1 Correction to: Acta Biotheor (2018) 66:113–133 https://doi.org/10.1007/s10441-018-9324-0
In the original publication of the article, the y axis labels present in Figs. 1a and 2a are incorrect. The correct Figs. 1a and 2a are provided here.
a The assignment of the sequence S = ATGGTGCACCTGACTCCTGA to four sinusoidal functions.b Four-Base-related curve of the sequence S. c A-related curve, G-related curve, T-related curve and C-related curve of the sequence S
a The assignment of the sequence S = ATGGTGCACCTGACTCCTGA to four tangent functions.b Four-Base-related curve of the sequence S. c A-related curve, G-related curve, T-related curve and C-related curve of the sequence S
Author information
Authors and Affiliations
Corresponding author
Rights and permissions
About this article
Cite this article
Xie, GS., Jin, XB., Yang, C. et al. Correction to: Graphical Representation and Similarity Analysis of DNA Sequences Based on Trigonometric Functions. Acta Biotheor 66, 251–253 (2018). https://doi.org/10.1007/s10441-018-9334-y
Published:
Issue Date:
DOI: https://doi.org/10.1007/s10441-018-9334-y