Journal of Plant Research

, Volume 131, Issue 1, pp 91–97 | Cite as

Genetic analysis of Japanese and American specimens of Scirpus hattorianus suggests its introduction from North America

  • Kohei Satoh
  • Kohtaroh Shutoh
  • Takahide Kurosawa
  • Eisuke Hayasaka
  • Shingo Kaneko
Regular Paper

Abstract

Scirpus hattorianus is a possible alien species in Japan, and a clarification of its unclear taxonomy is required to reveal its origin. It is not known whether the plants initially described from Japan represent the same species distributed in North America. To clarify the origin of the species, we attempted to sequence old specimens collected about 80 years ago using newly designed primer pairs specific for short sequences, including the variable sites. Chloroplast sequences of ndhF were compared among Japanese and North American S. hattorianus, and the closely related species, S. atrovirens, S. flaccidifolius, and S. georgianus. We succeeded in sequencing all samples, and two haplotypes were detected in S. hattorianus: one was unique to the species and the other, detected from specimens potentially collected from the same population as the types, was shared by both North American S. hattorianus and two closely related species, S. atrovirens and S. flaccidifolius. Our results suggest that Japanese S. hattorianus is an alien species that was introduced from North America at least twice.

Keywords

Alien species Chloroplast DNA Cyperaceae Herbarium specimens Scirpus hattorianus Taxonomy 

Introduction

Herbarium collections of extinct populations or species provide important samples that can be used to reveal their genetic traits (e.g. Saltonstall 2002). Genetic analyses of old herbarium specimens are, however, not very common probably due to the difficulty of PCR amplification using a degraded template DNA (Savolainen et al. 1995). As a consequence of long periods of sample storage or effects of insecticides, the template DNA is degraded to a small size, due to both enzymatic processes and nonenzymatic hydrolytic cleavage of phosphodiester bands in the phosphate-sugar backbone (for review, see Pääbo et al. 2004). Therefore, DNA extracted from old specimens is often inappropriate for PCR amplification using general universal primers for molecular phylogenetic analyses. The use of a short DNA fragment may provide a solution that enables us to analyze degraded DNA (e.g. Ishida et al. 2012; Valentini et al. 2009). Data from short fragments may provide new insight, especially for species that are extinct or of an unclear origin.

Scirpus hattorianus Makino, a perennial sedge, has unclear origin. Although this species is common in eastern North America (Schuyler 1967a; Strong 1994; Whittemore and Schuyler 2002), it is very rarely reported from Japan, from which it was initially described (Makino 1933; Ohwi 1943). Existing herbarium specimens of Japanese S. hattorianus were collected from the type locality in Fukushima Prefecture only four times between 1929 and 1939 (Kurosawa et al. 2015; Makino 1933), and no specimens had been collected thereafter (Kurosawa et al. 2015) except that Murata (1975) reported it from Shiga Prefecture based on a single specimen (G. Murata 22367, KYO). The specimen cannot be re-identified due to the lack of mature fruits, which are essential for identification. Recently, S. hattorianus was newly reported from eastern Hokkaido (Kato and Fukatsu 2016). In Japanese herbaria only about 40 specimens of S. hattorianus are deposited, most of which were made from cultivated plants between 1929 and 1940 (Kurosawa et al. 2015; Fig. 1). Schuyler (1967a, b) found that these specimens are morphologically indistinguishable from North American specimens.

Fig. 1

An example of old specimens of Japanese Scirpus hattorianus from cultivated plants collected in 1934 (FKSE4193)

Based on the records of its distribution, previous studies have noted the possibility of introduction of S. hattorianus to Japan (Govaerts et al. 2007; Kurosawa et al. 2015; Ohwi 1982; Schuyler 1967a, b; Whittemore and Schuyler 2002). Kurosawa et al. (2015) reported that the transformers and switchboards were purchased from a company in Pennsylvania, which is included in the range of S. hattorianus in North America, when the power plant near the sites of S. hattorianus collection in Fukushima Prefecture was built. They suggested from such circumstantial evidence that the transport of materials from the United States to the collection site in Japan might have led to the introduction of the species via these materials. To date, however, there is no direct evidence that S. hattorianus is a naturalized species in Japan.

We aimed to clarify the origin of S. hattorianus in Japan based on a comparison of the chloroplast ndhF sequence among Japanese and North American S. hattorianus and related species. Léveillé-Bourret et al. (2014) sequenced two plastid regions, matK and ndhF, of North American S. hattorianus and related species. Although the matK sequences showed deficient variation to distinguish S. hattorianus from closely related S. atrovirens Willd., S. flaccidifolius (Fernald) Schuyler, and S. georgianus R.M. Harper, the ndhF sequences exhibited five haplotypes based on ten variable sites among them (Léveillé-Bourret et al. 2014; Table 1). This suggests that the ndhF region can enable us to identify specimens lacking mature fruits (i.e. Murata’s specimen) and might bring us information about the origin of Japanese S. hattorianus. To sequence old herbarium specimens of Japanese S. hattorianus collected about 80 years ago, we designed PCR primers that amplify ndhF sequences including each variable site.

Table 1

Five variable sites in ndhF from North American Scirpus species sequenced by Léveillé-Bourret et al. (2014)

Locality (Accession no.)

Variable sites

H type a

157

274

406

476

512

565

662

854

997

1045

Scirpus hattorianus

 Quebec, Canada (KJ513545)

T

A

G

C

A

G

A

T

C

T

S H

 New Brunswick, Canada (KJ513546)

T

A

G

C

A

G

A

T

C

T

S H

 Quebec, Canada (KJ513547)

T

A

G

C

A

G

A

T

C

T

S H

S. atrovirens

 Ohio, USA (KJ513536)

C

G

G

C

A

A

A

T

A

C

S A

 Wisconsin, USA (KJ513537)

C

G

G

C

A

A

A

T

A

C

S A

S. flaccidifolius

 Virginia, USA (KJ513542)

C

G

G

C

A

A

A

T

C

C

S F

S. georgianus

 Missouri, USA (KJ513543)

C

G

A

T

G

A

M

C

C

C

S G1

 Alabama, USA (KJ513544)

C

G

A

T

G

A

A

T

C

C

S G2

Italics indicate variable sites which we did not sequence

aHaplotype

Materials and methods

Sampling of herbarium specimens

Leaf samples (ca. 10 mm2) were collected from specimens identified as S. hattorianus, S. georgianus, and S. atrovirens by number and length of perianth bristles according to the key and description of Whittemore and Schuyler (2002), except for G. Murata 22367, KYO (“S. hattorianus” from Shiga Prefecture, Japan) which is lacking of mature fruits as mentioned above. The specimens sampled are stored in Gray Herbarium, Harvard University (GH); Herbarium of the Faculty of Symbiotic Systems Science, Fukushima University (FKSE); Kyoto University Museum (KYO); New England Botanical Club Herbarium, Harvard University (NEBC); and Botanical Gardens, Tohoku University (TUS). We did not sample any type specimens, but sampled specimens collected in Fukushima Prefecture are derived from a population where type specimens were collected (Kurosawa et al. 2015). In addition to these samples, we conducted a field study in 2016 to sample S. hattorianus occurring in Hokkaido based on a report by Kato and Fukatsu (2016). Voucher specimens collected in the field study are deposited in FKSE and Fukui Botanical Garden (FUK).

DNA extraction, PCR amplification, and sequence determination

To amplify degraded DNA from old specimens, we attempted to design PCR primers for eight variable sites among S. hattorianus and the most closely related S. atrovirens and S. flaccidifolius in ndhF sequences (Léveillé-Bourret et al. 2014; Table 1), using Primer3 ver 0.4.0 (Untergasser et al. 2012). Although utility of the region for species discrimination should be considered, currently only this region can be used for discrimination of these Scirpus species. We successfully developed five primer pairs, which targeted five of the eight variable sites (Table 2). We also designed PCR primers for the chloroplast region rbcL, rbcL2F (5ʹ-GCC GAA ACA GGT GAA ATC AA-3ʹ), and rbcL2R (5ʹ-CCC GGT TAA GTA GTC ATG CA-3ʹ), based on sequences including several variable sites among Scirpus species in East Asia and North America (Jung and Choi 2010; Muasya et al. 2009). However, the sequences amplified by these primers exhibited no variation among S. hattorianus and the most closely related S. atrovirens, S. flaccidifolius, and S. georgianus, suggesting that these primers were not suitable for the current analysis (S. Kaneko unpublished data).

Table 2

Primer sequences, annealing temperatures, and accession numbers

Primer pair

Primer sequence (5′–3′)

T A a (°C)

Scirpus ndhF 157

F: AGCTACTTTGGCTCTTGCTC

53

 

R: GCAGTTCGAGACGAACCTAT

Scirpus ndhF 274

F: ATAGGTTCGTCTCGAACTGC

49

 

R: CGGTGAATATCCAACAACAG

Scirpus ndhF 406

F: CAAGAATTGCCTTTTTATTGG

48

 

R: TTATCCCGAAAATTGGAGAA

Scirpus ndhF 476

F: CCTTGCCTGTTTCTGGTCTA

48

 

R: TACGCAAATACCCATCAAAA

Scirpus ndhF 512

F: TTGCCTGTTTCTGGTCTAAA

48

 

R: TACGCAAATACCCATCAAAA

aAnnealing temperature

Genomic DNA was extracted using a DNeasy Plant Kit (QIAGEN, Maryland, USA). Polymerase chain reaction (PCR) amplifications were performed following the standard protocol of the Qiagen Multiplex PCR kit (QIAGEN) in a final volume of 8 µl, which contained extracted DNA, 4 µl of 2× Multiplex PCR Master Mix, and 0.2 µl of each multiplex primer. PCR amplifications were performed with the T100 thermal cycler (Bio-Rad, Hercules, California, USA) using the following conditions: initial denaturation at 95 °C for 15 min; 35 cycles of denaturation at 94 °C for 30 s, annealing for 1 min 30 s, extension at 72 °C for 1 min, and a final extension at 60 °C for 30 min. The annealing temperatures of each primer set are shown in Table 2. PCR products were purified using the illustra ExoStar (GE Healthcare Life Sciences UK Ltd, Little Chalfont, UK). The purified products were sequenced directly with an ABI BigDye Terminator Cycle Sequencing Kit ver. 3.1 (Applied Biosystems) on the ABI PRISM 3130 Genetic Analyzer (Applied Biosystems). Electrophoregrams were read and edited using Finch TV (Geospiza, Seattle, Washington, USA). The resulting sequences were deposited in DDBJ/GenBank/EMBL (Table S1). In addition to these resulting sequences, we obtained sequences from S. hattorianus, S. georgianus, S. atrovirens, and S. flaccidifolius, which were analyzed by Léveillé-Bourret et al. (2014). These sequences were aligned using MUSCLE (Edgar 2004). Finally, we compared the aligned sequences on MEGA6.06 (Tamura et al. 2013).

Results

The five variable sites were successfully sequenced among all samples. Each sequence, including the sites, were ca. 71 bp long and we obtained a total of 284 bp to compare between species (Table 3). Consistent sequences were identified among Japanese samples collected from the same locality.

Table 3

Variable sites in ndhF from North American and Japanese Scirpus species, sequenced in the present study and by Léveillé-Bourret et al. (2014)

Species and locality

Variable sites

H type a

157

274

406

476

512

Sequences from the present study (voucher specimens)

 Scirpus hattorianus

  Fukushima, Japan (FKSE4193)

C

G

G

C

A

S A or S F

  Fukushima, Japan (TUS165311)

C

G

G

C

A

S A or S F

  New Hampshire, USA (NEBC00892289)

C

G

G

C

A

S A or S F

  Hokkaido, Japan (FKSE92870)

T

A

G

C

A

S H

  Hokkaido, Japan (FUK6493)

T

A

G

C

A

S H

  Quebec, Canada (GH01153923)

T

A

G

C

A

S H

  Rhode Island, USA (NEBC01160677)

T

A

G

C

A

S H

 S. georgianus

  Maryland, USA (GH01153922)

C

G

A

T

G

S G1 or S G2

  Vermont, USA (NEBC00714505)

C

G

G

T

G

S G3 b

 S. atrovirens

  Pennsylvania, USA (TUS204179)

C

G

G

C

A

S A or S F

  Maine, USA (TUS290662)

C

G

G

C

A

S A or S F

  West Virginia, USA (TUS342027)

C

G

G

C

A

S A or S F

 “S. hattorianus” by Murata (1975)

  Shiga, Japan (KYO [G. Murata 22367])

C

G

A

T

G

S G1 or S G2

Sequence data from Léveillé-Bourret et al. (2014)

 S. hattorianus

T

A

G

C

A

S H

 S. georgianus

C

G

A

T

G

S G1 or S G2

 S. atrovirens

C

G

G

C

A

S A

 S. flaccidifolius

C

G

G

C

A

S F

aHaplotype potentially identical to one detected in Léveillé-Bourret et al. (2014)

bNot detected in Léveillé-Bourret et al. (2014)

Two haplotypes, potentially consistent with S H and S A or S F, distinguished by two substitutions, were detected in S. hattorianus (Table 3). Japanese S. hattorianus each possessed one of these haplotypes: the collection from Fukushima Prefecture (FKSE4193 and TUS16531) and Hokkaido Prefecture (FKSE92870 and FUK6493) possessed potential S A or S F (identical to NEBC00892289) and S H (identical to remaining samples of North American S. hattorianus), respectively (Table 3; Fig. 2). The sequence of the former was identical to S. atrovirens (e.g. KJ513536) and S. flaccidifolius (e.g. KJ513542) in addition to one sample of North American S. hattorianus (NEBC00892289).

Fig. 2

Geographic distribution of Scirpus samples and chloroplast haplotypes of ndhF, investigated in this study and Léveillé-Bourret et al. (2014)

Conversely, the sequences of S. georgianus were consistent. Two haplotypes, S G3 and potential S G1 or S G2, were detected in North American S. georgianus and these were clearly distinguished from those of other species (Table 3). The specimens collected in Shiga Prefecture (KYO [G. Murata 22367]), which were reported to be S. hattorianus, showed identical sequences to haplotype S G1 or S G2 (KJ513543, KJ513544, and GH01153922).

Discussion

Species identification and origin of S. hattorianus based on chloroplast sequences

We could not discriminate S. hattorianus from other related species based on the chloroplast sequence of the ndhF region. Although a previous study reported that North American S. hattorianus carried a specific sequence (Léveillé-Bourret et al. 2014), the additional sample in the present study (NEBC00892289) exhibited a novel haplotype, which is identical to those of S. atrovirens or S. flaccidifolius. Therefore, two haplotypes were detected in North American S. hattorianus: one was unique to the species and the other was shared by related species. Both haplotypes were also detected in Japanese S. hattorianus, complicating the recognition of this species which was originally described in Japan.

We were able to correctly identify S. georgianus using the sequence of the chloroplast ndhF region. The sample from Shiga Prefecture that was reported as S. hattorianus by Murata (1975) showed identical sequence to one haplotype of North American S. georgianus, suggesting that the sample is S. georgianus. Although it was regarded that S. georgianus in Japan had been firstly reported from Kyushu in 1980 (Kurosawa et al. 2015), our results indicated “Scirpus hattorianus” by Murata (1975) is misidentification of S. georgianus.

Scirpus hattorianus from Fukushima Prefecture can be an alien lineage that was introduced from North America, because the samples potentially exhibited haplotype S A or S F, which was shared by North American species, S. atrovirens or S. flaccidifolius, and a North American sample of S. hattorianus. Our results support the previous hypothesis proposed by Kurosawa et al. (2015). If S. hattorianus from Fukushima Prefecture were an independent lineage from North American related species, it would exhibit a specific ndhF sequence, showing that variable sequences are sufficient to distinguish related species in North America.

Scirpus hattorianus in Hokkaido is also likely to be an alien lineage, because its sequences are identical to those of North American S. hattorianus (haplotype S H). Our results were consistent with the hypothesis proposed by Kato and Fukatsu (2016), who reported this species from an unpaved roadside on a farm, and stated that it was an alien species. Recently, naturalization of S. hattorianus has been reported from France (Verloove 2014), suggesting the possibility that this species is able to colonize places outside of North America.

Our morphological and molecular identifications provide some insights about the origin and introduction of Japanese S. hattorianus. Samples from Fukushima are identical to New Hampshire, and those from Hokkaido are probably identical to Quebec, New Brunswick, and Rhode Isl. These results as well as its discoveries in different periods and localities between Hokkaido and Fukushima will suggest at least two independent introductions of S. hattorianus to Japan. However, the original areas are still unclear because we were unable to sufficiently cover the genetic variation of S. hattorianus, especially in North America. Although S. hattorianus is widely distributed in North America (Whittemore and Schuyler 2002), we only analyzed six samples of North American S. hattorianus from limited sites in Canada and USA. Further phylogeographic studies using higher resolution DNA marker in North America can reveal the original area of Japanese S. hattorianus.

Putative cause of discrepancy in the sequencing results for S. hattorianus

We hypothesize two putative reasons to explain why S. hattorianus from Fukushima could not be distinguished from related species by chloroplast sequences. One reason is the occurrence of hybridization between S. hattorianus and related species. In North America, Whittemore and Schuyler (2002) reported hybridization between S. hattorianus and related species, S. atrovirens and S. georgianus. Moreover possible backcrossing between S. hattorianus and its hybrid (S. hattorianus x S. ancistrochaetus) was also reported (Schuyler 1967b). Hybrids or individuals that captured the chloroplast of closely-related Scirpus species might have been introduced to Fukushima Prefecture, and then described as S. hattorianus. Nuclear DNA datasets will reveal the actual state of the hybridization, but at the moment we cannot analyze it due to no nuclear sequence information of these species to develop primers targeting short sequences.

The second reason is due to our deficient numbers of samples, including those of Léveillé-Bourret et al. (2014). The genetic relationships between S. hattorianus and related species are still unclear because the whole distribution area of these species was not covered as mentioned above. Multiple haplotypes could also be produced by parallel mutations or ancestral polymorphisms. In the case of S. hattorianus, we assumed that the possibility of parallel mutation is likely to be low because the haplotypes were distinguished by multiple substitutions. Covering their variation in North America will be needed to reveal parallel mutations or ancestral polymorphisms. In addition, S. atrovirens was reported to show variable chromosome numbers (Strong 1994); however, the chromosome numbers of our samples are unknown. Scirpus atrovirens, showing different chromosome numbers, might possess the same haplotype as S. hattorianus.

Conclusion

In this study, we succeeded in sequencing several Scirpus specimens including old ones, which collected from the type locality of S. hattorianus and detected Japanese S. hattorianus showed two haplotypes, suggesting that at least two introductions occurred to Japan. However, the haplotype of S. hattorianus collected from the type locality was shared by related species in North America, complicating the recognition of the species. A taxonomic reconsideration is needed, as well as additional samples covering the distribution range of S. hattorianus and relative species in North America.

Notes

Acknowledgements

We thank Drs. David E. Boufford, A. R. Brach (Harvard University), M. Maki, K. Yonekura (Tohoku University), H. Nagamasu (Kyoto University), and H. Ikeda (Tokyo University), and Ms. A. Shimizu (Tokyo University), for their cooperation in the collection of specimen samples, and Messrs. K. Fukatsu (Notsuke Peninsule Nature Center) and S. Nemoto (Fukushima University), and Dr. Y. Kato (Kushiro City Museum), for their help in collecting samples. This work was supported by the Research Project of Fukushima University for Regeneration of Harmonies between Human Activity and Nature in Bandai-Asahi National Park.

Supplementary material

10265_2017_976_MOESM1_ESM.docx (21 kb)
Supplementary material 1 (DOCX 20 KB)

References

  1. Edgar RC (2004) MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res 32:1792–1797. doi: 10.1093/nar/gkh340 CrossRefPubMedPubMedCentralGoogle Scholar
  2. Govaerts R, Simpson DA, Goetghebeur P, Wilson KL, Egorova T, Bruhl J (2007) World checklist of Cyperaceae. The Board of Trustees of the Royal Botanic Gardens, Kew, RichmondGoogle Scholar
  3. Ishida Y, Demeke Y, de Groot PJVC, Georgiadis NJ, Leggett KE, Fox VE, Roca AL (2012) Short amplicon microsatellite markers for low quality elephant DNA. Cons Genet Res 4:491–494. doi: 10.1007/s12686-011-9582-5 CrossRefGoogle Scholar
  4. Jung J, Choi HK (2010) Systematic rearrangement of Korean Scirpus L. sl (Cyperaceae) as inferred from nuclear ITS and chloroplast rbcL sequences. J Plant Biol 53:222–232. doi: 10.1007/s12374-010-9109-8 CrossRefGoogle Scholar
  5. Kato Y, Fukatsu K (2016) A new record of Scirpus hattorianus Makino (Cyperaceae) from Hokkaido. J Jpn Bot 91:41–46 (Japanese)Google Scholar
  6. Kurosawa T, Hasunuma K, Kaneko S, Tanaka N, Hayasaka E (2015) Distribution of Scirpus hattorianus and S. georgianus (Cyperaceae) in Japan and the former’s putative North-American origin. Bunrui 15:29–40Google Scholar
  7. Léveillé-Bourret É, Gilmour CN, Starr JR, Naczi RF, Spalink D, Sytsma KJ (2014) Searching for the sister to sedges (Carex): resolving relationships in the Cariceae-Dulichieae-Scirpeae clade (Cyperaceae). Bot J Linn Soc 176:1–21. doi: 10.1111/boj.12193 CrossRefGoogle Scholar
  8. Makino T (1933) A contribution to the knowledge of the flora of Nippon. J Jpn Bot 8:44–45Google Scholar
  9. Muasya AM, Simpson DA, Verboom GA, Goetghebeur P, Naczi RF, Chase MW, Smets E (2009) Phylogeny of Cyperaceae based on DNA sequence data: current progress and future prospects. Bot Rev 75:2–21. doi: 10.1007/s12229-008-9019-3 CrossRefGoogle Scholar
  10. Murata G (1975) Discovery of Scirpus hattorianus in Shiga Prefecture. Acta Phytotax Geobot 27:28 (Japanese)Google Scholar
  11. Ohwi J (1943) Cyperaceae Japonicae, II: A synopsis of the Rhynchosporoideae and Scirpoideae of Japan, including the Kuriles, Saghalin, Korea, and Formosa. Mem Coll Sci, Kyoto Imp Univ. Ser B Biol 18:1–182Google Scholar
  12. Ohwi J (1982) Cyperaceae. In: Satake Y, Ohwi J, Kitamura S, Watari S, Tominari T (eds) Wild Flowers of Japan. Herbaceous plants 1. Heibonsha, Tokyo, pp 145–184 (Japanese)Google Scholar
  13. Pääbo S, Poinar H, Serre D, Jaenicke-Després V, Hebler J, Rohland N, Kuch M, Krause J, Vigilant L, Hofreiter M (2004) Genetic analyses from ancient DNA. Annu Rev Genet 38:645–679. doi: 10.1146/annurev.genet.37.110801.143214 CrossRefPubMedGoogle Scholar
  14. Saltonstall K (2002) Cryptic invasion by a non-native genotype of the common reed, Phragmites australis, into North America. Proc Natl Acad Sci 99:2445–2449. doi: 10.1073/pnas.032477999 CrossRefPubMedPubMedCentralGoogle Scholar
  15. Savolainen V, Cuénoud P, Spichiger R, Martinez MD, Crèvecoeur M, Manen JF (1995) The use of herbarium specimens in DNA phylogenetics: evaluation and improvement. Plant Syst Evol 197:87–98. doi: 10.1007/BF00984634 CrossRefGoogle Scholar
  16. Schuyler AE (1967a) Scirpus hattorianus in North America. Not Nat 398:1–5Google Scholar
  17. Schuyler AE (1967b) A taxonomic revision of North-American leafy species of Scirpus. Proc Acad Nat Sci Philadelphia 119:295–323Google Scholar
  18. Strong MT (1994) Taxonomy of Scirpus. Trichophorum, and Schoenoplectus (Cyperaceae) in Virginia.Bartonia 58:29–68Google Scholar
  19. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: molecular evolutionary genetics analysis version 6.0. Mol Biol Evol 30:2725–2729. doi: 10.1093/molbev/mst197 CrossRefPubMedPubMedCentralGoogle Scholar
  20. Untergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M, Rozen SG (2012) Primer3—new capabilities and interfaces. Nucleic Acids Res 40:e115–e115. doi: 10.1093/nar/gks596 CrossRefPubMedPubMedCentralGoogle Scholar
  21. Valentini A, Miquel C, Nawaz MA, Bellemain EVA, Coissac E, Pompanon F, Gielly L, Cruaud C, Nascetti G, Wincker P, Swenson JE (2009) New perspectives in diet analysis based on DNA barcoding and parallel pyrosequencing: the trnL approach. Mol Ecol Res 9:51–60. doi: 10.1111/j.1755-0998.2008.02352.x CrossRefGoogle Scholar
  22. Verloove F (2014) Scirpus hattorianus (Cyperaceae), newly reported for Europe, naturalized in France. Willdenowia 44:51–55. doi: 10.3372/wi.44.44108 CrossRefGoogle Scholar
  23. Whittemore AT, Schuyler AE (2002) Scirpus. In: Flora of North America Editorial Committee (ed) Flora of North America vol 23. Oxford University Press, Oxford, pp 8–21Google Scholar

Copyright information

© The Botanical Society of Japan and Springer Japan KK 2017

Authors and Affiliations

  • Kohei Satoh
    • 1
  • Kohtaroh Shutoh
    • 1
    • 2
  • Takahide Kurosawa
    • 1
  • Eisuke Hayasaka
    • 3
  • Shingo Kaneko
    • 1
  1. 1.Faculty of Symbiotic Systems ScienceFukushima UniversityFukushimaJapan
  2. 2.Faculty of EducationNiigata UniversityNiigataJapan
  3. 3.Fukui Botanical GardenFukuiJapan

Personalised recommendations