Advertisement

Euphytica

, 214:52 | Cite as

Characterization, fine mapping and candidate gene analysis of novel, dominant, nuclear male-sterile gene Ms53 in maize

  • Chaoxian Liu
  • Guoqiang Wang
  • Jie Gao
  • Chunyan Li
  • Ziru Zhang
  • Tingting Yu
  • Jiuguang Wang
  • Lian Zhou
  • Yilin Cai
Article
  • 221 Downloads

Abstract

To better understand the molecular mechanism of stamen formation in maize, we used chemical agent ethyl methanesulfonate (EMS) to treat B73 pollens and obtained a Ms53 mutant with no pollen shedding from maize anthers. Ms53 is a completely male-sterile mutant controlled by a single dominant gene; thus, it cannot propagate itself. Microscopic analysis suggested that mutant anthers are smaller in size and lack trichomes on the epidermis surface. Histological analyses revealed that mutant anther abortion occurs at the microspore development stage. Using 1864 individuals from a backcross population derived from Ms53× Mo17, we delimited Ms53 to an interval of approximately 350 kb containing seven annotated genes and flanked by simple repeat sequence (SSR) molecular markers AC196708-4 and AC233922-1. Sequencing analysis of candidate genes from Ms53 and B73 revealed that the 288th amino acid of a SBP-box transcription factor is substituted from glycine to serine and probably leads to the mutant phenotype. These studies will pave the way for elucidating the molecular mechanisms underlying anther development.

Keywords

Male-sterile mutant Ms53 Fine mapping SBP-box gene 

Introduction

Male sterility is a ubiquitous phenomenon in higher plants that prevents the formation of functional pollens but maintains female fertility. The ability to control male reproductive development is extremely important in maize hybrid seed production and breeding. Long-term selection in commercial maize breeding has led to smaller sized tassels and lower pollen production (Wang et al. 2013). Moreover, the propagation and spread of transgenic plants has raised a major concern regarding the possible ecological impact of transgenic crop plants (Ma 2005). Therefore, understanding the molecular mechanism underlying maize stamen development is of great importance.

Many male-sterile mutants in which female fertility is usually unperturbed have been identified in maize. These mutants provide valuable materials for elucidating the molecular mechanisms of maize anther and pollen development. Male sterility is typically divided into the following classes: cytoplasmic male sterility (CMS) and nuclear male sterility (NMS) (Zhang et al. 2015). CMS, caused by incompatibility between cytoplasmic and nuclear gene products (Feng et al. 2015), is one of the most interesting and heavily researched topics because it is extensively used in commercial hybrid production. CMS in maize is divided into the following types: T-type CMS, C-type CMS and S-type CMS (Sofi et al. 2007). T-type CMS can be fully restored by dominant genes Rf-1 and Rf-2 (Wise et al. 1996), S-type CMS by Rf-3 (Zabala et al. 1997), and C-type CMS by Rf-4 (Kheyr-Pour et al. 1981). CMS technology is restricted to certain germplasms and may result in poor sterility stability in inbreds or poor fertility restoration in hybrids (Fox et al. 2017); thus, NMS genes are promising for hybrid seed production (Li et al. 2007; Zhang et al. 2013).

NMS has been reported in many species of higher plants (Figueroa and Browse 2015; Shukla et al. 2014; Sinha and Rajam 2013; Woo et al. 2008). In maize, over 40 NMS loci affecting nearly all stages of anther development have been identified (Skibbe and Schnable 2005). Currently, only a few genes have been studied in detail. In maize, the anther contains four anther lobes, and each contains the following somatic layers: the epidermis, endothecium, middle layer and tapetum. Most cloned male-sterile genes are implicated in anther wall layer development. For example, Ms32 encodes a helix-loop-helix (HLH) transcription factor that regulates cell division and differentiation of the tapetal and middle layers. In loss-of-function Ms32 mutants, the tapetal precursor cells cannot differentiate normally and instead form extra layers of cells that lead to failure in pollen mother cell development (Moon et al. 2013). Ms23 shares similar phenotypes with Ms32 and encodes an anther-specific HLH transcription factor required for tapetum differentiation (Nan et al. 2017). Additionally, Msca1 and Mac1 are two male-sterile mutants that have been characterized in detail; their anther walls develop abnormally. In Msca1 mutants, the cell division and differentiation of the four-layered anther wall are seriously affected, and as a consequence, structures containing parenchymal cells and ectopic, nonfunctional vascular strands are formed (Chaubal et al. 2003). By contrast, in Mac1 anthers, the primary parietal layer usually fails to divide periclinally; thus, the three wall layers cannot form normally, while archesporial cells divide excessively, and most fail to form microsporocytes (Sheridan et al. 1999). Ms8 putatively encodes a β-1, 3-galactosyltransferase, and Ms8 mutant anthers exhibit an excess number of epidermal cells and fewer tapetum cells (Wang et al. 2013). Additionally, some NMS genes control protein secretion from the tapetum into its encircling tissues. Ms44 is a newly identified gene specifically expressed in the tapetum; this gene encodes a lipid transfer protein that controls male sterility with a dominant phenotype. Mutation of Ms44 impedes the secretion of protein from tapetal cells into the locule and ultimately results in male sterility (Fox et al. 2017).

In this study, we report a newly identified, dominant male-sterile mutant, Ms53, and characterization of its phenotypes. Using a BC2 segregation population, the mutant gene was fine mapped at an interval of approximately 305 kb. We found that the SBP-box gene located in this physical region harbors an SNP substitution (G to A) that causes an amino acid change from glycine to serine at amino acid 288. These results will pave the way for identification of the candidate genes involved in anther development in maize.

Materials and methods

Obtaining the Ms53 mutant and constructing the backcross segregation population

Inbred lines B73 and Mo17 were planted in an experimental field of Southwest University, Chongqing, China in 2013. B73 pollens were collected and treated by chemical agent EMS diluted with paraffin oil (the final concentration of EMS: 0.67 ml/L) for 45 min and then directly cross-pollinated with Mo17. Approximately 12,000 M1 plants were planted in 2014, and among these individuals, we found only one mutant, Ms53, which exhibited no pollen shedding. In the offspring of M1 individuals, we also found many recessive mutants related to maize kernel, leaf, glume, and sex development. We used Ms53 as the maternal parent pollinated with Mo17 to produce backcross population BC1. The BC1 population, which was planted at Yuanjiang County, Yunnan province in 2014, was used for genetic analysis and mutant gene preliminary mapping. Fifteen male-sterile plants in the BC1 population were continuously backcrossed to Mo17 to generate the BC2 population for Ms53 fine mapping.

Morphological analysis

Approximately 3-mm immature anthers were dissected from Ms53 mutants and wild-type plants for histological observation, immediately fixed in FAA (50% ethanol, 0.9 M glacial acetic acid, and 3.7% formaldehyde) at 4 °C overnight, and dehydrated by a graded ethanol series. Samples were then infiltrated with a graded ethanol-xylene series and embedded in paraffin (Sigma). Ten-μm-thick paraffin sections were transferred to slide glasses and baked at 42 °C for 48 h. After deparaffinization and dehydration, the sections were stained by 1% safranine and Fast Green (Amresco). Finally, the sections were mounted and observed under a Nikon E600.

For scanning electron microscopy (SEM) analysis, the mature anthers of Ms53 and wild-type plants from the BC1 segregating population were dissected and immediately examined under a scanning electron microscope (SU3500, Hitachi) to observe the morphological differences between Ms53 and normal plants.

Polymorphism SSR marker screening

SSR markers covering the whole maize genome were downloaded from MaizeGDB (http://www.maizegdb.org/), and polymorphic markers between B73 and Mo17 were screened by polyacrylamide gel electrophoresis (PGE). To screen linkage markers of Ms53, we used bulk-segregant analysis (BSA). Male-sterile and male-fertile DNA pools were constructed using ten male-sterile plants and male-fertile plants, respectively, from the BC1 population by equally mixing DNA. In addition, polymorphic markers between B73 and Mo17 were used for detecting polymorphisms of the polymerase chain reaction (PCR) products between the two DNA pools.

SSR marker development and gene prediction

Development of more SSR markers is needed in the vicinity of the target DNA region for fine mapping of Ms53. Maize genomic DNA sequences were downloaded from Gramene (http://www.gramene.org/) and used for developing SSRs through SSRHunter (Li and Wan 2005). The single copy SSRs identified through blasting against the maize Unfinished High Throughput Genomic Sequences (HTGS) database were used as a template for designing primers with Primer-blast (http://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi?LINK_LOC=BlastHome). In addition, we determined whether the newly developed markers were polymorphic between B73 and Mo17 by PGE. Gene prediction was completed by web-based online software FGENESH (Solovyev et al. 2006).

Phylogenetic tree construction of SBP-box transcription factors in maize, rice and Arabidopsis

All the protein sequences of SBP-box transcription factors in maize, rice and Arabidopsis were downloaded from the Plant Transcription Factor Database (Jin et al. 2014) and imported into MEGA6 for phylogenetic tree construction (Tamura et al. 2013). Multiple sequence alignment was performed using CLUSTALW with default settings within MEGA6 (Higgins et al. 1996) and subsequently used to construct a neighbor-joining phylogenetic tree with 1000 bootstrap replications (Saitou and Nei 1987).

Results

Characterization and genetic analysis of Ms53

The mutant phenotype was revealed when Ms53 plants grew during the M1 stage. Wild-type plants produced a large quantity of pollens that normally shed from anthers (Fig. 1a), but Ms53 mutant plants could not (Fig. 1b). At the M1 stage, the Ms53 mutant was crossed to Mo17 to generate a BC1 segregation population for analyzing the genetic pattern of Ms53. In total, 113 male-sterile and 107 male-fertile individuals were observed in the BC1 segregation population (Table 1); these numbers fit the expected segregation ratio 1:1 (χ2 = 0.16 < \(x_{0.05}^{2}\) = 3.84). Based on these results, the Ms53 mutant is controlled by a single dominant gene.
Fig. 1

The morphological characteristics of wild-type and Ms53 mutant plants. a , b: normal and Ms53 mutant plant tassels. c, d: spikelet observation of normal and Ms53 mutant plants under a stereoscope. e, f, g, h: anther morphological observation of normal and Ms53 mutant plants under a stereoscope and SEM. i, j: morphological analysis of approximately 3-mm anthers from normal and Ms53 mutant plants by paraffin section. AW: anther wall, MSP: microspore

Table 1

Segregation of wild type and Ms53 plants in BC1 segregation population

Cross

M1 Phenotype

BC1

Total

χ2

Wild type

Ms53

M1 × Mo17

Mutant type

107

113

220

0.16

To further characterize the Ms53 phenotype, we conducted a series of morphological analyses. Compared with wild-type anthers, Ms53 anthers were smaller in size and exhibited a shrunken phenotype (Fig. 1c, d, e, f). Morphological observation using SEM indicated that the epidermis cells of Ms53 anthers were relatively smooth due to a lack of trichomes (Fig. 1g, h). To deeply investigate the stage of pollen abortion, we prepared paraffin sections of approximately 3-mm maize anthers. As Fig. 1i shows, wild-type anthers normally formed microspores arranged in one whorl, whereas Ms53 mutant anthers had no microspores, and the anther wall of mutant plants was thicker than that of normal plants (Fig. 1j), which suggested that anther abortion occurs at the microspore stage.

SSR marker screening linked to Ms53 and preliminary mapping

To map Ms53, we identified 431 polymorphic SSR markers between B73 and Mo17. The number of molecular markers distributed on ten chromosomes ranged from 34 to 57, with an average of 43 SSR markers on each chromosome (Table S1). Using these markers to screen male-sterile and male-fertile DNA pools, we detected polymorphic PCR products amplified by SSR marker ZAG589 (Fig. 2a); thus, ZAG589 located at bin 4.10 on maize chromosome 4 is probably linked to Ms53. In addition, we used ZAG589 to detect the genotypes of ten Ms53 mutant and ten wild-type plants (Fig. 2b). The genotypes of these plants were consistent with their phenotypes except three plants because of chromosome recombination, which further confirmed that ZAG589 is linked to Ms53. New SSR markers in the vicinity of the location of ZAG589 were developed according to B73 reference genome RefGen_v4 and used for Ms53 preliminary mapping (Table 2). Finally, using 220 individuals from the BC1 population, we mapped Ms53 at an interval of approximately 1.07 Mb flanked by SSR markers AC196269-3 and AC204715-3, which detected seven and three recombinants, respectively (Fig. 3a).
Fig. 2

Linkage SSR marker screening and confirmation a The polymorphic PCR products amplified by ZAG589 between male-fertile and male-sterile DNA pools, which suggests that ZAG589 is linked to Ms53. b Confirmation of linkage SSR marker ZAG589 by genotyping ten Ms53 mutant and ten wild-type plants FP: male-fertile DNA pool, SP: male-sterile DNA pool

Table 2

Primer sequences for Ms53 mapping and candidate gene cloning

Symbol of Primers

Forward primer (listed 5′ to 3′)

Reverse primer (listed 5′ to 3′)

Length of PCR products (bp)

ZAG589

GGGTCGTTTAGGGAGGCACCTTTGGT

GCGACAGACAGACAGACAAGCGCATTGT

115

AC196269-3

ACTACAGAGTACAGACACGCTG

CAAGTCCGTCAAGTATGCCTTC

177

AC191405-4

ACCGAATGCACATCTTCGTACT

CTGGCCATTATGTTTGACGCTT

208

AC196708-4

AAGCCTGAACTCAGGATCATCG

TCACATTTGCACGTTCTTGAGC

300

AC233922-1

GAGATACTGAAACAGGCACCGT

CTGTTGTGTTCTCGATGCCCTA

207

AC204715-3

GGTTAGGCAAGACTTCAGTGGA

GAGGTTGTACACGGTGCACTT

198

AC191360-3

CGCGCGCTGATGCTAGATTG

CTCCTGCCGACCCACTACAAAT

179

SBP cDNA

AGGAGCAGCAGCTCAGATTTC

GCGTCACAAAACCGTGGATTAT

1745

Fig. 3

Fine mapping of Ms53. a Preliminary mapping of Ms53 using the BC1 population including 220 individuals. Ms53 was mapped to a region of approximately 1.07 Mb flanked by AC196269-3 and AC204715-3. b Fine mapping of Ms53 using the BC2 population including 1644 individuals. Ms53 was mapped to an interval of approximately 350 kb flanked by AC196708-4 and AC233922-1. The numbers between SSR markers represent physical distance. The numbers under SSR markers represent recombination events

Fine mapping of Ms53 and gene prediction and annotation of the mapping region

To further map mutant gene Ms53, we used a larger BC2 population including 1644 individuals to screen recombinants at the loci of AC196269-3 and AC204715-3. A total of 40 and 20 recombinants at AC196269-3 and AC204715-3 were screened, respectively (Fig. 3b). SSR markers AC191405-4, AC196708-4 and AC233922-1 were further developed and used for detecting the genotypes of recombinants; 30, 11 and 2 recombinants were detected at each locus, respectively. In addition, Ms53 was delimited at a region of approximately 350 kb flanked by AC196708-4 and AC233922-1.

Gene prediction and annotation was performed. The genomic DNA sequence of 350 kb harbored seven annotated genes (Table 3). These annotated genes encode molybdopterin biosynthesis MoaE family protein, SBP transcription factor, putative HLH DNA-binding domain superfamily protein, trehalose-6-phosphate synthase, ubiquitin-conjugating enzyme 29, putative ROP family GTPase ROP2 and methyltransferases.
Table 3

The genes annotated in the fine mapping interval

Gene ID

Location

Annotation

GRMZM2G165966

4:238255268-238256301

Molybdopterin biosynthesis MoaE family protein

GRMZM2G065451

4:238318275-238321628

SBP transcription factor

GRMZM2G139372

4:238494709-238498244

Putative HLH DNA-binding domain superfamily protein

GRMZM2G123511

4:238549714-238552179

Trehalose-6-phosphate synthase

AC233922.1_FG008

4:238584691-238585814

Ubiquitin-conjugating enzyme 29

GRMZM5G846811

4:238592881-238596701

Putative ROP family GTPase ROP2A

GRMZM2G090156

4:238707295-238712177

Methyltransferases

The SBP-box transcription factor containing a single mutation is the potential candidate gene leading to male sterility

A total of seven annotated genes within the mapping region were predicted, cloned and sequenced. We found a nucleotide substitution, G to A, that occurs at the 862nd base of CDS and the 102nd base of the 3rd exon in the genomic DNA sequence of SBP transcription factor (GRMZM2G065451) (Figs. 4, 5). This substitution results in the amino acid substitution of Gly288 for Ser. SPL8 (AT1G02065), a SBP transcription factor in Arabidopsis, can affect pollen sac development, and its loss of function results in a semi-sterile phenotype (Unte et al. 2003; Xing et al. 2013), which suggests that GRMZM2G065451 is the candidate gene of Ms53 and that amino acid Gly288 is critical for its function.
Fig. 4

The mutation position in the coding sequence of GRMZM2G065451. The light blue and green rectangles represent the initiation and stop codons of the SBP-box gene, respectively. The red rectangle indicates the position (862nd) of the single base substitution from G–A. The amino acid is substituted from glycine (G) to serine (S). (Color figure online)

Fig. 5

The gene structure and location of the point mutation in GRMZM2G065451. The black rectangle and black arrow represent the exon (E1–E4) and promoter of the SBP-box gene, respectively

Molecular evolution analysis of SBP-box genes in maize, rice and Arabidopsis

Elucidating the phylogenetic relationships of the SBP-box gene family in maize, rice and Arabidopsis is a very useful step for revealing the evolutionary and functional divergence of these genes, which provides important clues for studying gene function. A number of sequences of SBP-box transcription factors encoded by one gene due to alternative transcript splicing were found in the original downloaded sequences from PlantTFDB (Jin et al. 2014). Since these protein sequences share the same sequences and are always close in molecular evolution, only one representative protein sequence was reserved for further analysis. In total, 17, 19 and 30 SBP-box transcription factors from Arabidopsis, rice and maize, respectively, were used for a constructing phylogenetic tree (Table S2). We divided the SBP-box proteins into ten groups, and our candidate gene SBP-box transcription factor (GRMZM2G065451) closely clustered with three SBP-box proteins (AT1G27360, AT1G27370, and AT5G43270) in Arabidopsis, two in rice (Os06g49010 and Os02g04680), and one in maize (GRMZM2G097275) in clade I (CI), Group I (Fig. 6), which suggested that these proteins share the same origin and have similar functions in plant development. GRMZM2G065451 has a weak relationship with SPL8 (AT1G02065, indicated by a yellow pentagram), which suggests functional divergence in their molecular evolution history.
Fig. 6

The molecular evolution analysis of SBP transcription factors in Arabidopsis, rice and maize. The phylogenetic tree was divided into ten groups (Group I–X), and Group I contained the following clades: CI and CII. The yellow and red pentagrams represent the SBP transcription factors GRMZM2G065451 in maize and AT1G02065 (SPL8) in Arabidopsis, respectively

Discussion

Generally, NMS mutants are controlled by recessive genes, but a few are controlled by dominant genes, such as Ms44 (Fox et al. 2017). In this study, we isolated a new male-sterile mutant, Ms53, with smaller sized anthers. Genetic analysis revealed that Ms53 is controlled by a dominant gene. Phenotypic characterization revealed that anther abortion occurs at the stage of microspore development, and the anther wall is greatly affected in the Ms53 mutant. Microsporocytes undergo meiosis to form microspores, which give rise to mature pollen after mitosis in anthers (McCormick 2004). The formation of microspores relies on the interaction of microsporocytes with several types of somatic anther walls, including tapetal cells (Ma et al. 2008). The genes involved in this process in any tissues or stages probably result in male sterility. Many genes, such as Ms1, RPG, and FLA3 in Arabidopsis and Ms32 and Ms23 in maize, are involved in this process (Ito and Shinozaki 2002; Guan et al. 2008; Li et al. 2010; Moon et al. 2013; Nan et al. 2017).

We used a map-based cloning strategy for narrowing the locus to a DNA region containing seven annotated genes on maize chromosome 4. Sequencing analysis revealed that the SBP-box gene (GRMZM2G065451) is probably the gene controlling the Ms53 phenotype. A nucleotide substitution of G for A occurs in the 862nd base of the coding sequence of the SBP-box transcription factor, which results in the amino acid substitution of Gly288 for Ser. SBP-box genes are ubiquitously found in the plant kingdom and considered important regulators in plant development (Salinas et al. 2012). The SBP-box transcription factor family comprises numerous members, such as 17 SBP-box genes in Arabidopsis, 19 in rice and 31 in maize (Xie et al. 2006; Yang et al. 2008; Zhang et al. 2016). These genes play critical roles in regulating sporogenesis and flowering as well as other physiological processes (Unte et al. 2003; Gandikota et al. 2007; Chuck et al. 2014). Loss-of-function mutation of SPL8 in Arabidopsis affects pollen sac development and leads to a semi-sterile phenotype; microscopic analysis indicates that the reduced fertility is primarily attributable to abnormally developed microsporangia (Unte et al. 2003; Xing et al. 2010). In this study, molecular evolutionary genetics analysis revealed that SPL8 (yellow pentagram) and GRMZM2G065451 (red pentagram) belong to different groups (Fig. 6), and coding sequence alignment indicated that there is only 28.94% identity between SPL8 and GRMZM2G065451 (Fig. S1), which suggested that the functional difference in these two genes occurred in evolutionary history. The genetic pattern of these two genes also confirmed this point.

Maize is one of the most important crops in the world. In its commercial breeding, emasculating male flowers is a key step for producing high-purity hybrid seed. However, detasseling, a labor -intensive and time-consuming process, greatly increases production cost, reduces hybrid seed yield and damages the environment (Chen and Liu 2014; Wang et al. 2015). Male sterility provides a crucial breeding tool for resolving this problem. The CMS system has been widely used in hybrid breeding in field crops (Saxena and Hingane 2015; Bohra et al. 2016). However, in maize, high susceptibility to fungal pathogens and the instability of sterility and fertility restoration in certain environments have hindered its application (Wise et al. 1999; Fox et al. 2017). Nonetheless, NMS is quite stable in different environments and germplasms, and some NMS systems have been well developed for maize hybrid production (Unger et al. 2002; Wu et al. 2016; Zhang et al. 2017). This study on M53 will pave the way for elucidating the molecular mechanisms underlying maize anther development and for its use in maize commercial hybrid seed production.

Notes

Acknowledgements

This study was supported by a China Postdoctoral Science Foundation funded project (2014M552303), Fundamental Research Funds for the Central Universities (XDJK2015B009), Technology Integration and Demonstration of Zhongkeyu 9699 and Xidabainuo No.1 (cstc2015jcsf-nycgzhA80006) and the China Scholarship Council.

Compliance with ethical standards

Conflicts of interest

The authors declare no conflicts of interest.

Supplementary material

10681_2018_2132_MOESM1_ESM.docx (45 kb)
Supplementary material 1 (DOCX 44 kb)
10681_2018_2132_MOESM2_ESM.docx (112 kb)
Supplementary material 2 (DOCX 111 kb)

References

  1. Bohra A, Jha UC, Adhimoolam P, Bisht D, Singh NP (2016) Cytoplasmic male sterility (CMS) in hybrid breeding in field crops. Plant Cell Rep 35:967–993CrossRefPubMedGoogle Scholar
  2. Chaubal R, Anderson JR, Trimnell MR, Fox TW, Albertsen MC, Bedinger P (2003) The transformation of anthers in the msca1 mutant of maize. Planta 216(5):778–788PubMedGoogle Scholar
  3. Chen L, Liu YG (2014) Male sterility and fertility restoration in crops. Annu Rev Plant Biol 65:579–606CrossRefPubMedGoogle Scholar
  4. Chuck GS, Brown PJ, Meeley R, Hake S (2014) Maize SBP-box transcription factors unbranched2 and unbranched3 affect yield traits by regulating the rate of lateral primordia initiation. Proc Natl Acad Sci 111(52):18775–18780CrossRefPubMedPubMedCentralGoogle Scholar
  5. Feng Y, Zheng Q, Song H, Wang Y, Wang H, Jiang L, Yan J, Zheng Y, Yue B (2015) Multiple loci not only Rf3 involved in the restoration ability of pollen fertility, anther exsertion and pollen shedding to S type cytoplasmic male sterile in maize. Theoretical and Applied Genetics 128(11):2341–2350CrossRefPubMedGoogle Scholar
  6. Figueroa P, Browse J (2015) Male sterility in Arabidopsis induced by overexpression of a MYC5-SRDX chimeric repressor. Plant J 81(6):849–860CrossRefPubMedGoogle Scholar
  7. Fox T, DeBruin J, Haug Collet K, Trimnell M, Clapp J, Leonard A, Li B, Scolaro E, Collinson S, Glassman K, Miller M, Schussler J, Dolan D, Liu L, Gho C, Albertsen M, Loussaert D, Shen B (2017) A single point mutation in Ms44 results in dominant male sterility and improves nitrogen use efficiency in maize. Plant Biotechnol J 15(8):942–952CrossRefPubMedPubMedCentralGoogle Scholar
  8. Gandikota M, Birkenbihl RP, Höhmann S, Cardon GH, Saedler H, Huijser P (2007) The miRNA156/157 recognition element in the 3′ UTR of the Arabidopsis SBP box gene SPL3 prevents early flowering by translational inhibition in seedlings. Plant J 49(4):683–693CrossRefPubMedGoogle Scholar
  9. Guan YF, Huang XY, Zhu J, Gao JF, Zhang HX, Yang ZN (2008) RUPTURED POLLEN GRAIN1, a member of the MtN3/saliva gene family, is crucial for exine pattern formation and cell integrity of microspores in Arabidopsis. Plant Physiol 147(2):852–863CrossRefPubMedPubMedCentralGoogle Scholar
  10. Higgins DG, Thompson JD, Gibson TJ (1996) Using CLUSTAL for multiple sequence alignments. Methods Enzymol 266(1):383CrossRefPubMedGoogle Scholar
  11. Ito T, Shinozaki K (2002) The MALE STERILITY1 gene of Arabidopsis, encoding a nuclear protein with a phd-finger motif, is expressed in tapetal cells and is required for pollen maturation. Plant Cell Physiol 43(11):1285–1292CrossRefPubMedGoogle Scholar
  12. Jin J, Zhang H, Kong L, Gao G, Luo J (2014) PlantTFDB 3.0: a portal for the functional and evolutionary study of plant transcription factors. Nucl Acids Res 42:1182–1187CrossRefGoogle Scholar
  13. Kheyr-Pour A, Gracen V, Everett H (1981) Genetics of fertility restoration in the C-group of cytoplasmic male sterility in maize. Genetics 98(2):379–388PubMedPubMedCentralGoogle Scholar
  14. Li Q, Wan JM (2005) SSRHunter: development of a local searching software for SSR sites. Hereditas 27(5):808PubMedGoogle Scholar
  15. Li S, Yang D, Zhu Y (2007) Characterization and use of male sterility in hybrid rice breeding. J Integr Plant Biol 49(6):791–804CrossRefGoogle Scholar
  16. Li J, Yu M, Geng LL, Zhao J (2010) The fasciclin-like arabinogalactan protein gene, FLA3, is involved in microspore development of Arabidopsis. Plant J 64(3):482–497CrossRefPubMedGoogle Scholar
  17. Ma H (2005) Molecular genetic analyses of microsporogenesis and microgametogenesis in flowering plants. Annu Rev Plant Biol 56:393–434CrossRefPubMedGoogle Scholar
  18. Ma J, Yan B, Qu Y, Qin F, Yang Y, Hao X, Yu J, Zhao Q, Zhu D, Ao G (2008) Zm401, a short-open reading-frame mRNA or noncoding RNA, is essential for tapetum and microspore development and can regulate the floret formation in maize. J Cell Biochem 105(1):136–146CrossRefPubMedGoogle Scholar
  19. McCormick S (2004) Control of male gametophyte development. Plant Cell 16(suppl 1):S142–S153CrossRefPubMedPubMedCentralGoogle Scholar
  20. Moon J, Skibbe D, Timofejeva L, Wang CJR, Kelliher T, Kremling K, Walbot V, Cande WZ (2013) Regulation of cell divisions and differentiation by MALE STERILITY32 is required for anther development in maize. Plant J 76(4):592–602CrossRefPubMedPubMedCentralGoogle Scholar
  21. Nan G, Zhai J, Arikit S, Morrow D, Fernandes J, Mai L, Nguyen N, Meyers B, Walbot V (2017) MS23, a master basic helix-loop-helix factor, regulates the specification and development of the tapetum in maize. Development 144(1):163–172CrossRefPubMedGoogle Scholar
  22. Saitou N, Nei M (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4(4):406–425PubMedGoogle Scholar
  23. Salinas M, Xing S, Höhmann S, Berndtgen R, Huijser P (2012) Genomic organization, phylogenetic comparison and differential expression of the SBP-box family of transcription factors in tomato. Planta 235(6):1171–1184CrossRefPubMedGoogle Scholar
  24. Saxena KB, Hingane AJ (2015) Male sterility systems in major field crops and their potential role in crop improvement. In: Bahadur B, Venkat Rajam M, Sahijram L, Krishnamurthy KV (eds) Plant biology and biotechnology, vol I. Plant diversity, organization function and improvement. Springer, New Delhi, pp 639–656CrossRefGoogle Scholar
  25. Sheridan WF, Golubeva EA, Abrhamova LI, Golubovskaya IN (1999) The mac1 mutation alters the developmental fate of the hypodermal cells and their cellular progeny in the maize anther. Genetics 153(2):933–941PubMedPubMedCentralGoogle Scholar
  26. Shukla P, Singh NK, Kumar D, Vijayan S, Ahmed I, Kirti PB (2014) Expression of a pathogen-induced cysteine protease (AdCP) in tapetum results in male sterility in transgenic tobacco. Funct Integr Genomics 14(2):307–317CrossRefPubMedGoogle Scholar
  27. Sinha R, Rajam MV (2013) RNAi silencing of three homologues of S-adenosylmethionine decarboxylase gene in tapetal tissue of tomato results in male sterility. Plant Mol Biol 82(1–2):169–180CrossRefPubMedGoogle Scholar
  28. Skibbe D, Schnable P (2005) Male sterility in maize. Maydica 50(3/4):367Google Scholar
  29. Sofi PA, Rather A, Wani SA (2007) Genetic and molecular basis of cytoplasmic male sterility in maize. Commun Biometry Crop Sci 2:49–60Google Scholar
  30. Solovyev V, Kosarev P, Seledsov I, Vorobyev D (2006) Automatic annotation of eukaryotic genes, pseudogenes and promoters. Genome Biol 7(1):S10.1–S10.12CrossRefPubMedPubMedCentralGoogle Scholar
  31. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: molecular evolutionary genetics analysis version 6.0. Mol Biol Evol 30(12):2725CrossRefPubMedPubMedCentralGoogle Scholar
  32. Unger E, Cigan AM, Trimnell M, R-j Xu, Kendall T, Roth B, Albertsen M (2002) A chimeric ecdysone receptor facilitates methoxyfenozide-dependent restoration of male fertility in ms45 maize. Transgenic Res 11:455–465CrossRefPubMedGoogle Scholar
  33. Unte US, Sorensen A-M, Pesaresi P, Gandikota M, Leister D, Saedler H, Huijser P (2003) SPL8, an SBP-box gene that affects pollen sac development in Arabidopsis. Plant Cell 15(4):1009–1019CrossRefPubMedPubMedCentralGoogle Scholar
  34. Wang D, Skibbe DS, Walbot V (2013) Maize Male sterile 8 (Ms8), a putative β-1, 3-galactosyltransferase, modulates cell division, expansion, and differentiation during early maize anther development. Plant Reprod 26(4):329–338CrossRefPubMedGoogle Scholar
  35. Wang Y, Gu R, Chen H, Shi H, Yu X, Zhang H, Zhao C, Sun Q, Ke Y (2015) Characterization and genetic mapping of a novel recessive genic male sterile gene ms305 in maize (Zea mays L.). Israel J Plant Sci 62:208–214CrossRefGoogle Scholar
  36. Wise RP, Dill CL, Schnable PS (1996) Mutator-induced mutations of the rf1 nuclear fertility restorer of t-cytoplasm maize alter the accumulation of t-urfl3 mitochondrial transcripts. Genetics 143(3):1383–1394PubMedPubMedCentralGoogle Scholar
  37. Wise RP, Bronson CR, Schnable PS, Horner HT (1999) The genetics, pathology, and molecular biology of T-cytoplasm male sterility in maize. Adv Agron 65:79–130CrossRefGoogle Scholar
  38. Woo MO, Ham TH, Ji HS, Choi MS, Jiang W, Chu SH, Piao R, Chin JH, Kim JA, Park BS (2008) Inactivation of the UGPase1 gene causes genic male sterility and endosperm chalkiness in rice (Oryza sativa L.). Plant J 54(2):190–204CrossRefPubMedPubMedCentralGoogle Scholar
  39. Wu Y, Fox TW, Trimnell MR, Wang L, Rj Xu, Cigan AM, Huffman GA, Garnaat CW, Hershey H, Albertsen MC (2016) Development of a novel recessive genetic male sterility system for hybrid seed production in maize and other cross-pollinating crops. Plant Biotechnol J 14(3):1046–1054CrossRefPubMedGoogle Scholar
  40. Xie K, Wu C, Xiong L (2006) Genomic organization, differential expression, and interaction of SQUAMOSA promoter-binding-like transcription factors and microRNA156 in rice. Plant Physiol 142(1):280–293CrossRefPubMedPubMedCentralGoogle Scholar
  41. Xing S, Salinas M, Höhmann S, Berndtgen R, Huijser P (2010) miR156-targeted and nontargeted SBP-box transcription factors act in concert to secure male fertility in Arabidopsis. Plant Cell 22(12):3935–3950CrossRefPubMedPubMedCentralGoogle Scholar
  42. Xing S, Quodt V, Chandler J, Höhmann S, Berndtgen R, Huijser P (2013) SPL8 acts together with the brassinosteroid-signaling component BIM1 in controlling Arabidopsis thaliana male fertility. Plants 2(3):416–428CrossRefPubMedPubMedCentralGoogle Scholar
  43. Yang Z, Wang X, Gu S, Hu Z, Xu H, Xu C (2008) Comparative study of SBP-box gene family in Arabidopsis and rice. Gene 407(1):1–11CrossRefPubMedGoogle Scholar
  44. Zabala G, Gabay-Laughnan S, Laughnan JR (1997) The nuclear gene Rf3 affects the expression of the mitochondrial chimeric sequence R implicated in S-type male sterility in maize. Genetics 147(2):847–860PubMedPubMedCentralGoogle Scholar
  45. Zhang H, Xu C, He Y, Zong J, Yang X, Si H, Sun Z, Hu J, Liang W, Zhang D (2013) Mutation in CSA creates a new photoperiod-sensitive genic male sterile line applicable for hybrid rice seed production. Proc Natl Acad Sci 110(1):76–81CrossRefPubMedGoogle Scholar
  46. Zhang L, Mao D, Xing F, Bai X, Zhao H, Yao W, Li G, Xie W, Xing Y (2015) Loss of function of OsMADS3 via the insertion of a novel retrotransposon leads to recessive male sterility in rice (Oryza sativa). Plant Sci 238:188–197CrossRefPubMedGoogle Scholar
  47. Zhang W, Bei L, Bin Y (2016) Genome-wide identification, phylogeny and expression analysis of the SBP-box gene family in maize (Zea mays). J Integr Agric 15(1):29–41CrossRefGoogle Scholar
  48. Zhang D, Wu S, An X, Xie K, Dong Z, Zhou Y, Xu L, Fang W, Liu S, Liu S, Zhu T, Li J, Rao L, Zhao J, Wan X (2017) Construction of a multicontrol sterility system for a maize male-sterile line and hybrid seed production based on the ZmMs7 gene encoding a PHD-finger transcription factor. Plant Biotechnol J.  https://doi.org/10.1111/pbi.12786 Google Scholar

Copyright information

© Springer Science+Business Media B.V., part of Springer Nature 2018

Authors and Affiliations

  • Chaoxian Liu
    • 1
  • Guoqiang Wang
    • 1
  • Jie Gao
    • 2
  • Chunyan Li
    • 1
  • Ziru Zhang
    • 1
  • Tingting Yu
    • 1
  • Jiuguang Wang
    • 1
  • Lian Zhou
    • 1
  • Yilin Cai
    • 1
  1. 1.Maize Research InstituteSouthwest UniversityChongqingChina
  2. 2.National Maize Improvement Center of ChinaChina Agricultural UniversityBeijingChina

Personalised recommendations