A phase II study of the HDAC inhibitor SB939 in patients with castration resistant prostate cancer: NCIC clinical trials group study IND195

Summary

Background SB939 is a potent oral inhibitor of class 1, 2, and 4 histone deacetylases (HDACs). These three HDAC classes are highly expressed in castration resistant prostate cancer (CRPC) and associated with poor clinical outcomes. We designed a phase II study of SB939 in men with metastatic CRPC. Methods Patients received SB939 60 mg on alternate days three times per week for 3 weeks on a 4-week cycle. Primary endpoints were PSA response rate (RR) and progression-free survival (PFS). Secondary endpoints included objective response rate and duration; overall survival; circulating tumor cell (CTC) enumeration and safety. Exploratory correlative studies of the TMPRSS2-ERG fusion and PTEN biomarkers were also performed. Results Thirty-two patients were enrolled of whom 88 % had received no prior chemotherapy. The median number of SB939 cycles administered was three (range 1–8). Adverse events were generally grade 1–2, with five pts experiencing one or more grade three event. One patient died due to myocardial infarction. A confirmed PSA response was noted in two pts (6 %), lasting 3.0 and 21.6 months. In patients with measurable disease there were no objective responses. Six patients had stable disease lasting 1.7 to 8.0 months. CTC response (from ≥5 at baseline to <5 at 6 or 12 weeks) occurred in 9/14 evaluable patients (64 %). Conclusion Although SB939 was tolerable at the dose/schedule given, and showed declines in CTC in the majority of evaluable patients, it did not show sufficient activity based on PSA RR to warrant further study as a single agent in unselected patients with CRPC.

Introduction

Genetic and epigenetic modifications are known to play a critical role in prostate cancer development and progression [1]. Alterations in histone deacetylase (HDAC) activity have been documented in prostate cancer, and HDAC isoforms I, II and III are highly expressed in most prostate carcinomas [2]. High expression of HDAC2 has been associated with increased cell proliferation and shorter PSA relapse-free survival times [2]. It has been observed that HDAC inhibition results in HSP90 acetylation [3], which decreases HSP90 activity and promotes the degradation of client proteins [4]. Since HSP90 is a crucial chaperone in androgen receptor (AR) stabilization and translocation [5], HDAC inhibition represents a promising therapeutic target in prostate cancer.

SB939 (Pracinostat, MEI Pharma, San Diego) is a competitive inhibitor of HDAC, particularly isoforms I and II [6]. In vitro SB939 treatment of cancer cells resulted in the accumulation of acetylated histone H3 and alpha-tubulin, as well as increased expression of the CDK inhibitor p21 [7]. SB939 showed promising activity in in vivo tumor models, with dose-dependent antitumor activity against a variety of solid tumor models [7, 8]. Furthermore, in silico analysis has demonstrated an association between ERG gene co-expression patterns and HDAC1 gene expression, which raises the possibility that HDAC inhibition may have particular relevance in TMPRSS2-ERG fusion positive prostate cancers [2].

Two phase I studies in patients with advanced solid malignancies, established that SB939 could be safely administered and demonstrated promising pharmacodynamic activity with increased levels of acetylated histone H3 demonstrated in a dose dependent manner [9, 10]. The recommended phase 2 dose of SB939 was 60 mg given orally three times per week for 3 weeks of a 4 weeks cycle [10]. The NCIC Clinical Trials Group (CTG) conducted a phase II clinical trial to evaluate the tolerability and clinical activity of SB939 in patients with CRPC. Because it has been proposed that the presence of the TMPRSS2-ERG fusion could indicate sensitivity to HDAC inhibition [11] and because TMPRSS2-ERG induced prostate cancer growth is promoted when PTEN is lost [12], correlative studies evaluating TMPRSS2-ERG and PTEN status as potential predictive markers were also undertaken.

Patients and methods

Study design

This was a non-randomized, non-blinded multicenter phase II trial of oral SB939 in patients with CRPC. The primary endpoints were PSA response and progression free survival, as per the Prostate Cancer Clinical Trials Working Group (PCWG2) guidelines [13]. Secondary endpoints included safety, tolerability, objective response and response duration (according to modified RECIST 1.1 criteria [14], enumeration of circulating tumor cells (CTC) at baseline and after 6 and 12 weeks, time to PSA progression, exploratory analysis of the utility of ERG expression on CTC as a potential predictive marker of response to SB939. This study adhered to the Declaration of Helsinki and Good Clinical Practice. Local ethics committee approval was obtained by all participating institutions prior to study initiation and all patients provided written informed consent. This study is registered in www.clinicaltrials.gov as NCT01075308.

Patient selection

Patients had documented metastatic adenocarcinoma of the prostate with radiographic or PSA progression and a castrate level of testosterone, a serum PSA of ≥ 5 μg/L, and an Eastern Cooperative Oncology Group (ECOG) performance status of 0 or 1. Patients were required to maintain medical castration therapy, and to be off peripheral antiandrogens. Up to one prior chemotherapy regimen was permitted, as was prior radiation provided a minimum of 4 weeks had elapsed before enrollment. Patients had to have adequate function of the bone marrow (neutrophils ≥ 1.5 × 109/L, platelets ≥ 100 × 109/L), liver (bilirubin within normal limits, aspartate aminotransferase/alanine aminotransferase ≤ 2.5 × ULN) and kidneys (serum creatinine ≤ 1.5 × ULN) and cardiac function as follows: baseline QTc ≤ 450 msec, left ventricular ejection fraction ≥ 50 %, normal troponin I or T. Patients could not have a prior history of any pre-existing uncontrolled cardiac condition, and no prior myocardial infarction. Patients were not eligible if they had a history of previous invasive cancer (except adequately treated non-melanoma skin cancer, or other solid tumours curatively treated with no evidence of disease for > 5 years), brain metastases, other serious medical illness or prior treatment with an HDAC inhibitor.

Treatment plan and evaluations

SB939 was administered at 60 mg orally every other day three times per week for 3 weeks, followed by a 1-week rest period. A dose reduction to 40 mg was permitted but if further dose reductions were required, patients were removed form study. Dose interruptions for toxicity of up to 2 weeks were permitted, but patients who either required delays beyond 2 weeks or dose reduction below 40 mg or experienced a grade 4 adverse event, were removed from protocol therapy. Otherwise, patients remained on treatment until disease progression (either by RECIST 1.1 criteria or by PSA progression after a minimum of 12 weeks on study [13]), intolerable toxicity, start of new cancer therapy, withdrawal of consent, or death. At baseline, all patients underwent a complete history and physical exam, laboratory blood tests, ECG, LVEF assessment and radiological imaging consisting of chest/abdominal/pelvic CT scan and bone scan. Physical exam, laboratory tests for hematology, biochemistry and PSA were repeated on day 1 of every 4-week cycle. Radiological imaging of measurable disease was repeated at the end of every second cycle, and bone scan imaging was performed at 12 weeks and end of study in patients with positive bone scans at baseline, and as clinically indicated. Circulating tumor cells were collected as previously described at baseline [15], week 6 and 12 if patients were still on study treatment. Adverse events were evaluated continuously and graded according to the NCI Common Terminology Criteria for Adverse Events (CTCAE) version 4.0.

Outcome measures

All patients were considered assessable for toxicity from the time of their first treatment. Response and progression were evaluated by RECIST 1.1 criteria in patients who had measurable disease at baseline [16]. All patients who had received at least one cycle of therapy and who had two or more PSA measurements at least 3 weeks apart following baseline were considered assessable for PSA decline assessment. PSA response was defined as a decline of 50 % or greater in PSA maintained for at least 3 weeks without other evidence of disease progression. PSA progression was evaluated following a minimum of 12 weeks on study and was defined as a rise in PSA of 25 % (minimum 2 ng/mL) above baseline (or nadir) and confirmed by a second increasing value at least 3 weeks later. Circulating tumor cell counts were scored as favorable (<5 cells/7.5 mL blood) and unfavorable (≥5 cells/7.5 mL blood) at each measurement.

Evaluation of TMPRSS2-ERG fusion status in CTC specimens

Frozen whole blood collected in PAXgene Blood RNA tubes from CRPC patients was collected and total RNA was isolated using PAXgene Blood RNA Kit (Qiagen). cDNA was prepared from RNA amplified using Low Input Quick Amplification RNA Kit (Agilent) using random hexamers and SuperScript First-Strand System (Invitrogen). RT-PCR for TMPRSS2-ERG (forward primer: 5’ T1 TAGGCGCGAGCTAAGCAGGAG, reverse primer: 5’ E8 GTCCATAGTCGCTGGAGGAG), PSA (forward primer: 5’-TGTGCTTCAAGGTATCACGTCAT-3’, reverse primer: 5’-TGTACAGGGAAGGCCTTTCG-3’ and 18S RNA (forward primer: 5’-CGATGCTCTTAGCTGAGTGT-3’, reverse primer: 5’-GGTCCAAGAATTTCACCTCT-3’) were performed and relative product levels determined by relative quantification method normalized to respective 18S RNA levels [17]. TMPRSS2-ERG transcript levels in blood samples were compared to that of peripheral blood lymphocytes from a normal male donor.

Evaluation of TMPRSS2-ERG fusion status and PTEN deletion status in archival tissue

Tissue samples were obtained from radical prostatectomy archival tissue from 28 patients and analyzed by fluorescence in situ hybridization (FISH). Detection of genomic rearrangements associated with the presence of the TMPRSS2-ERG fusion gene [18] was undertaken using the TMP/ERG del-TECT™ Four Color CLEAR-VIEW FISH™ (CymoGen Dx, LLC, USA) probe set. One hundred non-overlapping, intact interphase nuclei were scored per sample. If less than 100 scorable nuclei were present, then as many cells as possible were scored above a minimum of 30 cells. Samples were considered fusion-positive if the expected FISH signal pattern for a fusion was observed in more than 60 % of cells. Similarly, the PTEN-del-TECT™ Four Color CLEAR-VIEW FISH™ (CymoGen Dx, LLC, USA) was used for detection of deletions of the PTEN gene [19]. Details of the probe configurations for both FISH probes are provided on the CymoGen Dx website.

Immunohistochemistry (IHC) with the anti-ERG antibody (Epitomics, Burlingame, CA, USA) was used to detect ERG oncoprotein as increased expression of this protein is considered to be a surrogate marker for TMPRSS2-ERG fusion [20]. PTEN expression was evaluated by IHC using the anti-PTEN antibody (Cell Signaling Technology, Danvers, MA, USA). Staining of samples was performed on the Discovery XT® automated staining platform (Ventana Medical Systems, Inc., Tucson, AZ). ERG expression was evaluated relative to endothelial cell nuclei and lymphocytes as internal positive controls. When the ERG protein expression level was markedly decreased compared to these controls the sample was considered negative. Benign glands served as internal negative controls. Positive expression of PTEN protein in benign glands as well as in vascular endothelium throughout the samples was used as internal positive controls, so cancerous glands having markedly decreased expression of PTEN compared with the surrounding benign glands and/or stroma were considered negative for PTEN protein when using dichotomous scoring criteria [21].

Statistical considerations

It was hypothesized that SB9393 monotherapy would be considered of further interest if 15 % or more of patients had a PSA response as defined above, and would be of no interest if the proportion was 2 % or less. A two-stage design [22] was used with an alpha level of 0.1 and a power of 0.9 with a planned 16 assessable subjects accrued to stage I and 13 further subjects accrued in stage II if at least one PSA response was observed in stage I. If fewer than three PSA responses were observed in the 29 total subjects accrued, then no further investigation of this drug in this setting was considered warranted.

Results

Patient characteristics

Thirty-two patients were enrolled from June 2010 to November 2011 from 7 NCIC CTG member centers. Baseline characteristics are listed in Table 1.

Table 1 Baseline patient demographic and clinical characteristics (N = 32)

Treatments administered

A total of 103 cycles of SB939 were administered, with a median of 3 cycles (range 1–8) administered per patient. Fifty-three percent of patients received at least 90 % of the planned dose, with the median actual dose intensity being 127.6 mg per week (range 45–137.5 mg). Seven patients (22 %) required at least one dose delay, and 5 (16 %) patients required at least one dose reduction for toxicity. Therapy was discontinued for the following reasons: intercurrent illness not related to study protocol (two patients), death (one patient), disease progression ([18] patients), adverse event related to protocol therapy (six patients), symptomatic progression (four patients), unconfirmed radiologic progression (one patient).

Safety

Adverse events with an incidence of >10 % or ≥ grade 3 that were considered related to SB939 are listed in Table 2. Adverse events were generally grade 1–2 with the most common ones being fatigue (34 %) and nausea (31 %). Five patients experienced one or more grade 3 events. One patient experienced a grade 5 cardiac arrest and myocardial infarction sustained 23 days after his last dose of SB939. This was not thought to be related to SB939. QTc values for this patient were not increased on study except following the myocardial infarction. Hematologic and biochemical abnormalities were minimal with only one patient experiencing a grade 4 laboratory event (anemia) noted on study. Other than the myocardial infarction already described, no significant cardiac events were noted. All 32 patients had repeated QTc evaluations on treatment. The majority maintained a QTc < 450 ms however seven patients developed a grade 1 QTc prolongation on study.

Table 2 Adverse events grade ≥3 and/or occurring in >10 % of patients considered related (N = 32)

Efficacy

All patients had at least one PSA measurement performed after baseline, and all but three were evaluable for PSA response. Two (6 %) confirmed PSA responses were noted, which were maintained for 3 and 21.6 months respectively. Figure 1 shows best PSA responses for all patients. Fifteen patients were evaluable for response by RECIST criteria and no partial or complete responses were observed. Figure 2 demonstrates the best CTC change seen in 21 patients with baseline and follow up CTC analyses. The proportion of patients with a favorable CTC profile (<5 CTC/7.5 mL) increased from 33 % at baseline to 66 % on treatment. No correlation between PSA and CTC responses was observed (Fig. 3).

Fig. 1
figure1

Best PSA response according to PTEN and ERG status

Fig. 2
figure2

Best CTC change seen in all evaluable patients (N = 21)

Fig. 3
figure3

CTC and PSA changes noted at 6 weeks in evaluable patients

Correlative studies

Given the low PSA response rate observed for SB939, correlative studies could not be assessed as potential predictive markers (Figs. 1 and 2). To determine if there was an association between expression levels of the TMPRSS-ERG gene in frozen blood collected at the time of CTC analysis, RNA extraction and qPCR for TMPRSS2-ERG transcript was undertaken on all 21 patients who had detectable CTCs. TMPRSS2-ERG transcripts could be identified in a third of the samples with a lower limit of detection in samples with as few as three CTC/7.5 mL, but no correlation between transcript signal detection and CTC burden was observed. Exploratory analyses were also performed on 31 patients in whom archival tissue was available for FISH and IHC analysis of TMPRSS2-ERG rearrangement and/or PTEN deletion. Of these nine samples were excluded from FISH analysis for TMPRSS2-ERG due to either unsuccessful hybridization [8] or insufficient sample tumor content [1]. Of the remaining 19 samples, eight were found to be positive for TMPRSS2-ERG fusion. ERG-IHC overexpression was seen in 14 of these 19 samples, and included all eight samples that had the fusion on FISH analysis in keeping with the strong correlation between the FISH and IHC assays for this biomarker. A total of 15 samples were excluded from FISH analysis for PTEN. This included the same nine samples that failed the TMPRSS2-ERG analysis. Of the remaining 13 samples, five were observed to have deletion of PTEN, four of which also harbored ERG-rearrangement. Of 18 samples that could be tested on IHC, PTEN protein loss was detected in eight samples and this set included the five samples demonstrating PTEN loss on FISH analysis.

Discussion

There is strong preclinical evidence supporting a role for HDAC inhibitors in prostate cancer [23]. Despite this, several recent clinical trials of these agents have failed to show promising single agent activity [24, 25]. Similarly, this phase II multicenter study failed to demonstrate promising single agent activity for SB939 monotherapy in terms of PSA response. Nevertheless, two patients did demonstrate confirmed PSA responses with one patient experiencing prolonged response to SB939 treatment for more than 21 months. Furthermore, in terms of CTC parameters, 9 (64 %) patients had a conversion from an unfavorable CTC profile to a favorable one (i.e., <5 CTC/7.5 mL blood) while on treatment. Whether this represents a signal of clinical activity or phenotypic alterations in the CTC population deserves further investigation. Correlative studies were undertaken in an attempt to identify whether the presence of TMPRSS2-ERG fusion status or PTEN loss were predictive of response to treatment. Due to the lack of clinical responses observed, this data was not informative.

The administration of SB939 at the given schedule was generally well tolerated with few grade >2 adverse events noted. Although one patient died of a myocardial infarction, the fatal event occurred several weeks after study treatment had been discontinued due to anorexia and pain from spinal compression fractures. No other cardiac events were noted on study and electrocardiographic manifestations on treatment were asymptomatic, reversible and generally in keeping with those changes previously noted for this class of agents [26].

It is possible that HDAC inhibitors may have higher efficacy when used in combination with hormonal or cytotoxic chemotherapies. This is because HDAC inhibitors can sensitize cancer cells to cytotoxic therapies by increasing DNA accessibility [2729]. Combination studies are currently being pursued [27, 28, 30]. The strategy of combining HDAC inhibitors with other pathway specific agents also holds preclinical promise [31, 32], and studies evaluating HDAC and AR targeted agents in prostate cancer are under way (clinicaltrials.gov identifiers: NCT00878436, NCT00589472).

In conclusion, these data do not support the further evaluation of single-agent SB939 in unselected CRPC patients, but further studies in combination with other therapeutics may be warranted.

References

  1. 1.

    Abbas A, Gupta S (2008) The role of histone deacetylases in prostate cancer. Epigenetics 3(6):300–309

    PubMed Central  PubMed  Article  Google Scholar 

  2. 2.

    Weichert W, Roske A, Gekeler V, Beckers T, Stephan C, Jung K et al (2008) Histone deacetylases 1, 2 and 3 are highly expressed in prostate cancer and HDAC2 expression is associated with shorter PSA relapse time after radical prostatectomy. Br J Cancer 98(3):604–610

    CAS  PubMed Central  PubMed  Article  Google Scholar 

  3. 3.

    Edwards A, Li J, Atadja P, Bhalla K, Haura EB (2007) Effect of the histone deacetylase inhibitor LBH589 against epidermal growth factor receptor-dependent human lung cancer cells. Mol Cancer Ther 6(9):2515–2524

    CAS  PubMed  Article  Google Scholar 

  4. 4.

    Fiskus W, Ren Y, Mohapatra A, Bali P, Mandawat A, Rao R et al (2007) Hydroxamic acid analogue histone deacetylase inhibitors attenuate estrogen receptor-alpha levels and transcriptional activity: a result of hyperacetylation and inhibition of chaperone function of heat shock protein 90. Clin Cancer Res 13(16):4882–4890

    CAS  PubMed  Article  Google Scholar 

  5. 5.

    Pratt WB, Galigniana MD, Morishima Y, Murphy PJ (2004) Role of molecular chaperones in steroid receptor action. Essays Biochem 40:41–58

    CAS  PubMed  Google Scholar 

  6. 6.

    Kantharaj E, Jayaraman R (2011) Histone deacetylase inhibitors as therapeutic agents for cancer therapy: Drug metabolism and pharmacokinetic properties. In: Rundfeldt C, (ed.). Drug development - a case study based insight into modern strategies. InTech, 101

  7. 7.

    Novotny-Diermayr V, Sangthongpitag K, Hu CY, Wu X, Sausgruber N, Yeo P et al (2010) SB939, a novel potent and orally active histone deacetylase inhibitor with high tumor exposure and efficacy in mouse models of colorectal cancer. Mol Cancer Ther 9(3):642–652

    CAS  PubMed  Article  Google Scholar 

  8. 8.

    Wang H, Yu N, Chen D, Lee KC, Lye PL, Chang JW et al (2011) Discovery of (2E)-3-{2-butyl-1-[2-(diethylamino)ethyl]-1H-benzimidazol-5-yl}-N-hydroxyacrylami de (SB939), an orally active histone deacetylase inhibitor with a superior preclinical profile. J Med Chem 54(13):4694–4720

    CAS  PubMed  Article  Google Scholar 

  9. 9.

    Razak AR, Hotte SJ, Siu LL, Chen EX, Hirte HW, Powers J et al (2011) Phase I clinical, pharmacokinetic and pharmacodynamic study of SB939, an oral histone deacetylase (HDAC) inhibitor, in patients with advanced solid tumours. Br J Cancer 104(5):756–762

    CAS  PubMed Central  PubMed  Article  Google Scholar 

  10. 10.

    Yong WP, Goh BC, Soo RA, Toh HC, Ethirajulu K, Wood J et al (2011) Phase I and pharmacodynamic study of an orally administered novel inhibitor of histone deacetylases, SB939, in patients with refractory solid malignancies. Ann Oncol 22(11):2516–2522

    CAS  PubMed  Article  Google Scholar 

  11. 11.

    Iljin K, Wolf M, Edgren H, Gupta S, Kilpinen S, Skotheim RI et al (2006) TMPRSS2 fusions with oncogenic ETS factors in prostate cancer involve unbalanced genomic rearrangements and are associated with HDAC1 and epigenetic reprogramming. Cancer Res 66(21):10242–10246

    CAS  PubMed  Article  Google Scholar 

  12. 12.

    Squire JA (2009) TMPRSS2-ERG and PTEN loss in prostate cancer. Nat Genet 41(5):509–510

    CAS  PubMed  Article  Google Scholar 

  13. 13.

    Scher HI, Halabi S, Tannock I, Morris M, Sternberg CN, Carducci MA et al (2008) Design and end points of clinical trials for patients with progressive prostate cancer and castrate levels of testosterone: recommendations of the Prostate Cancer Clinical Trials Working Group. J Clin Oncol 26(7):1148–1159

    PubMed Central  PubMed  Article  Google Scholar 

  14. 14.

    Eisenhauer EA, Therasse P, Bogaerts J, Schwartz LH, Sargent D, Ford R et al (2009) New response evaluation criteria in solid tumours: revised RECIST guideline (version 1.1). Eur J Cancer 45(2):228–247

    CAS  PubMed  Article  Google Scholar 

  15. 15.

    de Bono JS, Scher HI, Montgomery RB, Parker C, Miller MC, Tissing H et al (2008) Circulating tumor cells predict survival benefit from treatment in metastatic castration-resistant prostate cancer. Clin Cancer Res 14(19):6302–6309

    PubMed  Article  Google Scholar 

  16. 16.

    Eisenhauer EA, Therasse P, Bogaerts J, Schwartz LH, Sargent D, Ford R et al (2009) New response evaluation criteria in solid tumours: revised RECIST guideline (version 1.1). Eur J Cancer 45(2):228–247

    CAS  PubMed  Article  Google Scholar 

  17. 17.

    Schmittgen TD, Livak KJ (2008) Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc 3(6):1101–1108

    CAS  PubMed  Article  Google Scholar 

  18. 18.

    Yoshimoto M, Joshua AM, Cunha IW, Coudry RA, Fonseca FP, Ludkovski O et al (2008) Absence of TMPRSS2:ERG fusions and PTEN losses in prostate cancer is associated with a favorable outcome. Mod Pathol 21(12):1451–1460

    CAS  PubMed  Article  Google Scholar 

  19. 19.

    Yoshimoto M, Ludkovski O, DeGrace D, Williams JL, Evans A, Sircar K et al (2012) PTEN genomic deletions that characterize aggressive prostate cancer originate close to segmental duplications. Genes Chromosomes Cancer 51(2):149–160

    CAS  PubMed  Article  Google Scholar 

  20. 20.

    Chaux A, Albadine R, Toubaji A, Hicks J, Meeker A, Platz EA et al (2011) Immunohistochemistry for ERG expression as a surrogate for TMPRSS2-ERG fusion detection in prostatic adenocarcinomas. Am J Surg Pathol 35(7):1014–1020

    PubMed Central  PubMed  Article  Google Scholar 

  21. 21.

    Lotan TL, Gurel B, Sutcliffe S, Esopi D, Liu W, Xu J et al (2011) PTEN protein loss by immunostaining: analytic validation and prognostic indicator for a high risk surgical cohort of prostate cancer patients. Clin Cancer Res 17(20):6563–6573

    CAS  PubMed Central  PubMed  Article  Google Scholar 

  22. 22.

    Simon R (1989) Optimal two-stage designs for phase II clinical trials. Control Clin Trials 10(1):1–10

    CAS  PubMed  Article  Google Scholar 

  23. 23.

    Welsbie DS, Xu J, Chen Y, Borsu L, Scher HI, Rosen N et al (2009) Histone deacetylases are required for androgen receptor function in hormone-sensitive and castrate-resistant prostate cancer. Cancer Res 69(3):958–966

    CAS  PubMed Central  PubMed  Article  Google Scholar 

  24. 24.

    Molife LR, Attard G, Fong PC, Karavasilis V, Reid AH, Patterson S et al (2010) Phase II, two-stage, single-arm trial of the histone deacetylase inhibitor (HDACi) romidepsin in metastatic castration-resistant prostate cancer (CRPC). Ann Oncol 21(1):109–113

    CAS  PubMed  Article  Google Scholar 

  25. 25.

    Rathkopf DE, Picus J, Hussain A, Ellard S, Chi KN, Nydam T et al (2013) A phase 2 study of intravenous panobinostat in patients with castration-resistant prostate cancer. Cancer Chemother Pharmacol 72(3):537–544

    CAS  PubMed Central  PubMed  Article  Google Scholar 

  26. 26.

    Molife R, Fong P, Scurr M, Judson I, Kaye S, de Bono J (2007) HDAC inhibitors and cardiac safety. Clin Cancer Res 13(3):1068, author reply -9

    PubMed  Article  Google Scholar 

  27. 27.

    Munster P, Marchion D, Bicaku E, Schmitt M, Lee JH, DeConti R et al (2007) Phase I trial of histone deacetylase inhibition by valproic acid followed by the topoisomerase II inhibitor epirubicin in advanced solid tumors: a clinical and translational study. J Clin Oncol 25(15):1979–1985

    CAS  PubMed  Article  Google Scholar 

  28. 28.

    Munster PN, Marchion D, Thomas S, Egorin M, Minton S, Springett G et al (2009) Phase I trial of vorinostat and doxorubicin in solid tumours: histone deacetylase 2 expression as a predictive marker. Br J Cancer 101(7):1044–1050

    CAS  PubMed Central  PubMed  Article  Google Scholar 

  29. 29.

    Tsai SC, Valkov N, Yang WM, Gump J, Sullivan D, Seto E (2000) Histone deacetylase interacts directly with DNA topoisomerase II. Nat Genet 26(3):349–353

    CAS  PubMed  Article  Google Scholar 

  30. 30.

    Rathkopf D, Wong BY, Ross RW, Anand A, Tanaka E, Woo MM et al (2010) A phase I study of oral panobinostat alone and in combination with docetaxel in patients with castration-resistant prostate cancer. Cancer Chemother Pharmacol 66(1):181–189

    CAS  PubMed  Article  Google Scholar 

  31. 31.

    Wissing MD, Mendonca J, Kortenhorst MS, Kaelber NS, Gonzalez M, Kim E et al (2013) Targeting prostate cancer cell lines with polo-like kinase 1 inhibitors as a single agent and in combination with histone deacetylase inhibitors. FASEB J: Off Publ Fed Am Soc Exp Biol 27(10):4279–4293

    CAS  Article  Google Scholar 

  32. 32.

    Ellis L, Ku SY, Ramakrishnan S, Lasorsa E, Azabdaftari G, Godoy A, et al (2013) Combinatorial antitumor effect of HDAC and the PI3K-Akt-mTOR pathway inhibition in a Pten defecient model of prostate cancer. Oncotarget

Download references

Acknowledgments

The NCIC Clinical Trials Group is supported by the Canadian Cancer Society Research Institute (grant #021039) l

Conflict of interest

The authors declare that they have no conflict of interest.

Author information

Affiliations

Authors

Corresponding author

Correspondence to B. J. Eigl.

Additional information

PAB is funded by a Cancer Care Ontario Research Chair in Experimental Therapeutics

Rights and permissions

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

Eigl, B.J., North, S., Winquist, E. et al. A phase II study of the HDAC inhibitor SB939 in patients with castration resistant prostate cancer: NCIC clinical trials group study IND195. Invest New Drugs 33, 969–976 (2015). https://doi.org/10.1007/s10637-015-0252-4

Download citation

Keywords

  • Castration resistant prostate cancer
  • Histone deacetylase inhibitors
  • HDAC