Introduction

Barley (Hordeum vulgare L.) is among the most economically important cereals grown in Ethiopia. In terms of area coverage and total production, barley ranks 5th next to tef, maize, sorghum and wheat (CSA 2016). It covered over one million ha with a total production of 2.0 million tones, and productivity of 1.81 t/ha. Biotic stress such as diseases take the lion share accounting for such low productivity. Ethiopia is an important primary and secondary gene center for many field crop species, including barley with wide genetic diversity (Adugna 2011; Harlan 1969; Vavilov 1951). Several traits, such as disease resistance to Barley yellow dwarf virus-PAV (BYDV-PAV), powdery mildew, leaf rust, loose smut, and Barley stripe mosaic virus (BSMV), and high lysine content were identified from barley germplasm originated from Ethiopia (Abebe 2006). The availability of resistance traits for various economically important diseases is an opportunity to be exploited to develop multiple disease resistance.

Breeding new varieties through conventional methods take up to 12 years and even then, the release of an improved variety cannot be guaranteed (Korzun 2003). The advent and applications of molecular marker technologies worldwide, however, is changing the scene significantly by speeding up the classical crop improvement program by assessing and/or introgression of rich gene pool that exists in the cultivated crops and their wild relatives. Molecular markers are of paramount importance in serving as chromosomal landmarks to trace the presence of a specific genomic region related to a useful trait during the breeding process. Consequently, they are helpful to accumulate multiple genes for resistance to specific pathogens within the same cultivar (gene pyramiding). Besides mapping and tagging genes, molecular markers have made it also possible to map and characterize the polygenes underlying quantitative traits in natural populations (QTL mapping). Molecular diagnostic methods based on polymerase chain reaction (PCR) technology, such as random amplified polymorphic DNA (RAPD), amplified fragment length polymorphism (AFLP) and simple sequence repeat microsatellite (SSR) emerged in the 1980s and early 1990, and their use to enhance plant breeding efforts has been described by many investigators (Dudley 1993; Paterson et al. 1991; Stuber et al. 1999).

Located on chromosome 3H (Schaller et al. 1964), the BYDV resistance gene (Yd2) was first identified by Rasmusson and Schaller (1959) in barleys originated from Ethiopia. Later, Collins et al. (1996) has accurately mapped and demonstrated that Yd2 gene co-segregated with RFLP markers Xwg889 and XY1p on the long arm of chromosome 3, about 0.5 cM from the centromere. Sequence data further showed that the Ylp alleles differ by a single nucleotide in barley with and without Yd2. Such close linkage suggested to provide an opportunity to develop a strong marker for Yd2 selection. Paltridge et al. (1998) and Jefferies et al. (2003) were also developed a co-dominant PCR-based marker designated YLM. More recently, the other resistant gene ‘Ryd3’ was identified from barley and linked to the SSR markers HVM22, HVM14, HVM65, HVM74, Bmac0018 and Bmac0009 (Niks et al. 2004). Yd3 located on a different chromosome (chromosome 6H) (Spaner et al., 1998; Ramsay et al., 2000) than Ryd2, and their location on a different chromosome suggested as an advantage to easily combine both genes in one cultivar to attain a higher level of BYD resistance than either alone. These resistant genes are currently widely used all over the world in barley improvement programs. Whilst both genes were identified from the Ethiopian barley landrace collections, they were not incorporated into elite barley cultivars.

Barley is challenged by the presence of complex of more than one disease that commonly occur in farmers’ fields at the same time. Leaf rust (caused by Puccinia hordei Otth.) and net blotch (caused by Pyrenophora teres Drechsler) are, among others, the two major fungal diseases constraining barley production in major growing areas in Ethiopia (Ayele et al. 2008). Among cereal viruses, BYDV-PAV is causing significant impact on highland grown barley in Ethiopia (Agranovsky 1986; Bekele 1998; Bekele et al. 2001, 2003). The level of damage caused by these diseases necessitated development of efficient control measures. Since chemical application is not an economically or environmentally sound solution, the development of varieties with durable resistance is a priority for breeding programs. The aim of this investigation was: primarily, to screen barley accessions/landraces resistant to BYDV, using Yd2 linked marker (YLP) (Ford et al. 1998), and phenotypic evaluation for leaf rust and net blotch; secondly, to determine whether differences exist between lines with and without Yd2 gene on virus incubation period and/or movement; and thirdly, to understand if there is any association between plant growth rate [days to heading (DtH)] and BYD severity.

Materials and methods

Evaluation of barley accessions to BYDV-PAV, leaf rust and net blotch

Plant materials and DNA extraction

Plant materials used in this study was earlier selected and advanced from around 1400 barley landrace collections and released cultivars obtained from Ethiopian Biodiversity Institute (EBI) and Barley Improvement Department of Holetta Agricultural Research Centre (HARC) (PPRC 2012). The selected materials were further purified for “true to type” based on barley descriptors using morphological features (IPGRI 1994). A total of 165 genotypes, of which 143 barley landrace collections identified earlier at Plant Protection Research Center (PPRC) as promising lines against BYDV-PAV under field conditions and 22 released and elite candidates were evaluated using PCR marker (Yd2-linked marker) to determine whether the known BYDV-PAV resistance gene is involved in the field observed resistance reactions. Each genotype was planted in un-replicated, two row plots of 0.6 m × 1 m = 0.6 m2, with spacing of 0.3 m and 0.5 m, between rows and plots, respectively. About 1 g barley plants were sampled at 1–2 leaf growth stages (11–12 Zadoks scale) (Zadoks et al. 1974) for DNA extraction. Total plant DNA was extracted using cetyl trimethyl ammonium bromide (CTAB) buffer as essentially described by Doyle and Doyle (1990) with the modification that samples were ground in liquid nitrogen using tissue layser. All other plants of each genotypes were allowed to grow until maturity to monitor development of BYD symptoms and other foliar diseases. To guarantee BYD development, cultivars “Gold (CI 1145)” and “HB-42” were planted at a uniform interval as a source of infection row one weak ahead of test genotypes. In addition, to supplement natural infection, viruliferous aphid vectors (Rhopalosiphum padi L.) reared at PPRC greenhouse were uniformly distributed on test plants to promote infection. Superimposed on the same barley materials, host response to leaf rust and net blotch were phenotypically evaluated. Data on heading date, BYD symptoms severity (0–9 scale) (Schaller and Qualset, 1980) at booting stage (41–49 Zadoks scale) (Zadoks et al. 1974), and leaf rust (Pucinia hordei Otth.) and net blotch (Pyrenophora teres Drechs.) severity and plant response to infection were recorded twice at heading and flowering using modified Cobbs Scale (Peterson et al. 1948) (Table 1).

Table 1 Cleaved amplified polymorphic sequence-polymerase chain reaction (CAPS-PCR) amplification of Yd2 gene and reaction of barley genotypes to Barley yellow dwarf virus (BYD), leaf rust and net blotch at Ambo, Ethiopia, 2015/2016 main cropping seasons
Full size table

Polymerase chain reaction (PCR) analysis for Yd2 gene

PCR amplification of Yd2 gene was performed in 15 μl reaction volume containing 3 μl Buffer, 8.85 μl SdH2O, 10 pmole each primer (0.5 μl each), 0.15 μl Taq polymerase and 2 μl genomic DNA. PCR was run on a standard thermocycler with reaction conditions of 94 °C for 5 min followed by 35 cycles of 94 °C for 30 s, 53 °C for 1 min and 72 °C for 2 min, and a final extension step of 72 °C for 5 min. The CAPS-PCR primers (Ford et al. 1998) used for the amplification of the Yd2 gene were Y1p-MF (AATACAGGAATCTGTTGAAAGAA) and Y1p-MR (TCATCATGGCTCGGAGAAGGTGG). PCR products (10 μl/well, each) were separated by 2.5% agarose gel electrophoresis in 1 x TAE (Tris-Acetate-EDTA) buffer stained with 5 μl Redsafe™ nucleic acid staining solution (20,000x) (iNtRON Biotechnology) and visualized using UV light transillumination. For reference and comparison of PCR products, 100 bp DNA size marker (iNtRON Biotechnology) was used along with the samples at 4 μl/well.

Relationships of virus incubation period and host plant resistance

Plant materials and virus inoculum preparation

Sixty-seven barley accessions (Table 2), randomly selected from 165 field selected advanced barleys, were evaluated in the greenhouse to determine association of BYDV-PAV incubation period or movement and host plant resistance. Based on the PCR results (above), both susceptible (-Yd2) and resistant (+Yd2) genotypes were included. All accessions were planted in pots in greenhouse at ambient room temperature. Culture of local BYDV-PAV isolate earlier identified at PPRC were used in this study. Similarly, for virus acquisition and inoculation, a local colony of R. padi was reared in greenhouse at ambient room temperature (~ 22 °C). Test plants were grown in pots of 23 cm × 20 cm, with each pot planted to six seeds for each treatment and maintained in the growth house with day temperature of 20–22 °C. A 48 h acquisition and inoculation access periods adopted, and 10 viruliferous aphids per plant were used for inoculation feeding. All plants receiving different treatments were inoculated equally at 2–3 leaf stages. Six treatments were tested, namely 2, 5, 10, 15, 20 and 25 days after inoculation (DAI).

Table 2 Differences of BYDV-PAV detectability and movement from point of inoculation in barley accessions with (+Yd2) and without (-Yd2) resistant gene when tested by Tissue blot Immunoassay (TBIA) 2–25 days after inoculation
Full size table

Laboratory analysis using tissue blot immunoassay (TBIA)

Plants of each treatment were tested by tissue blot immunoassay (TBIA) test as essentially described by Makkouk and Comeau (1994). Stems of test plants from each treatment were cut using new razor blades and blotted on nitrocellulose membrane (NCM) and analyzed by the TBIA. A 1:1000 dilution of the BYDV-PAV polyclonal antibodies (=BYDV-B; Cat No. 140112, Bioreba, Switzerland) was used as the primary antibody. Goat anti-rabbit antibody conjugated to alkaline phosphatase was used as the probe antibody. Test plants considered positive based on the development of purplish to brown granules in the phloem tissue of the samples following the TBIA test.

Results

Evaluation of barley accessions to BYDV-PAV, leaf rust and net blotch

Using the PCR-CAPS primers, expected product size (PS) (331 bp) related to Yd2 gene was amplified. Out of 165 accessions tested against the Yd2-linked markers, 96 (58.2%) of the tested genotypes were confirmed to contain the Yd2 resistance gene (Table 1). Results of PCR, electrophoresis and UV visualization of purified 48 barley genotypes are shown in Fig. 1.

Fig. 1
figure 1

PCR amplifications of Yd2 gene (PS = 331 bp) conferring resistance to BYDVs from 48 barley accessions. No. 1–48 = tested lines, M = 100 bp DNA size ladder. Accession No. of tested lines (1 to 48), in order, are: 4784(2.1), 4784(2–2), 4806–1(1), 4806–1(2), 4818(1.1), 4818(1.2), 4818(1.3), 4818(2), 4823–3(1.1), 4823–3(1.2), 4833–2, 4841–2(1.1), 4841–2(1.2), 4883, 4915–1(1.1), 4915–1(1.2), 4915–1(1.3), 4981–1, 64,016–1-2, 64,068–1, 64,105(1.1), 64,105(1.2), 64,106–2-1, 64,178(1.1), 64,178(1.2), 64,217.2(1), 64,217.2(2), 64,223(1), 64,223(2), 64,223(3), 64,226–1, Gold, HB-42, Shenen local(1), Shenen local(2), Shenen local(3), Shenen local(4), HB-1307, Cross 41/98, EH 1493, Ardu 12, Holker, Mis-21, Bekoji 1, EH 1847, IBON 170/03, Local, and Gold

Full size image

Data on the association of DtH and BYD symptoms severity was collected (Table 1) to compare if there were differential reactions among accessions. On barley accessions having short DtH (66 days) the disease severity appeared low, and vice versa on accessions having longer DtH (79–83 days). On the basis of DtH and disease symptoms severity score, all the genotypes can roughly be placed in two categories: (i) lines having no BYD symptoms or mild or medium with DtH from 66 to 76 days, and (ii) lines having medium to high symptoms with DtH from 79 to 83 days. At DtH from 66 to 76 days, symptomless lines were recorded in lines both with and without Yd2 genes, while all symptomless lines at 79–83 DtH were only those lines with Yd2 gene.

Phenotypic data collected to screen for multiple disease resistant barley showed that 11 lines that contained Yd2 gene had a disease reaction ranged from highly resistant to moderate (Table 1) for leaf rust and net blotch. Among 11 lines selected as having good level of multiple disease resistance, 6 accessions that showed highest level of reactions were Chelia local, 4304–2(2), 4818(1.3), 1822–1(1), 1831–2-2(2), and 4915–1(1.2). These lines had disease severity and response ranging from <1R to 5R and < 1R to 10MR, respectively, for leaf rust and net blotch. Despite all of them contained Yd2 gene, 2 accessions [1822–1(1) and 1831–2-2(2)] did not develop any BYD-like symptoms, 2 developed low level of yellowing symptom, 1 medium and 1 highest symptoms such as yellowing and stunting. The other 5 accessions [4841–2(1.1), 4915–1(1.3), 1818–1(2), 1820 and 1831–2-2(1)] had moderate level of resistance, with medium (1 accession), low (3 accession) and no (1 accession) BYD symptom developed. Other four accessions (1818–1(1), 1822–1(2), 4075-2-3(2) and 4784–1(1) were negative to Yd2 gene, but had low severity, and MR and R reactions to leaf rust and net blotch.

Relationships of virus incubation period and host plant resistance

When barley plants containing resistance gene (+Yd2) was inoculated with BYDV-PAV at three leaf stage were tested by TBIA at 2, 5, 10, 15, 20, 25 DAI, BYDV was first detected at 10 DAI. The number of lines infected increased relatively proportionally from 10 DAI to 25 DAI (Table 2). Whilst, when 20 barley accessions without resistance gene (-Yd2) were tested by TBIA, BYDV-PAV was detected 5 DAI. BYDV-PAV was not detectable in barley accessions with (+Yd2) or without (-Yd2) resistance gene 2 DAI. BYDV-PAV could not be recovered from any of the 6 treatments (DAI) in 4 accessions with (+Yd2) (accessions 1818–1, 4767-1-1, 4769-1-2 and 64,016–1-2) and two accessions without (-Yd2) (accessions 4075-2-3 and 64,068–1). In general, BYDV-PAV detectability increased from 10 DAI to 25 DAI in lines/accessions with Yd2 gene, although it was inconsistently increased with the highest being recorded at 25 DAI, followed by 10 DAI (Table 2).

Discussion

Ethiopian barley is considered highly diversified (Harlan 1969; Vavilov 1951) and landraces form the major genetic resources of cultivated barley in the country having several traits of agronomic importance (Abebe 2006). The two BYDV-PAV resistant major genes (Yd2 and Yd3), for instance, exclusively identified from the Ethiopian barley (Niks et al. 2004; Rasmusson and Schaller 1959) and have since been transferred to several spring and winter barley cultivars and breeding lines across the Globe (Burnett et al. 1995). However, this potential had not yet been exploited in barley improvement programs in the country. In this study, Yd2 gene was identified for the first time in significant proportion (58.2%) of barley genotypes tested using marker PCR (Table 1). This proportion is very high, and in agreement with the findings of Qualset (1975) who reported that the Ethiopian barley collections from high elevations had a much higher frequency of BYD resistance than barleys from the lower areas. The fact that barley collections used in this study were from higher altitudes between 2500 and 3300 masl, and BYD severity and incidence in Ethiopia was more pronounced at same altitude range (Agranovsky 1986; Agranovsky et al. 1985; Bekele et al. unpublished; Bekele et al. 2001, 2003; Yusuf et al. 1992) explains the high proportion of BYDV resistant genotypes from Ethiopia. Based on this fact it is likely to assume that the ecological conditions at higher elevations in Ethiopia are more conducive for both the viruses and their local clones of respective aphid vectors for BYD epiphytotic development, which in turn exerted natural selection pressure geared up toward resulting abundant resistant phenotypes. Hence, this research findings further supported the fact that Ethiopia is rich gene pool for barley where BYDV resistant gene is readily identified from landrace collections and genetic resistance can be easily employed to reduce the effects of the disease. BYD is currently an economic disease of high land grown elite barleys, and the identified resistant genotypes are a good resource for future barley improvement program targeting BYDVs in Ethiopia. As shown in Table 1, some Yd2 possessing accessions had higher BYD severity than the genotypes that lack this gene. This result may be interpreted in terms of occurrence of a resistance reaction called ‘Tolerance’ that permits plants to withstand high disease pressure with low yield loss.

A study to monitor the association of days to heading and development of BYD in accessions with (+Yd2) and without (-Yd2) resistant gene revealed that severe disease symptoms developed in lines having longer days to heading than lines having shorter days to heading. At 83 and 88 DtH, severe BYD symptoms developed in lines both with (+Yd2) and without (-Yd2) resistant gene. However, the proportion (47%) of lines having severe symptoms was higher for those lines without resistant gene (-Yd2). In most of the lines having DtH of 66–69 (42%), the symptoms were mild or absent. The general trend showed that as the DtH increased from 66 (shortest) to 88 (longest), disease severity and incidence increased proportionally, regardless of whether the resistant gene (Yd2) is present or not, assuming that the environment is similar. Two possible explanations can be suggested: (i) growth rate may affect the expression of BYD symptoms; or (ii) the level of tolerance conferred by Yd2 gene may be modified by host genotype and environmental factors. Hayes et al. (1971) found significant positive correlation between levels of tolerance expressed by the parents and progeny with growth rate, suggesting that environmental or genetic factors which delay heading diminish the expression of BYDV tolerance. Similarly, research results of Jones and Catherall (1970) suggested that barley varieties were most tolerant to infection with barley yellow dwarf virus (BYDV) when they grew rapidly, whether the rate of growth was determined by manipulation of the environment or by the innate genetic constitution of the host. Having experienced difficulty in recovering late maturing segregates, Jones and Catherall (1970) suggested that the Yd2 gene operates by retarding virus multiplication, thus allowing the virus to reach higher concentrations over a longer period of time.

In an attempt to adopt affordable and cheaper alternative methods of evaluation to differentiate resistant and susceptible barley genotypes using TBIA showed that BYDV-PAV was readily detectable five days after inoculation in stems of susceptible (-Yd2) than resistant (+Yd2) lines. This finding is in agreement with reports of previous studies on other crops that the relative restriction of virus movement in resistant cultivars has been documented for a number of sap transmissible viruses such as Cucumber mosaic virus (CMV) in pepper (Doufour et al. 1989; Nono-Womdim et al. 1991) and Maize dwarf mosaic virus (MDMV) in maize (Law et al. 1989). Previously, Jensen (1973) also reported that BYDV moves from an inoculated leaf more readily to roots in susceptible than in resistant cereals. Similarly, Makkouk and Ghulam (1992) reported differences in the rate of BYDV movement from the inoculated leaf to the root in resistant and susceptible barley genotypes. Makkouk et al. (1994) indicated that multiplication and/or movement of barley yellow dwarf virus was retarded in resistant (R) than in susceptible (S) barley genotypes. They showed that DAS-ELISA testing of root extracts from 41 genotypes three or four days after inoculation at the one leaf stage resulted in reliable differentiation of susceptible from resistant plants. Further testing of barley plants inoculated at the two or three leaf stage using tissue-blot ELISA on nitrocellulose membranes revealed that the virus was detected 4–6 days after inoculation in the phloem vessels of the growing points of the susceptible genotypes, but not of resistant genotypes, indicating the method is rapid and inexpensive technique for screening for BYDV resistance in barley. It is to be recalled from Table 2 that BYDV-PAV was not uniformly and consistently recovered from TBIA testing five DAI and onwards among most accessions without resistant gene (-Yd2), and yet the virus was not recovered in two such lines. In the case of barley accessions with resistant gene (+Yd2), BYDV-PAV was recovered most frequently at 25 DAI, supporting the report that the Yd2 resistant gene suppress/retard virus movement and/or multiplication. As in the case of accessions without Yd2, BYDV-PAV was not recovered from four lines. Absence of positive TBIA result in this case may be attributed to either inherent genetic background of the host that completely resist the virus conferred by the same gene or other gene(s) (major and minor) operating concurrently or infection escape or the efficiency of TBIA in detect low virus titer. Similarly, absence of positive TBIA reactions in two of Yd2 negative barley accessions may also imply the presence of other effective gene(s) other than Yd2 or infection escape due to lack of uniform application of viruliferous aphid vectors. In general, as in the case of previous studies, the result based on virus movement gave good indications in selecting promising barley lines in preliminary screening. Thus, to use the method solely to develop BYDV resistant genotypes, supporting data such as yield and associated agronomic traits may be taken into consideration.

It is interesting to note that some barley genotypes found resistant to BYD were also resistant to leaf rust and net blotch. Cultivars resistant to multiple diseases are scarce since breeding for multiple disease resistance is a difficult and lengthy task (https://www.researchgate.net/publication/265820772). Luckily, eleven barley genotypes possessing multiple disease (leaf rust, net blotch and BYDV) resistance were successfully identified in the present study. Such multiple disease resistance is a desirable trait of good agricultural importance to be incorporated in elite barley genotypes through backcross breeding. In most cases, these results were hardly attainable, and signifies the great diversity of, and characteristic feature and quality of, Ethiopian barley landrace collections. Thus, barley breeders should take advantage of this opportunity in producing multi-disease resistant/tolerant barley genotypes in an agronomically enhanced genetic background in Ethiopia and beyond.