14 microsatellites used in this study

Information regarding multiplex arrangement, original published primers and fluorescently labelled oligonucleotides used as template for modified forward primers is displayed. The primer volume used to create a multiplex with a total volume of 100 µl (distilled H2O plus the volumes of the unlabelled and fluorescently labelled primers) is also represented (PVM). The forward and reverse primers were concentrated at 10 µM and 100 µM, respectively. This table is adapted from Supplementary Material 2 of Álvarez et al. (2015) and Table S2 of Lourenço et al. (2017).

Locus Multiplex Label* Primer forward (5′–3′) Primer reverse (5′–3′) PVM (µl)
SST-A6-I2 Ssal1 NED TTCAGTGCTCTTGCAGGTTG AGTCTGCAAGGATAGAAAGATCG 2.0
SST-A6-II2 Ssal1 PET ATTCTCTCTGACAAGGATTGTGG GGTAGACAGACATCAAGGCAGAC 1.2
SalE141 Ssal1 VIC GCTGCCCTCTCTGCCTACTGACCAT GCCAAGACATGGAACACCCTCCCGC 0.8
Sal291 Ssal2 6-FAM CTCTTTGACTGAACCAGAACCCC GCCTGTCGGCTCTGTGTAACC 8.0
SST-B112 Ssal2 PET TCAAACGGTGCCAAAGTTATTAG TTAATTGGCAGTTTTCTTTCCAG 2.0
SalE121 Ssal2 VIC CTCAGGAACAGTGTGCCCCAAATAC CTCATAATTTAGTCTACCCTCCCAC 0.8
SST-C32 Ssal3 PET CCGTTTGAGTCACTTCTTTCTTG TTGCTTTACCAACCAGTTATTGTC 1.4
SalE71 Ssal3 NED TTTCAGCACCAAGATACCTCTTTTG CTCCCTCCATATCAAGGTCACAGAC 0.8
SalE51 Ssal3 6-FAM CCACATGATGCCTACGTATGTTGTG CTCCTGTTTACGCTTCACCTGCTCC 0.6
SalE21 Ssal3 VIC CACGACAAAATACAGAGAGTGGATA ATATTTGAAATTGCCCATTTGGTA 3.0
SalE061 Ssal4 VIC GGACTCATGGTCACCCAGAGGTTCT ATGGATTGTGTCGAAATAAGGTATC 1.2
Sal31 Ssal4 6-FAM CTCAGACAAGAAATCCTGCTTCTTC ATAAATCTGTCCTGTTCCTAATCAG 1.2
SalE81 Ssal4 NED GCAAAGTCCATGCTTTCCCTTTCTC GACATACCAAAGACTCCAGAATGGG 0.8
SST-G92 Ssal4 NED CCTCGTCAGGGGTTGTAGG CTTTCCAGGAAGAAACTGAGATG 0.8
  1. *An extra number of base pairs were added at the 5′ end of the original sequence of forward primers in order to allow binding of four different fluorescent labelled oligonucleotides (6-FAM—TGT AAA ACG ACG GCC AGT; VIC—TAA TAC GAC TCA CTA TAG GG; NED—TTT CCC AGT CAC GAC GTT G; PET—GAT AAC AAT TTC ACA CAG G)
  2. 1Steinfartz et al. (2004)
  3. 2Hendrix et al. (2010)

Appendix 3: Details of the calculation of pairwise between-individual matrices of geographic distances in EUME_Larv

The two geographic distance matrices obtained in locality EUME_Larv were subjected to additional pre-treatment procedures. This is because not all individuals along the transect were sampled in a straight path, particularly the westernmost individuals (Fig. 2c). Since a river that may comprise a barrier to dispersal is located adjacently to sampled individuals, the pairwise Euclidean distances involving these westernmost individuals are likely underestimated. To circumvent this issue, we digitized a shapefile adjacent to the river in QGIS (QGIS Development Team 2017). Then, we employed the R package gdistance (van Etten 2017) to rasterize the shapefile and calculate a pairwise “least-cost” distance that accounted for the river as a barrier to dispersal involving those individuals and remaining sampled individuals.

Appendix 4: Summary statistics of spatial autocorrelation analyses comparing larviparous males and pueriparous males

Summary statistics of spatial autocorrelation analyses comparing larviparous males and pueriparous males (see respective correlogram in Fig. 3a) aimed at testing H1. The Omega test value (ω) and respective p value (p) for each subsample is displayed. Significant ω values were declared when p < 0.01 (values in bold; Smouse et al. 2008). Remaining parameters were estimated for each of the eight distance classes tested: 100 (0–100 m), 200 (101–200 m), 300 (201–300 m), 400 (301–400 m), 500 (401–500 m), 600 (501–600 m), 700 (601–700 m), and 1000 (701–1000 m). These parameters are: N (number of pairs of individuals analysed), r (autocorrelation coefficient) and respective lower (r lower 95% CI limit) and upper (r upper 95% CI limit) bounds of the 95% CIs. The p values of one-tailed tests to determine if r values were significantly higher (p (r-rand  r-obs)) or lower (p (r-obs  r-rand)) than expected for a given distance class are also displayed, with significant p values (p < 0.05) in bold and underlined.

Data set and parameters ω (pω) 100 200 300 400 500 600 700 1000
Larviparous males 28.4 (0.03)         
N   185 191 160 149 116 87 70 98
r   − 0.019 0.013 0.001 0.004 − 0.008 − 0.005 0.022 − 0.001
r lower 95% CI limit   − 0.035 − 0.007 − 0.021 − 0.019 − 0.032 − 0.031 − 0.007 − 0.028
r upper 95% CI limit   0.001 0.033 0.024 0.028 0.017 0.022 0.053 0.024
p (r-rand  r-obs)   0.979 0.068 0.446 0.336 0.733 0.662 0.079 0.551
p (r-obs  r-rand)   0.021 0.932 0.554 0.664 0.267 0.338 0.921 0.449
Pueriparous males 21.7 (0.72)         
N   291 303 262 200 168 122 91 116
r   − 0.003 0.003 0.006 − 0.007 − 0.006 0.003 − 0.007 0.009
r lower 95% CI limit   − 0.018 − 0.010 − 0.008 − 0.024 − 0.026 − 0.021 − 0.030 − 0.012
r upper 95% CI limit   0.011 0.017 0.022 0.011 0.015 0.026 0.017 0.030
p (r-rand  r-obs)   0.699 0.319 0.186 0.806 0.744 0.382 0.699 0.187
p (r-obs  r-rand)   0.301 0.681 0.814 0.194 0.256 0.618 0.301 0.813

Appendix 5: Summary statistics of spatial autocorrelation analyses comparing larviparous females and pueriparous females

Summary statistics of spatial autocorrelation analyses comparing larviparous females and pueriparous females (see respective correlogram in Fig. 3b) aimed at testing H1. The Omega test value (ω) and respective p value (p) for each subsample is displayed. Significant ω values were declared when p < 0.01 (values in bold; Smouse et al. 2008). Remaining parameters were estimated for each of the eight distance classes tested: 100 (0–100 m), 200 (101–200 m), 300 (201–300 m), 400 (301–400 m), 500 (401–500 m), 600 (501–600 m), 700 (601–700 m), and 1000 (701–1000 m). These parameters are: N (number of pairs of individuals analysed), r (autocorrelation coefficient) and respective lower (r lower 95% CI limit) and upper (r upper 95% CI limit) bounds of the 95% CIs. The p values of one-tailed tests to determine if r values were significantly higher (p (r-rand  r-obs)) or lower (p (r-obs  r-rand)) than expected for a given distance class are also displayed, with significant p values (p < 0.05) in bold and underlined.

Data set and parameters ω (pω) 100 200 300 400 500 600 700 1000
Larviparous females 38.4 (< 0.01)         
N   188 188 164 158 135 105 58 79
r   0.020 − 0.005 − 0.008 − 0.016 0.008 0.024 − 0.018 − 0.019
r lower 95% CI limit   0.000 − 0.027 − 0.027 − 0.037 − 0.016 − 0.001 − 0.047 − 0.051
r upper 95% CI limit   0.040 0.016 0.013 0.006 0.031 0.048 0.015 0.011
p (r-rand  r-obs)   0.017 0.714 0.782 0.941 0.210 0.031 0.858 0.917
p (r-obs  r-rand)   0.983 0.286 0.218 0.060 0.790 0.970 0.142 0.083
Pueriparous females 44.3 (< 0.01)         
N   280 281 241 186 134 100 64 75
r   0.010 − 0.017 0.003 0.006 − 0.003 0.034 − 0.038 − 0.004
r lower 95% CI limit   − 0.004 − 0.032 − 0.014 − 0.013 − 0.024 0.007 − 0.066 − 0.039
r upper 95% CI limit   0.025 − 0.002 0.020 0.026 0.019 0.060 − 0.010 0.033
p (r-rand  r-obs)   0.077 0.992 0.354 0.242 0.602 0.003 0.994 0.612
p (r-obs  r-rand)   0.923 0.008 0.646 0.758 0.398 0.997 0.007 0.389

Appendix 6: Summary statistics of spatial autocorrelation analyses comparing larviparous males and larviparous females

Summary statistics of spatial autocorrelation analyses comparing larviparous males and larviparous females (see respective correlogram in Fig. 4a) aimed at testing H2. The Omega test value (ω) and respective p value (p) for each subsample is displayed. Significant ω values were declared when p < 0.01 (values in bold; Smouse et al. 2008). Remaining parameters were estimated for each of the eight distance classes tested: 100 (0–100 m), 200 (101–200 m), 300 (201–300 m), 400 (301–400 m), 500 (401–500 m), 600 (501–600 m), 700 (601–700 m), and 1000 (701–1000 m). These parameters are: N (number of pairs of individuals analysed), r (autocorrelation coefficient) and respective lower (r lower 95% CI limit) and upper (r upper 95% CI limit) bounds of the 95% CIs. The p values of one-tailed tests to determine if r values were significantly higher (p (r-rand  r-obs)) or lower (p (r-obs  r-rand)) than expected for a given distance class are also displayed, with significant p values (p < 0.05) in bold and underlined.

Data set and parameters ω (pω) 100 200 300 400 500 600 700 1000
Larviparous males 28.4 (0.03)         
N   185 191 160 149 116 87 70 98
r   − 0.019 0.013 0.001 0.004 − 0.008 − 0.005 0.022 − 0.001
r lower 95% CI limit   − 0.035 − 0.007 − 0.021 − 0.019 − 0.032 − 0.031 − 0.007 − 0.028
r upper 95% CI limit   0.001 0.033 0.024 0.028 0.017 0.022 0.053 0.024
p (r-rand  r-obs)   0.979 0.068 0.446 0.336 0.733 0.662 0.079 0.551
p (r-obs  r-rand)   0.021 0.932 0.554 0.664 0.267 0.338 0.921 0.449
Larviparous females 38.4 (< 0.01)         
N   188 188 164 158 135 105 58 79
r   0.020 − 0.005 − 0.008 − 0.016 0.008 0.024 − 0.018 − 0.019
r lower 95% CI limit   0.000 − 0.027 − 0.027 − 0.037 − 0.016 − 0.001 − 0.047 − 0.051
r upper 95% CI limit   0.040 0.016 0.013 0.006 0.031 0.048 0.015 0.011
p (r-rand  r-obs)   0.017 0.714 0.782 0.941 0.210 0.031 0.858 0.917
p (r-obs  r-rand)   0.983 0.286 0.218 0.060 0.790 0.970 0.142 0.083

Appendix 7: Summary statistics of spatial autocorrelation analyses comparing pueriparous males and pueriparous females

Summary statistics of spatial autocorrelation analyses comparing pueriparous males and pueriparous females (see respective correlogram in Fig. 4b) aimed at testing H2. The Omega test value (ω) and respective p value (p) for each subsample is displayed. Significant ω values were declared when p < 0.01 (values in bold; Smouse et al. 2008). Remaining parameters were estimated for each of the eight distance classes tested: 100 (0–100 m), 200 (101–200 m), 300 (201–300 m), 400 (301–400 m), 500 (401–500 m), 600 (501–600 m), 700 (601–700 m), and 1000 (701–1000 m). These parameters are: N (number of pairs of individuals analysed), r (autocorrelation coefficient) and respective lower (r lower 95% CI limit) and upper (r upper 95% CI limit) bounds of the 95% CIs. The p-values of one-tailed tests to determine if r values were significantly higher (p (r-rand  r-obs)) or lower (p (r-obs  r-rand)) than expected for a given distance class are also displayed, with significant p values (p < 0.05) in bold and underlined.

Data set and parameters ω (pω) 100 200 300 400 500 600 700 1000
Pueriparous males 21.7 (0.72)         
N   291 303 262 200 168 122 91 116
r   − 0.003 0.003 0.006 − 0.007 − 0.006 0.003 − 0.007 0.009
r lower 95% CI limit   − 0.018 − 0.010 − 0.008 − 0.024 − 0.026 − 0.021 − 0.030 − 0.012
r upper 95% CI limit   0.011 0.017 0.022 0.011 0.015 0.026 0.017 0.030
p (r-rand  r-obs)   0.699 0.319 0.186 0.806 0.744 0.382 0.699 0.187
p (r-obs  r-rand)   0.301 0.681 0.814 0.194 0.256 0.618 0.301 0.813
Pueriparous females 44.3 (< 0.01)         
N   280 281 241 186 134 100 64 75
r   0.010 − 0.017 0.003 0.006 − 0.003 0.034 − 0.038 − 0.004
r lower 95% CI limit   − 0.004 − 0.032 − 0.014 − 0.013 − 0.024 0.007 − 0.066 − 0.039
r upper 95% CI limit   0.025 − 0.002 0.020 0.026 0.019 0.060 − 0.010 0.033
p (r-rand  r-obs)   0.077 0.992 0.354 0.242 0.602 0.003 0.994 0.612
p (r-obs  r-rand)   0.923 0.008 0.646 0.758 0.398 0.997 0.007 0.389

Appendix 8: Summary statistics of spatial autocorrelation analyses comparing males and females in each sampled larviparous population

Summary statistics of spatial autocorrelation analyses comparing males and females in each sampled larviparous population (PEGA_Larv, EUME_Larv, and SGAL_Larv; see respective correlograms in Fig. 5). The Omega test value (ω) and respective p value (p) for each sampled locality is displayed. Significant ω values were declared when p < 0.01 (values in bold; Smouse et al. 2008). Remaining parameters were estimated for each of the six distance classes tested: 100 (0–100 m), 200 (101–200 m), 300 (201–300 m), 500 (301–500 m), 700 (501–700 m), and 1000 (701–1000 m). These parameters are: N (number of pairs of individuals analysed), r (autocorrelation coefficient) and respective lower (r lower 95% CI limit) and upper (r upper 95% CI limit) bounds of the 95% CIs. The p-values of one-tailed tests to determine if r values were significantly higher (p (r-rand  r-obs)) or lower (p (r-obs  r-rand)) than expected for a given distance class are also displayed, with significant p values (p < 0.05) in bold and underlined.

Data set and parameters ω (pω) 100 200 300 500 700 1000
PEGA_Larv
Males 25.0 (0.01)       
N   71 76 58 99 62 41
r   − 0.035 0.010 0.009 0.011 − 0.003 0.006
r lower 95% CI limit   − 0.063 − 0.018 − 0.021 − 0.013 − 0.032 − 0.034
r upper 95% CI limit   − 0.007 0.040 0.035 0.036 0.025 0.050
p (r-rand  r-obs)   0.997 0.210 0.277 0.153 0.597 0.372
p (r-obs  r-rand)   0.003 0.790 0.723 0.847 0.403 0.628
Females 30.9 (< 0.01)       
N   61 44 35 83 45 22
r   0.007 0.042 − 0.029 − 0.006 0.002 − 0.049
r lower 95% CI limit   − 0.022 0.005 − 0.068 − 0.031 − 0.035 − 0.095
r upper 95% CI limit   0.038 0.075 0.016 0.019 0.043 − 0.004
p (r-rand  r-obs)   0.264 0.009 0.950 0.713 0.447 0.988
p (r-obs  r-rand)   0.736 0.991 0.049 0.288 0.553 0.013
EUME_Larv
Males 19.2 (0.11)       
N   64 64 59 93 33 12
r   0.020 0.015 − 0.001 − 0.021 − 0.021 0.035
r lower 95% CI limit   − 0.013 − 0.026 − 0.047 − 0.052 − 0.075 − 0.066
r upper 95% CI limit   0.062 0.063 0.045 0.012 0.031 0.102
p (r-rand  r-obs)   0.157 0.210 0.514 0.910 0.779 0.214
p (r-obs  r-rand)   0.844 0.790 0.486 0.091 0.221 0.786
Females 30.9 (< 0.01)       
N   55 68 64 92 47 25
r   0.056 − 0.030 − 0.014 − 0.004 0.028 − 0.040
r lower 95% CI limit   0.016 − 0.074 − 0.042 − 0.040 − 0.015 − 0.098
r upper 95% CI limit   0.097 0.014 0.012 0.032 0.069 0.026
p (r-rand  r-obs)   0.006 0.950 0.771 0.625 0.098 0.919
p (r-obs  r-rand)   0.994 0.049 0.230 0.375 0.902 0.081
SGAL_Larv
Males 31.9 (< 0.01) 50 51 43 73 62 45
N   − 0.042 0.015 − 0.006 0.007 0.033 − 0.019
r   − 0.070 − 0.020 − 0.046 − 0.022 0.002 − 0.052
r lower 95% CI limit   − 0.015 0.047 0.037 0.037 0.065 0.015
r upper 95% CI limit   0.996 0.169 0.613 0.301 0.012 0.884
p (r-rand  r-obs)   0.004 0.831 0.387 0.699 0.988 0.116
p (r-obs  r-rand)        
Females 15.1 (0.24) 72 76 65 118 71 32
N   0.005 − 0.011 0.009 − 0.005 0.001 0.018
r   − 0.029 − 0.038 − 0.020 − 0.028 − 0.026 − 0.030
r lower 95% CI limit   0.035 0.017 0.038 0.018 0.028 0.073
r upper 95% CI limit   0.353 0.788 0.264 0.678 0.479 0.173
p (r-rand  r-obs)   0.647 0.212 0.736 0.322 0.521 0.827
p (r-obs  r-rand)   50 51 43 73 62 45

Appendix 9: Summary statistics of spatial autocorrelation analyses estimated and comparing males and females in each sampled pueriparous population

Summary statistics of spatial autocorrelation analyses comparing males and females in each sampled pueriparous population (INFA_Puer, BRAN_Puer, and VILL_Puer; see respective correlograms in Fig. 5). The Omega test value (ω) and respective p value (p) for each sampled locality is displayed. Significant ω values were declared when p < 0.01 (values in bold; Smouse et al. 2008). Remaining parameters were estimated for each of the six distance classes tested: 100 (0–100 m), 200 (101–200 m), 300 (201–300 m), 500 (301–500 m), 700 (501–700 m), and 1000 (701–1000 m). These parameters are: N (number of pairs of individuals analysed), r (autocorrelation coefficient) and respective lower (r lower 95% CI limit) and upper (r upper 95% CI limit) bounds of the 95% CIs. The p-values of one-tailed tests to determine if r values were significantly higher (p (r-rand  r-obs)) or lower (p (r-obs  r-rand)) than expected for a given distance class are also displayed, with significant p values (p < 0.05) in bold and underlined.

Data set and parameters ω (pω) 100 200 300 500 700 1000
INFA_Puer
Males 15.7 (0.22)       
N   107 105 83 86 63 48
r   0.006 0.006 − 0.008 0.003 − 0.013 − 0.006
r lower 95% CI limit   − 0.019 − 0.018 − 0.035 − 0.025 − 0.041 − 0.041
r upper 95% CI limit   0.030 0.031 0.019 0.032 0.017 0.027
p (r-rand  r-obs)   0.245 0.293 0.751 0.380 0.834 0.653
p (r-obs  r-rand)   0.755 0.707 0.250 0.620 0.166 0.347
Females 18.6 (0.12)       
N   88 86 66 93 40 27
r   0.013 − 0.019 − 0.003 0.011 − 0.006 0.003
r lower 95% CI limit   − 0.016 − 0.049 − 0.028 − 0.015 − 0.041 − 0.050
r upper 95% CI limit   0.040 0.011 0.021 0.036 0.034 0.056
p (r-rand  r-obs)   0.140 0.943 0.584 0.163 0.632 0.444
p (r-obs  r-rand)   0.860 0.058 0.416 0.837 0.369 0.556
BRAN_Puer        
Males 25.8 (0.02)       
N   71 84 72 117 65 26
r   − 0.028 0.001 0.035 − 0.010 − 0.004 0.029
r lower 95% CI limit   − 0.061 − 0.030 − 0.004 − 0.037 − 0.036 − 0.021
r upper 95% CI limit   0.009 0.032 0.072 0.019 0.029 0.081
p (r-rand  r-obs)   0.962 0.467 0.014 0.795 0.606 0.133
p (r-obs  r-rand)   0.038 0.533 0.987 0.205 0.394 0.867
Females 19.9 (0.14)       
N   84 92 92 127 74 27
r   − 0.002 − 0.023 0.013 0.003 0.011 − 0.004
r lower 95% CI limit   − 0.030 − 0.052 0.020 − 0.021 − 0.020 − 0.075
r upper 95% CI limit   0.026 0.005 0.045 0.030 0.043 0.070
p (r-rand  r-obs)   0.538 0.953 0.183 0.388 0.220 0.575
p (r-obs  r-rand)   0.462 0.047 0.817 0.612 0.780 0.425
VILL_Puer        
Males 16.5 (0.18)       
N   113 114 107 165 85 42
r   0.002 0.002 − 0.001 − 0.009 0.011 0.014
r lower 95% CI limit   − 0.018 − 0.018 − 0.021 − 0.027 − 0.017 − 0.021
r upper 95% CI limit   0.021 0.023 0.019 0.008 0.037 0.049
p (r-rand  r-obs)   0.414 0.414 0.542 0.895 0.173 0.184
p (r-obs  r-rand)   0.586 0.586 0.458 0.105 0.827 0.816
Females 17.9 (0.14)       
N   108 103 83 100 50 21
r   0.017 − 0.010 − 0.002 − 0.006 0.006 − 0.010
r lower 95% CI limit   − 0.007 − 0.031 − 0.029 − 0.028 − 0.031 − 0.063
r upper 95% CI limit   0.043 0.013 0.024 0.018 0.044 0.045
p (r-rand  r-obs)   0.057 0.843 0.583 0.703 0.360 0.674
p (r-obs  r-rand)   0.943 0.157 0.417 0.298 0.641 0.326

Appendix 10: Matrix of pairwise ωgroups values (below diagonal) and respective p values (above diagonal) between the compared subsamples

Matrix of pairwise ωgroups values (below diagonal) and respective p-values (above diagonal) between the compared subsamples (LM—larviparous males; LF—larviparous females; PM—pueriparous males; PF—pueriparous females) in the “combined correlograms” (see Figs. 3 and 4). These analyses aimed at testing both of our hypotheses (i.e. differences in fine-scale genetic structure between reproductive modes [LM versus PM and LF versus PF] and sexes [LM versus LF and PM versus PF]) at global level. Comparisons between males and females were performed only within reproductive mode (NA—not applicable). No pairwise comparison was significant (p < 0.01; Banks and Peakall 2012).

Subsample LM LF PM PF
LM 0 0.02 0.73 0.14
LF 30.00 0 NA 0.57
PM 12.19 NA 0 NA
PF NA 14.35 22.22 0

Appendix 11: Pairwise t2 values and respective p-values between the analysed subsamples

Pairwise t2 values and respective p-values (pt2) between the analysed subsamples (LM—larviparous males; LF—larviparous females; PM—pueriparous males; PF—pueriparous females) for the eight distance classes evaluated: 100 (0–100 m), 200 (101–200 m), 300 (201–300 m), 400 (301–400 m), 500 (401–500 m), 600 (501–600 m), 700 (601–700 m), and 1000 (701–1000 m). These analyses aimed at testing both of our hypotheses (i.e. differences in fine-scale genetic structure between reproductive modes [LM versus PM and LF versus PF] and sexes [LM versus LF and PM versus PF]) at distance class level. Significant pairwise comparisons (pt2< 0.01; Banks and Peakall 2012) are in bold and underlined.

Comparison 100 200 300 400 500 600 700 1000
Hypothesis 1
 LM vs. PM
  t2 1.22 0.53 0.12 0.53 0.01 0.20 2.12 0.30
  pt2 0.27 0.47 0.74 0.48 0.91 0.66 0.15 0.58
 LF vs. PF         
  t2 0.61 0.75 0.59 1.93 0.41 0.29 0.85 0.37
  pt2 0.43 0.39 0.45 0.17 0.52 0.59 0.36 0.55
Hypothesis 2
 LM vs. LF
  t2 7.03 1.37 0.35 1.51 0.83 2.33 3.20 0.72
  pt2 0.01 0.24 0.56 0.22 0.37 0.13 0.07 0.39
 PM vs. PF
  t2 1.53 3.38 0.09 0.98 0.04 2.76 2.70 0.37
  pt2 0.21 0.07 0.77 0.32 0.84 0.10 0.10 0.55

Appendix 12: Matrix of pairwise ωgroups values (below diagonal) and respective p values (above diagonal) between males sampled from different sampled localities

Matrix of pairwise ωgroups values (below diagonal) and respective p-values (above diagonal) between males sampled from different sampled localities. These analyses aimed at testing if males from pairs of populations exhibiting the same or different (italics) reproductive modes showed significant differences in fine-scale genetic structure at global level. No pairwise comparison was significant (p < 0.01; Banks and Peakall 2012).

population PEGA_Larv EUME_Larv SGAL_Larv INFA_Puer BRAN_Puer VILL_Puer
PEGA_Larv 0 0.18 0.74 0.56 0.75 0.49
EUME_Larv 16.29 0 0.04 0.78 0.30 0.83
SGAL_Larv 8.56 21.96 0 0.28 0.16 0.39
INFA_Puer 10.69 8.09 14.29 0 0.19 0.85
BRAN_Puer 8.43 14.13 16.80 16.01 0 0.54
VILL_Puer 11.37 7.38 12.81 7.17 10.87 0

Appendix 13: Matrix of pairwise ωgroups values (below diagonal) and respective p values (above diagonal) between females sampled from different sampled localities

Matrix of pairwise ωgroups values (below diagonal) and respective p-values (above diagonal) between females sampled from different sampled localities. These analyses aimed at testing if females from pairs of populations exhibiting the same or different (italics) reproductive modes showed significant differences in fine-scale genetic structure at global level. No pairwise comparison was significant (p < 0.01; Banks and Peakall 2012).

Population PEGA_Larv EUME_Larv SGAL_Larv INFA_Puer BRAN_Puer VILL_Puer
PEGA_Larv 0 0.09 0.31 0.23 0.16 0.54
EUME_Larv 18.96 0 0.14 0.28 0.20 0.50
SGAL_Larv 13.84 17.22 0 0.95 0.96 0.98
INFA_Puer 15.18 14.33 5.22 0 0.93 0.98
BRAN_Puer 16.56 15.83 4.82 5.77 0 0.86
VILL_Puer 10.86 11.28 4.05 4.23 6.84 0

Appendix 14: Matrices of pairwise t 2 values (below diagonal) and respective p values (above diagonal) between males from different sampled localities

Matrices of pairwise t2 values (below diagonal) and respective p-values (above diagonal) between males from different sampled localities. These analyses aimed at testing if males from populations exhibiting the same or different (italics) reproductive modes showed significant differences in fine-scale genetic structure at distance class level. Six distance classes were evaluated: 100 (0–100 m), 200 (101–200 m), 300 (201-300 m), 500 (301–500 m), 700 (501–700 m), and 1000 (701–1000 m). No pairwise comparison was significant (pt2< 0.01; Banks and Peakall 2012).

Population PEGA_Larv EUME_Larv SGAL_Larv INFA_Puer BRAN_Puer VILL_Puer
100 m
 PEGA_Larv 0 0.02 0.76 0.04 0.75 0.07
 EUME_Larv 5.66 0 0.01 0.55 0.04 0.45
 SGAL_Larv 0.09 6.39 0 0.04 0.55 0.07
 INFA_Puer 4.17 0.36 4.29 0 0.09 0.79
 BRAN_Puer 0.11 4.15 0.36 2.86 0 0.15
 VILL_Puer 3.16 0.58 3.17 0.07 2.05 0
200 m
 PEGA_Larv 0 0.83 0.84 0.83 0.67 0.70
 EUME_Larv 0.04 0 1.00 0.68 0.53 0.58
 SGAL_Larv 0.04 0.00 0 0.70 0.57 0.60
 INFA_Puer 0.05 0.17 0.15 0 0.82 0.83
 BRAN_Puer 0.18 0.37 0.32 0.05 0 0.97
 VILL_Puer 0.16 0.31 0.27 0.04 0.00 0
300 m
 PEGA_Larv 0 0.83 0.84 0.83 0.67 0.70
 EUME_Larv 0.04 0 1.00 0.68 0.53 0.58
 SGAL_Larv 0.04 0.00 0 0.70 0.57 0.60
 INFA_Puer 0.05 0.17 0.15 0 0.82 0.83
 BRAN_Puer 0.18 0.37 0.32 0.05 0 0.97
 VILL_Puer 0.16 0.31 0.27 0.04 0.00 0
500 m
 PEGA_Larv 0 0.69 0.59 0.46 0.27 0.66
 EUME_Larv 0.16 0 0.85 0.76 0.14 1.00
 SGAL_Larv 0.29 0.03 0 0.93 0.12 0.86
 INFA_Puer 0.57 0.10 0.01 0 0.05 0.72
 BRAN_Puer 1.23 2.22 2.34 3.90 0 0.10
 VILL_Puer 0.19 0.00 0.03 0.13 2.76 0
700 m
 PEGA_Larv 0 0.11 0.83 0.69 0.25 0.25
 EUME_Larv 2.56 0 0.19 0.26 0.58 0.60
 SGAL_Larv 0.04 1.74 0 0.87 0.42 0.46
 INFA_Puer 0.16 1.27 0.02 0 0.48 0.47
 BRAN_Puer 1.33 0.31 0.65 0.48 0 0.99
 VILL_Puer 1.34 0.28 0.56 0.51 0.00 0
1000 m
 PEGA_Larv 0 0.53 0.12 0.66 0.96 0.52
 EUME_Larv 0.40 0 0.05 0.77 0.54 0.26
 SGAL_Larv 2.41 3.85 0 0.06 0.11 0.36
 INFA_Puer 0.18 0.08 3.71 0 0.70 0.27
 BRAN_Puer 0.00 0.37 2.62 0.15 0 0.49
 VILL_Puer 0.40 1.24 0.87 1.20 0.47 0

Appendix 15: Matrices of pairwise t2 values (below diagonal) and respective p values (above diagonal) between females from different sampled localities

Matrices of pairwise t2 values (below diagonal) and respective p-values (above diagonal) between females from different sampled localities. These analyses aimed at testing if females from populations exhibiting the same or different (italics) reproductive modes showed significant differences in fine-scale genetic structure at distance class level. Six distance classes were evaluated: 100 (0–100 m), 200 (101–200 m), 300 (201–300 m), 500 (301–500 m), 700 (501–700 m), and 1000 (701–1000 m). Significant t2 tests are in bold and underlined (pt2< 0.01; Banks and Peakall 2012).

Population PEGA_Larv EUME_Larv SGAL_Larv INFA_Puer BRAN_Puer VILL_Puer
100 m
 PEGA_Larv 0 0.05 0.92 0.82 0.68 0.68
 EUME_Larv 3.95 0 0.03 0.06 0.01 0.08
 SGAL_Larv 0.01 4.65 0 0.71 0.74 0.55
 INFA_Puer 0.05 3.68 0.14 0 0.46 0.82
 BRAN_Puer 0.16 6.18 0.11 0.52 0 0.32
 VILL_Puer 0.17 3.13 0.36 0.05 1.00 0
200 m
 PEGA_Larv 0 ≤  0.01 0.06 0.02 0.02 0.05
 EUME_Larv 6.95 0 0.42 0.62 0.77 0.38
 SGAL_Larv 3.70 0.66 0 0.71 0.56 0.98
 INFA_Puer 5.37 0.25 0.14 0 0.82 0.68
 BRAN_Puer 5.73 0.08 0.34 0.05 0 0.51
 VILL_Puer 3.90 0.77 0.00 0.17 0.43 0
300 m
 PEGA_Larv 0 0.59 0.18 0.34 0.13 0.34
 EUME_Larv 0.29 0 0.33 0.63 0.23 0.61
 SGAL_Larv 1.77 0.96 0 0.61 0.87 0.60
 INFA_Puer 0.89 0.24 0.26 0 0.47 0.99
 BRAN_Puer 2.25 1.43 0.03 0.51 0 0.45
 VILL_Puer 0.92 0.27 0.27 0.00 0.57 0
500 m
 PEGA_Larv 0 0.94 0.96 0.46 0.68 1.00
 EUME_Larv 0.01 0 0.98 0.48 0.70 0.93
 SGAL_Larv 0.00 0.00 0 0.43 0.65 0.95
 INFA_Puer 0.57 0.51 0.63 0 0.70 0.41
 BRAN_Puer 0.18 0.14 0.20 0.14 0 0.62
 VILL_Puer 0.00 0.01 0.00 0.68 0.25 0
700 m
 PEGA_Larv 0 0.38 0.96 0.79 0.74 0.91
 EUME_Larv 0.80 0 0.29 0.25 0.52 0.42
 SGAL_Larv 0.00 1.12 0 0.80 0.64 0.85
 INFA_Puer 0.07 1.36 0.06 0 0.52 0.70
 BRAN_Puer 0.11 0.40 0.23 0.43 0 0.81
 VILL_Puer 0.01 0.65 0.04 0.16 0.06 0
1000 m
 PEGA_Larv 0 0.84 0.12 0.24 0.32 0.41
 EUME_Larv 0.04 0 0.15 0.30 0.40 0.51
 SGAL_Larv 2.45 2.06 0 0.70 0.59 0.50
 INFA_Puer 1.38 1.04 0.15 0 0.87 0.77
 BRAN_Puer 1.00 0.73 0.30 0.03 0 0.88
 VILL_Puer 0.67 0.43 0.45 0.09 0.02 0

Appendix 16: Results of heterogeneity t 2 tests, as well as respective p values, between males and females in each sampled locality

Results of heterogeneity t2 tests, as well as respective p-values, between males and females in each sampled locality. These tests aimed at examining differences in fine-scale genetic structure between sexes in each sampled locality at global and distance class levels. A total of six distance classes were evaluated: 100 (0–100 m), 200 (101–200 m), 300 (201–300 m), 500 (301–500 m), 700 (501–700 m), and 1000 (701–1000 m). No significant differences in genetic structure were found (pt2< 0.01; Banks and Peakall 2012).

Pop (males vs. females) 100 200 300 500 700 1000
PEGA_Larv       
t2 (pt2) 3.48 (0.06) 1.56 (0.21) 2.12 (0.15) 0.80 (0.37) 0.05 (0.81) 2.47 (0.12)
EUME_Larv       
t2 (pt2) 1.44 (0.23) 1.84 (0.17) 0.20 (0.65) 0.42 (0.52) 1.99 (0.16) 1.94 (0.17)
SGAL_Larv       
t2 (p) 3.99 (0.04) 1.22 (0.27) 0.35 (0.55) 0.33 (0.56) 2.17 (0.14) 1.46 (0.23)
INFA_Puer       
t2 (pt2) 0.11 (0.75) 1.60 (0.21) 0.08 (0.77) 0.14 (0.71) 0.09 (0.77) 0.08 (0.77)
BRAN_Puer       
t2 (pt2) 1.30 (0.25) 1.26 (0.26) 0.88 (0.35) 0.47 (0.50) 0.46 (0.49) 0.48 (0.49)
VILL_Puer       
t2 (p) 0.84 (0.36) 0.57 (0.46) 0.01 (0.93) 0.05 (0.81) 0.05 (0.83) 0.56 (0.45)

Rights and permissions

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

Lourenço, A., Antunes, B., Wang, I.J. et al. Fine-scale genetic structure in a salamander with two reproductive modes: Does reproductive mode affect dispersal?. Evol Ecol 32, 699–732 (2018). https://doi.org/10.1007/s10682-018-9957-0

Download citation

Keywords

  • Dispersal
  • Larviparity
  • Pueriparity
  • Transition in reproductive mode
  • Salamandra salamandra
  • Spatial autocorrelation