Introduction

Minisatellites defined as 10–100-bp-long stretch of DNA (Charlesworth et al. 1994) encompass 0.5 to several kilobases in the eukaryotic genome (Vergnaud and Denoeud 2000). Variations in the number of their repeat units confer high level of polymorphism to these regions (Ali and Wallace 1988; Jeffreys et al. 1990, Kim et al. 2008). Earlier, minisatellites were described to represent the “junk” part of the genome (Orgel and Crick 1980). However, recent studies have shown their involvement in a variety of functions in the eukaryotic genome (Fondon and Garner 2004; Legendre et al. 2007; Levdansky et al. 2007).

Transcriptionally active minisatellites and microsatellites are of particular importance since they regulate functions of other RNAs (Li et al. 2002, 2004). Minisatellites within the RNAs particularly in the protein coding regions may influence both structure and function of the proteins. Such repeat elements owing to “strand slippage” during DNA replication shrink and expand, causing mutations in the coding regions of the corresponding genes. Consequently, the altered proteins elicit pathological response at the molecular and cellular levels, leading to genetic diseases, e.g., Huntington disease, fragile X syndrome, myotonic dystrophy, epilepsy, etc. (Li et al. 2004; Lohi et al. 2005; Verstrepen et al. 2005; Usdin 2008). Association of minisatellite with promoter regions influences binding of transcription factors, thus regulating gene expression across the tissues (Li et al. 2004; Caburet et al. 2004, 2005; Dey and Rath 2005; Mahr and Müller-Hilke 2007; Akagi et al. 2009). Minisatellites have been used as valuable tools to analyze uncharacterized genomes (Georges and Andersson 1996). In earlier studies, we uncovered several mRNA transcripts representing known and novel genes tagged with minisatellites from the buffalo genome (Srivastava et al. 2006, 2008, 2009). Of these, we characterized and mapped secreted modular calcium binding protein 1 gene in the buffalo genome (Srivastava et al. 2007). The consensus sequence of minisatellite 33.6 is an 11-bp repeat, originating from the human myoglobin gene (Jeffreys et al. 1985). In the present study, employing minisatellite-associated sequence amplification (MASA) approach, we uncovered mRNA transcripts tagged with two units of consensus of 33.6 repeat loci in water buffalo, Bubalus bubalis, using cDNA from different somatic tissues, gonads, and spermatozoa (Srivastava et al. 2006, 2008, 2009). These mRNA transcripts were studied for their sequence, homology, differential expression, and evolutionary status. Furthermore, chromosome localization and copy number studies were conducted for the candidate genes. The significance of buffalo in agriculture and in dairy and meat industries prompted us to use this animal as a model. Generation of mRNA fingerprint(s) from different somatic tissues and spermatozoa is envisaged to provide deeper insight into the ubiquitous and singular expression of the genes in this species and their functional correlations among different tissues. This work demonstrates the innate potentials of MASA-mediated approach for accessing genes without screening the cDNA library and forms a rich basis for functional and comparative genomics on any type of cell, tissues, and even biopsied samples.

Materials and methods

Blood collection and isolation of genomic DNA

Heparinized vials were used for blood collection from buffalo Bubalus bubalis, cattle Bos taurus, goat Capra hircus, sheep Ovis aries, human Homo sapiens, tiger Panthera tigris, fish Heteropneustes fossilis, bird Columba livia, rat Rattus norvegicus, jungle cat Felis chaus, bonnet monkey Macaca radiate, Indian rhinoceros Rhinoceros unicornis, and leopard Panthera pardus, and DNA was isolated following standard protocol (Srivastava et al. 2008). Blood samples from the endangered species were procured with due permissions from the competent authorities of the state and union government of India, following strictly the guidelines of the Institute’s Ethical and Biosafety Committee.

Sperm processing and RNA isolation

Fresh ejaculated semen samples from buffalo bulls were obtained from the animal farm, Lucknow, UP, India, following strictly the guidelines of the Institute’s Ethical and Biosafety Committee. Sperm cells were isolated by centrifugation on percoll density gradient (Srivastava et al. 2009). After the centrifugation, cells were washed in sperm wash buffer (0.15 mM NaCl and 10 mM EDTA), and pellets were processed for RNA extraction using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). After resuspension of the cells in TRIzol reagent, they were incubated at 60°C for 30 min, vortexed every 10 min for lysis as per standard protocols (Ostermeier et al. 2005; Lalancette et al. 2008a) and manufacturer’s instructions. DNase I (Ambion, USA) treatment was performed on every sample, and RNA was precipitated with ammonium acetate and ethanol. Quantification of RNA was done on UV spectrophotometer. In order to ensure that the RNA obtained was exclusively from the spermatozoa, it was reverse-transcribed to cDNA (described later), and using primers specific for CDH1 and CD45 genes, polymerase chain reaction (PCR) was performed. These genes express only in epithelial and leukocyte cells, respectively, and not in the spermatozoa (Lambard et al. 2004; Lalancette et al. 2008a). Further, presence of DNA was ruled out by PCR using 50-ng total RNA as template and β-actin primers, GenBank accession no. DQ661647 (forward 5′ CAGATCATGTTCGAGACCTTCAA 3′ and reverse 5′ GATGATCTTGATCTTCATTGTGCTG 3′), designed on different exons (Srivastava et al. 2009).

RNA isolation from the tissues and synthesis of cDNA

Total RNA was extracted from testis, kidney, liver, spleen, lung, heart, ovary, and brain using TRIzol following manufacturer’s instructions. These tissues were procured from the local slaughter house, Delhi, India. Following this, approximately 10 µg of RNA each from different tissues and spermatozoa was reverse-transcribed into cDNA using commercially available high-capacity cDNA RT kit (Applied Biosystems, USA). The success of cDNA synthesis was confirmed by PCR reaction of 35 cycles using buffalo-derived β-actin primers.

MASA with oligo based on the consensus of 33.6 minisatellite

Using 22-base-long 33.6 oligo primer (Supplementary Table 1) and cDNA from different tissues and spermatozoa, PCR amplifications were carried out. The reaction conditions involved 95°C denaturation for 5 min followed by 35 cycles each consisting of 95°C for 1 min, 60°C for 1.5 min, and 72°C for 1 min and final extension at 72°C for 10 min. In order to amplify more numbers of 33.6 tagged transcripts, other annealing temperatures between 55°C and 60°C were also used. Approximately, 25 μl of amplified product was resolved on a 20-cm-long, 3% (w/v) agarose gel in 1× TBE buffer at a constant voltage. The resolved bands were sliced from the gel, purified using the Gel extraction kit (QIAGEN), and cloned into pGEMT-easy vector (Promega, USA).

Cloning of amplified fragments, slot-blot hybridization, and sequencing

PCR-amplified fragments were cloned and sequenced after confirmation with restriction digestion (EcoR1 enzyme) and slot-blot hybridization, using α-32P-dCTP-labeled buffalo genomic DNA. For slot-blot hybridization, PCR-amplified inserts were alkaline-denatured and spotted onto the nylon membrane along with buffalo genomic DNA as positive control and cloning vector as negative control. Hybridizations were carried out overnight at 60°C. After hybridization, membranes were washed in 2× saline sodium citrate (SSC) and 0.1% SDS thrice, and signals were recorded by exposure of the blot to X-ray film. Following this, at least three clones from each set were subjected to sequencing. The sequences were deposited in the database, and accession numbers were obtained (Table 1).

Table 1 Details of the mRNA transcripts tagged with consensus of 33.6 repeat loci in water buffalo B. bubalis
Full size table

Database search

The putative identity of sequences was determined using Basic Local Alignment Search Tool (http://www.ncbi.nlm.nih.gov/blast/Blast.cgi; Altschul et al. 1990) and B. taurus build 4 genome database at the National Center for Biotechnology Information (NCBI). Search parameters were set for nucleotide collection (nr/nt) and reference mRNA sequence (RefSeq_rna) optimized for highly similar sequences (megablast). Only trimmed sequences containing 33.6 minisatellite on both ends were used for similarity searches. Table 1 enlists “Transcript ID,” “Score,” “E-value,” “Accession no.,” and “Description” of 29 transcripts. Multiple sequence alignment and phylogenetic tree construction were done using ClustalW program (www.ebi.ac.uk/clustalw). Only sequences that were showing similarity with the characterized genes in the database were taken for phylogenetic analysis. Repeats were calculated using Tandem Repeat Finder. ORF and amino acid sequence identification were done using Translation Tool (http://www.bioinformatics.org/sms/index.html).

Cross-hybridization of MASA-amplified fragments with different species

For cross-hybridization, approximately 500 ng of heat-denatured genomic DNA from 12 different species mentioned earlier were slot-blotted onto the nylon membrane along with cloned plasmid and buffalo genomic DNA as positive control and 2× SSC as negative control. Blots were hybridized with α-32P-dCTP-labeled recombinant plasmids at 60°C overnight, and autoradiography was done following standard procedure (John and Ali 1997).

RT–PCR and relative expression of MASA generated candidate transcripts with real-time PCR

Expression of MASA-amplified transcripts from the tissues and sperm was studied using clone-specific internal primers designed by Primer 3 software and 50 ng cDNA from different tissues. For each RT–PCR reaction, β-actin was used as positive control. Relative expression of cDNA from different tissues and spermatozoa corresponding to 13 mRNA transcripts was studied using real-time PCR (Sequence Detection system, 7000, ABI Prism, CA, USA). Primers were designed using Primer Express 2.0 (Applied Biosystems) software (Supplementary Table 1). Real-time PCR reaction was performed following standard protocol (Pathak et al. 2006; Srivastava et al. 2008). The specificity of each primer pair and efficiency of the amplification were tested by assaying serial dilutions of cDNA. Single melting temperature peak representing a single amplicon validated primer specificity while the slope and R 2 values for serial dilutions affirmed the reactions efficiency. In order to reduce individual variations, normalization of quantitative real-time results was done using endogenous control (GAPDH). To detect potential contamination during preparation of the plate, nuclease-free water was included in each reaction as a negative control. Quantitative real-time PCR reactions were performed in triplicate using 96-well plate in a 20-µl reaction volume, employing conditions of 50°C for 2 min and 95°C for 10 min, followed by 40 cycles each of 95°C for 10 s and 60°C for 1 min. The data were analyzed using threshold setup recommended by Applied Biosystems (http://www3.appliedbiosystems.com/cms/groups/mcb_support/documents/generaldocuments/cms_042176.pdf). The expression status was calculated using the formula \( {\left( {1 + E} \right)^{^{ - \Delta Ct}}} \), where E is the efficiency of PCR and ∆Ct is the cyclic threshold difference between target gene and internal control. To achieve the maximum (one) efficiency of the real-time PCR, the amplicon size was kept small (70–150 bp) so that the expression level of the test gene/transcript remains \( {2^{ - \Delta \Delta Ct}} \). Based on this, expression levels of different mRNA transcripts in buffalo genome were ascertained.

Amplification of full-length buffalo peroxisomal membrane protein 4 CDS using endpoint PCR

Peroxisomal membrane protein 4 (PXMP-4) gene in buffalo represented partial cDNA sequence amplified by 33.6 MASA (EU188605). Full-length buffalo PXMP-4 CDS was generated using primers designed from cattle PXMP-4 sequence (accession no. NM_001099163, XM_869359). Details of primer sequences (transcript ID Dp30) and product size are given in Supplementary Table 1. End point PCR was conducted to amplify 3′ UTR of PXMP-4 gene, and the amplicon so obtained was cloned into pGEMT-easy vector and sequenced. Finally, full-length buffalo PXMP-4 gene sequences were assembled.

Copy number calculation for 33.6 MASA-amplified transcripts

Copy number of two representative mRNA transcripts, Dp10 corresponding to SARS2 gene and Dp26 corresponding to PXMP-4 in buffalo genome, was calculated using SYBR Green chemistry on real-time PCR Sequence Detection System-7000 (ABI, USA). Serial dilutions (10-fold) of buffalo genomic DNA and recombinant plasmids in the range of 300,000,000 to three copies were prepared (haploid genome of buffalo = 3.36 pg, wt per base pair = 1.096 × 10−21 g), and reactions were conducted in triplicate according to standard protocol (Pathak et al. 2006). Primer (Supplementary Table 1) and assay conditions were kept similar to those used for relative expression study.

Chromosomal localization of SARS2 gene by fluorescence in situ hybridization

Buffalo metaphase chromosomes were prepared according to standard protocol (Pathak et al. 2006). Fluorescence in situ hybridization (FISH) was carried out using B. taurus SARS2 (BC140548, MGC: 151512 (IMAGE: 8080720)) bacterial artificial chromosome (BAC) probe (imaGenes GmbH, Germany). The BAC clone was labeled with biotin-16-dUTP nick translation Kit, Vysis (IL, USA). Biotinylated antifluorescein antibody and FITC avidin DCS were obtained from Vector Labs. Reaction was carried out following standard protocol (Premi et al. 2007). Slides were counterstained with DAPI and watched under fluorescence microscope (BX 51, Olympus), and images were captured with CCD camera attached with a video camera mounting adaptor Olympus U-CMAD-2. Chromosomal mapping was done following the ISCNDB 2000 (Cribiu et al. 2001).

Results

In silico analysis of 33.6 minisatellites across the species

To gain an insight into the transcribing genes associated with 33.6 minisatellites, oligonucleotides comprising one (5′CCTCCAGCCCT3′) and two (5′CCTCCAGCCCT CCTCCAGCCCT3′) units of this repeat were used independently to conduct BLAST search. Two units comprising 22 nucleotides did not reveal significant homology with the entries in GenBank whereas one unit comprising 11 nucleotides was found to be present in the flanking and intervening regions of several structural and functional genes across the species (Supplementary Table 2). Though most of the genes in the database were found to be tagged with one unit of 33.6 sequences, the presence of two units across the wider spectrum of genes in any species could not be ruled out. This is because such genes may not yet be part of the database. With this assumption, we used 22-base-long oligonucleotides of 33.6 repeat for genome-wide search of genes employing MASA.

The mRNA transcripts tagged with consensus of 33.6 repeat across different somatic tissues and spermatozoa of buffalo

MASA conducted with 22-base-long oligonucleotides and cDNA from different somatic tissues, gonads, and spermatozoa of buffalo amplified several mRNA transcripts ranging from 200 to 1.0 kb as shown (a representative) in Fig. 1. Prominent bands totaling 161 from all the tissues and spermatozoa were cloned, sequenced, and subjected to database search. Details of each mRNA transcript totaling 29 in the range of 206 to 988 bp uncovered in the present study are given in Table 1 and Supplementary Table 3. ClustalW alignment of the 29 mRNA transcripts showed no intertissue sequence polymorphism.

Fig. 1
figure 1

A representative agarose gel showing minisatellite-associated sequence amplification (MASA) using 22-base-long oligo primer based on consensus of 33.6 repeat loci. cDNA from different somatic tissues and spermatozoa of buffalo amplified by 33.6 primer (a). β-actin primers were used as an internal control (b). Molecular marker 1-kb ladder is given on the left side

Full size image

33.6 tagged mRNA transcripts associated with various transcribing genes

Of the 29 mRNA transcripts identified, BLAST search for 15 transcripts showed sequence homology with flanking or intervening region(s) of transcribing genes involved in signal transduction, cell differentiation, and cell proliferation (see Tables 1 and 2) across the species. The remaining 14 transcripts showed either negligible or nonsignificant homology with the functional genes in the database. However, they did show homology with still uncharacterized BAC clones and contigs (Table 1).

Table 2 Relative expression and copy number assessment of representative MASA-identified mRNA transcripts in different somatic tissues and spermatozoa of buffalo B. bubalis
Full size table

Status of MASA-amplified sequences in different species

Buffalo-derived 33.6 tagged mRNA transcripts were cloned and used as probes for cross-hybridization with genomic DNA from 12 different species. A representative blot is shown in Fig. 2, and the remaining results have been given in Supplementary Table 4. Of the 29 uncovered fragments, 21 showed signals across the species, seven (Dp2, Dp5, Dp6, Dp11, Dp13, Dp24, and Dp28) were specific to bovid, and one (Dp25) was exclusive to buffalo (see Supplementary Table 4). Phylogenetic analyses of 14 corresponding gene fragments (Dp1, Dp2, Dp3, Dp4, Dp9, Dp10, Dp12, Dp17, Dp19, Dp20, Dp21, Dp22, Dp26, and Dp27) showed their close relationship with cattle, but surprisingly one, Dp16, was found to be close to humans. Twelve genes used for phylogenetic analysis are shown in a representative figure (Supplementary Figure 1). Since the remaining 14 mRNA transcripts had no entry in the database, they could not be used for such analysis.

Fig. 2
figure 2

Zoo-blot hybridization to elucidate conservation of 33.6 tagged mRNA transcripts in different species. Cross-hybridization result of representative 13 recombinant clones corresponding to 33.6 tagged mRNA transcripts with genomic DNA of buffalo and 12 other species is mentioned on top of the panel. NC denotes negative control (2×SSC) and PC positive control (recombinant plasmids). Transcript IDs of the sequences used for hybridization are mentioned on the left. β-actin was used as an internal positive control

Full size image

Differentially expressed mRNA transcripts in somatic tissues and spermatozoa

RT–PCR analysis of 29 mRNA transcripts with their internal primers showed varying levels of signals among somatic tissues, gonads, and spermatozoa with respect to 13 mRNA transcripts (Fig. 3) whereas the remaining 16 showed almost uniform signals in all the tissues examined (not shown). Following this, 13 transcripts were subjected to quantitative expression analysis using real-time PCR. Tissue or spermatozoal mRNA transcript(s) that showed lowest expression was used as an internal calibrator (cb). From these 13, nine (Dp1, Dp4, Dp8, Dp10, Dp17, Dp19, Dp20, Dp26, and Dp27) showed the highest expression in spermatozoa (Fig. 4, Table 2). Dp2 showed maximum expression in testis, Dp9 in liver, and Dp22 in lung, suggesting their specific roles in these organs (Fig. 4). Notably, Dp16 showed negligible expression in spermatozoa. Summary of the relative expression (in folds) derived from \( {2^{ - \Delta \Delta Ct}} \) values obtained for various transcripts based on real-time PCR is given in Table 2.

Fig. 3
figure 3

RT–PCR analysis of 33.6 tagged mRNA transcripts. Using internal primers and cDNA from different somatic tissues, gonads, and spermatozoa of buffalo, RT–PCR analysis of 13 representative mRNA transcripts was done. Transcript’s IDs are indicated on left and tissues are mentioned on top of the lanes. β-actin was used a positive control

Full size image
Fig. 4
figure 4

Expressional analysis of the representative 33.6 tagged mRNA transcripts. a–l represents different tissues, gonad, and spermatozoa. Note the maximum expression of some representative mRNA transcripts in the spermatozoa corresponding to Dp1, 4, 8, 10, 17,19, 20, and 26 shown in a, c, d, f, h, i, j, and l), respectively, and exclusive expression of Dp9 in liver (e). Bars represent relative expression of the transcript(s) in folds. Transcript IDs are mentioned on top left corner and tissues, below the panels. For details, see Table 2

Full size image

Isolation and characterization of the buffalo PXMP-4 CDS

Of all the 33.6 tagged transcripts, a 605 bp (Dp26) showed homology with B. taurus PXMP-4 gene along its entire length, representing partial cDNA sequence of PXMP-4 in buffalo. End point PCR with gene-specific cattle PXMP-4 primers amplified 883-bp fragment (accession number EU714054), in buffalo genome (Supplementary Table 1). Complete assembled cDNA sequence of PXMP-4 gene in buffalo was found to be of 1,488 bp (Supplementary Figure 2). In silico analysis (http://www.ncbi.nlm.nih.gov/gorf/gorf.html) of PXMP-4 sequence from nucleotide position 1–555 (negative frame) was found to encode an open reading frame of 184 amino acids with putative conserved domain of approximate molecular weight of 24 kDa. Multiple alignments of buffalo PXMP-4 sequences showed the highest homology with that of cattle, though this gene was present in other species as well (Supplementary Figure 3). Except two units of 33.6 repeat, no other repetition of minisatellite was noticed in the entire sequence.

Buffalo PXMP-4 and SARS2 are single-copy genes

Copy number calculation of two transcripts, Dp10 and Dp26, was done using real-time PCR and SYBR green. Standard curve with slope −3.5 to −3.6 substantiated maximum efficiency of the reaction. Extrapolating the standard curves gave single copy for both the genes per haploid genome (Fig. 5). Chromosomal mapping of Dp10, representing SARS2 gene, was done using FISH and bovine SARS2 BAC probe. As expected, two signals on buffalo metaphase chromosome 18 (Fig. 6a) and interphase nuclei (Fig. 6b) were detected.

Fig. 5
figure 5

Copy number assessment of PXMP-4 and SARS2 genes by real-time PCR. Real-time PCR amplification plots based on 10-fold dilution series of plasmids carrying 33.6 tagged sequences for copy number calculation. a Dp10, showing slope of −3.5 and a single dissociation peak. b Dp26, showing slope of −3.6 and a single dissociation peak, substantiating maximum efficiency of the PCR reaction and high specificity of the primers, respectively, with target cDNA

Full size image
Fig. 6
figure 6

Localization of SARS2 gene on the representative interphase nuclei and metaphase chromosome 18 using FISH. SARS2 BAC probe showing signals on buffalo metaphase chromosome 18 (a) and interphase nuclei (a–e) (b). Note two signals in the interphase nuclei corresponding to those on the homologous chromosomes. Scales are not shown to the micrographs

Full size image

Discussion

Debates whether minisatellites play roles in organism development and evolution have yet to take a decisive turn. However, their presence in the transcribing regions of the genomes has attracted much attention (Morgante et al. 2002; Lalancette et al. 2008b). Current work on buffalo is another stepping stone showing minisatellite tagged with exons, contradicting the earlier notion of their absence in the coding sequences. Consensus sequence of 33.6 repeat loci is distributed ubiquitously in the human (Jeffreys et al. 1985) and several nonhuman genomes (Wickings 1993; Karaca et al. 2002). In an earlier study, two units (5′CCTCCAGCCCT3′)2 of this repeat uncovered genome-specific band pattern in bovid (Azfer et al. 1999). However, Blast search of the same showed its poor association with coding or noncoding region of the gene(s). Since we detected a number of genes from somatic tissues and spermatozoa tagged with two units of 33.6 repeat, it is likely that repeat tagged genes across the species are still not part of the database. Among minisatellite tagged genes, 50–60% (Tables 1 and 2) encode cell wall proteins or proteins that are involved in signal transduction. Such genes encode mostly serine and threonine residues believed to be the site for posttranslational modifications, crucial for maintaining the proteins at cell wall surface (Verstrepen et al. 2005; Richard and Dujon 2006). Presence of these transcripts both in somatic tissues and spermatozoa suggests their more generalized functions. Since buffalo genome is not yet fully sequenced, transcript profile from the current work will add new vistas to the buffalo genomics.

Repeat sequences in a genome may cause reciprocal or nonreciprocal translocations, segmental duplications, gene amplification, and other kinds of chromosomal rearrangements (Richard et al. 2008). In addition, sequence insertion is known to cause genomic diversity (Richard et al. 2008). Exclusive presence of transcript Dp25 in buffalo observed in the present study may be representing an event of sequence insertion. If so, Dp25 mRNA transcript may prove to be an attractive candidate to be analyzed among different breeds of buffalo across the somatic tissues and spermatozoa to ascertain its possible breed-specific origin. Phylogenetic analysis of 33.6 tagged genes in buffalo showed close homology with those of cattle (Supplementary Figure 1). This may not be true for all the genes owing to differences in the genome evolution of the two species. However, such phylogenetic analysis of different breeds of buffalo would be relevant in the context of breed delineation.

Differential expression of most of the transcripts in somatic tissues, gonads, and spermatozoa may be a reflection of programmed sequence modulation required during different stages of development. The highest expression of nine mRNA transcripts in the spermatozoa suggests their possible biological significance in the fertilization events. It is likely that 33.6 repeat tagged with mRNA transcripts acts as transcriptional regulator, leading to qualitative changes in gene expression either by chromatin modification or sequence alterations.

Notwithstanding detection of 29 mRNA transcripts, we characterized two candidate single-copy genes, PXMP-4 and SARS2, showing the highest expression in the spermatozoa. Absence of peroxisomes in the cells of the liver, kidney, and brain has been associated with Zellweger syndrome, a rare, congenital disorder that affects children (Heymans et al. 1983). Analysis of full-length PXMP-4 gene (Supplementary Figure 3) showed that two units of 33.6 repeat are often not conserved, reflecting its polymorphic nature. Similar analysis of all the 33.6 tagged genes in buffalo and other species is envisaged to uncover levels of conservation of this minisatellite, highlighting their possible regulatory roles. Earlier studies have shown the presence of peroxisomes in spermatozoa (Reisse et al. 2001) which is corroborated by our present work on PXMP-4 gene expression. However, no such information is available on SARS2 gene in any species. This evoked our interest to localize this gene on buffalo chromosome using cattle-derived BAC clone.

In humans, several point mutations in SARS of mitochondria lead to inaccurate translation causing sensorineural deafness (Yokogawa et al. 2000; Shah et al. 2001). Mouse mitochondrial SARS shows ubiquitous expression but more in the tissues with high metabolic rate such as heart and liver (Gibbons et al. 2004). Therefore, the lowest expression of this gene in buffalo’s heart and liver was found to be startling. Even more surprising was the highest expression in the spermatozoa. Additional work on this line in buffalo and different species would resolve this issue and strengthen clinical significance of this gene. In addition, expression studies of these genes in genetically infertile animals would prove to be informative for ascertaining their involvement in the control and regulation of in/fertility, if any. This would enrich our understanding on the roles of un/common genes selectively expressing in various somatic tissues and germ line.

In conclusion, our data demonstrate that 33.6 minisatellite is an integral part of various transcribing genes in buffalo genome. The fact that few genes detected in the present study have clinical significance adds additional strength to MASA-mediated approach of genome analysis. Thus, detailed characterization of mRNA transcripts from different somatic tissues and spermatozoa is envisaged to be useful for (1) ascertaining their involvement in regulation of in/fertility, (2) molecular delineation of buffalo breeds, if any, and (3) identification of “superior” germplasm enriching prospects of animal biotechnology. Novel part of the present approach is that several functional, structural, and regulatory genes have been accessed without screening the cDNA library.