Skip to main content

Table 1 Oligonucleotide primers used for PCR and sequencing of rhinoceros mitochondrial DNA

From: Comparison of whole mitochondrial genome sequences of northern and southern white rhinoceroses (Ceratotherium simum): the conservation consequences of species definitions

Primer set Primer name Sequence Binding position on mt genome PCR amplicon size (bp)
Rhino set 1 CscMtF1 CCTAGCCTCACCATCAAC 15,399 8493
CscMtR1 CTAGTTGGAATGGGTAAGC 7060
Rhino set 2 CscMtF2b CCTTGCTAGGAGACGACCAG 5486 6378
CscMtR2b TGTGCTGTTTTTGTGGGTGT 11,863
Rhino set 3 CscMtF3 CCGCTCCTAATCGCACTAAC 10,668 6022
CscMtR3 TGGGAAGGGGGTTAGACTTT 16,689