Functional & Integrative Genomics

, Volume 9, Issue 4, pp 513–523 | Cite as

Post-acclimation transcriptome adjustment is a major factor in freezing tolerance of winter wheat

Original Paper

Abstract

Cold-acclimated winter wheat plants were slowly frozen to −10°C, and then the temperature was either maintained at −10°C or was lowered further to −12°C. Expression levels of a total of 423 genes were significantly altered in these treatments; genes upregulated outnumbered those downregulated by about a 9:1 ratio. Sixty-eight genes were upregulated at least fivefold in all freezing treatments; 17 of these 68 encoded transcription factors including C-repeat binding factor (Cbf), WRKY, or other Zn-finger proteins, indicating strong upregulation of genes involved in transcription regulation. Sixteen of the 68 highly upregulated genes encoded kinases, phosphatases, calcium trafficking-related proteins, or glycosyltransferases, indicating upregulation of genes involved in signal transduction. Six genes encoding chlorophyll a/b binding-like proteins were upregulated uniquely in response to the -12°C treatment, suggesting a protective role of pigment-binding proteins in freezing stress response. Most genes responded similarly in the very freezing tolerant cultivar Norstar and in the moderately freezing tolerant Tiber, but some genes responded in opposite fashion in the two cultivars. These results showed that wheat crowns actively adapt as the temperature declines to potentially damaging levels, and genetic variation for this ability exists among cultivars.

Keywords

Cold acclimation DNA array Freezing tolerance Hardiness Transcriptome 

Introduction

Wheat (Triticum aestivum L.) supplies about 20% of the food calories for the world’s population and is a staple in many countries. The per capita consumption of wheat in the USA exceeds that of any other single food source (Anonymous 2002). Each year, millions of kilograms of potential grain yield fail to materialize because of various stress factors that impact the growth and maturation of the plants. One of the most significant stresses is cold temperature and freezing conditions. In a historical survey of wheat crop losses in the Midwestern USA in the years 1956 to 1988, it was reported that the percentage of winter wheat fields that were not harvested due to winterkill averaged 7% over the 33-year period with a high of 22.2% (Patterson et al. 1990). For decades, plant breeders have worked to improve the cold tolerance of winter wheat but, according to the University of Saskatchewan winter wheat production manual, “…since 1929, the total world breeding effort has achieved little or no increase in the winter hardiness of available cultivars…” (Fowler 2002).

The ability of wheat plants to survive freezing is contingent on the effectiveness of two processes, cold acclimation and freezing stress response. Cold acclimation (Thomashow 1999) is a relatively slow, adaptive response of plants to mild cold stress (e.g., +3°C) that results in a plethora of physiological responses that greatly enhance tolerance to more severe conditions (e.g., −15°C). Freezing stress response, as used in this report, refers to responses of previously cold-acclimated plants to those “more severe conditions.” Cold acclimation involves the transcriptional response of at least 450 genes in wheat (Monroy et al. 2007) probably located in all of the chromosomes (Fowler et al. 2005). While cold acclimation of cereal grain plants at low, above freezing temperatures results in large increases in cold tolerance, it has been shown that further improvement of cold tolerance may be realized by further acclimation at nonfatal subfreezing temperatures, a process known as “second phase of hardening” (Livingston 1996) or “subzero acclimation” (Herman et al. 2006). Herman et al. (2006) found that, in wheat plants that had been cold acclimated at +3°C for 3 weeks, then exposed to −3°C for 6 h to 3 days, the level of freezing tolerance increased by more than 2°C, concomitant with significant changes in the messenger RNA (mRNA) expression levels of hundreds of genes. Hence, the exposure of cold acclimated cereal plants to 24 h of −3°C resulted in adaptive changes that conferred improved freezing tolerance, and this adaptation involved broad changes in the transcriptome (Herman et al. 2006). There may be further adaptive responses as the temperature declines further, but nothing is known of transcriptomic changes that may occur as the temperature declines to potentially damaging levels. If the plants actively adapt as the temperature declines, genes involved in transcription regulation and signal transduction would be expected to respond strongly, because rapid and precise regulation of expression of freezing stress response genes would be necessary. Other key genes involved in freezing stress response, such as those encoding cold responsive proteins or osmoprotectants, would also be expected to respond.

The hypothesis motivating this research was that wheat plants actively adjust the transcriptome during the freezing process. Information on transcriptomic changes will provide clues about the mechanisms that are used by the plants to effect response to subfreezing temperatures as they occur, after cold acclimation has taken place. Therefore, the objective of this research was to elucidate the transcriptomic changes that occurred in previously cold acclimated winter wheat plants as the temperature declined to potentially damaging levels.

Experimental

Plant material and freezing treatment

The winter wheat cultivars Norstar (Grant 1980) and Tiber (Kisha et al. 1992) were studied. The LT50, the temperature expected to be fatal to 50% of the plants, has been reported as about −19°C for Norstar (Limin and Fowler 2006) and about −13°C for Tiber (Skinner et al. 2005). Norstar and Tiber are hard red winter wheat cultivars but appear to have no commonality in their pedigrees. Norstar was derived from a cross of Winalta and Alabaskaya (Grant 1980), while Tiber is a selection from Redwin (Kisha et al. 1992). Redwin does not have Winalta or Alabaskaya in its pedigree (Kisha et al. 1992).

Seeds were sown into Sunshine Mix LC1 planting medium (Sun Gro Horticulture, Bellevue, WA, USA) in six-container packs (Model 1020, Blackmore Co., Belleville, MI, USA). Seeds were germinated and seedlings grown at 22°C in a growth chamber (Model E15, Conviron, Pembina, ND, USA) under cool white fluorescent lights (about 300 µmol m−2 s−1 at the soil surface) with a 16-h photoperiod until the seedlings reached the three-leaf stage. The plants were then transferred to 3°C with an 8-h photoperiod (about 250 µmol m−2 s−1 at mid-plant height) for 4 weeks to induce cold acclimation. Plants were irrigated weekly with nutrient solution containing macro and micronutrients (Peters Professional, Scotts Co., Camarillo, CA, USA).

The crowns (meristematic regions) of the plants were subjected to controlled freezing episodes as follows. The soil was washed from the plants using ice water, the residual caryopsis, roots, and shoots were removed, and six crowns (each about 5 mm in length) were blotted dry with paper towels and placed in 2 ml microcentrifuge tubes. One tube was frozen immediately in liquid nitrogen and stored at −80°C (Treatment 1, Fig. 1). Other tubes containing six crowns were transferred to a computer-controlled low temperature alcohol bath (Model F25 MV controlled by EasyTemp software, Julabo, Vista, CA, USA) at 0°C. The temperature was lowered at a rate of 1.5°C h−1. Tubes were removed from the alcohol bath and frozen in liquid nitrogen when they had been exposed to one of three conditions: when the temperature reached −10°C (treatment 2, Fig. 1); when the temperature reached −10°C and was held at −10°C for 1.3 h (treatment 3, Fig. 1), or when the temperature reached −12°C (Treatment 4, Fig. 1). Because the rate of temperature decline was 1.5°C h−1, the time required to cool from −10°C to −12°C was 1.3 h; hence, plant crowns in treatments 3 and 4 (Fig. 1) were exposed to subfreezing temperatures for equal amounts of time. Each temperature treatment was replicated three times on plants grown independently at different times. Samples were stored at −80°C. A duplicate set of tubes with the roots removed from the plants and the shoots trimmed to about 2-cm length was included with two of the trials to determine whether the temperature treatments were fatal to the plants. These plants were removed from the freezing bath, allowed to thaw overnight on ice, then planted into moist Vermiculite in closed plastic boxes, and incubated at 25°C with a 16-h photoperiod. Plants were assessed for survival after 5 days.
Fig. 1

Winter wheat cultivar Tiber plants were subjected to cold acclimation and then freezing episodes as indicated. Samples were collected at the time points numbered 1–4

RNA extraction and microarray interrogation

To extract RNA, the six plant crowns that had been frozen in liquid nitrogen and stored at −80°C were homogenized in liquid nitrogen using a mortar and pestle; RNA was extracted using 1.5 ml of Trizol reagent and the standard protocol (Invitrogen, Carlsbad, CA, USA). RNA was quantified with UV spectrophotometry and stored at −80°C. About 40 μg RNA was recovered from six plant crowns.

Global gene expression levels were assayed with the GeneChip® Wheat Genome Array (Affymetrix, Santa Clara, CA, USA). This array contains 61,127 probe sets representing 55,052 transcripts for all 42 wheat chromosomes (http://www.affymetrix.com). RNA labeling and hybridization to the Affymetrix arrays and post-hybridization scanning and data pre-processing was conducted by the Washington State University Biotechnology Core Facility. Three independent sets of RNA samples were analyzed for each temperature treatment (total of 12 microarray chips). The data files were further analyzed using “Flexarray” software (Blazejczyk et al. 2007). The microarray data were normalized using the “robust multi-chip average” method, and probe sets showing significant differences in hybridization intensity among treatments were sought using the empirical Bayes analysis due to Wright and Simon (algorithm EB Wright & Simon) available in the Flexarray software. The GenBank identifiers of the sequences that the probe sets were designed to identify were obtained from the GeneChip information file provided by Affymetrix. Tentative functions of genes of interest were sought through BLASTN searches of the GenBank nonredundant database (http://blast.ncbi.nlm.nih.gov). In the event the BLASTN algorithm returned only genes of unknown function, translated searches (BLASTX and TBLASTX) were also performed. Genes with no significant match to GenBank entries were also used as queries in BLASTN searches of the TIGR plant database (http://www.tigr.org).

Quantitative real-time PCR

Quantitative real-time PCR (qPCR) was used to confirm expression level changes of selected genes. The Protoscript II kit (New England Biolabs, Ipswich, MA, USA) was used to synthesize complementary DNA (cDNA). The cDNA synthesis reactions were initiated with 1 µg RNA that had been treated with RNase-free DNase I (Ambion, Austin, TX, USA) according to the manufacturer’s protocol and were primed with the anchored oligo dT primers provided in the Protoscript II kit. Synthesis was according to the manufacturers’ protocol, except that the reactions were allowed to proceed for 100 min instead of 60 min. The completed 20 µl cDNA syntheses were diluted to 50 µl with nuclease-free water and stored at −20°C. This template cDNA was diluted 1:10 prior to use, and 1 µl of the resulting solution was used as template for qPCR. The PCRs were conducted on an Applied Biosystems (Foster City, CA USA) 7300 Real-Time PCR System using 25-µl preparations that consisted of 1× Go-Tag® Colorless Master Mix (Promega, Madison, WI, USA), 1 µl cDNA, 200 µM each primer, 0.85× SYBR Green I (Invitrogen, Carlsbad, CA, USA), and 300 nM ROX dye (Roche, Indianapolis, IN, USA) as a passive fluorescence standard. The qPCR software available with the instrument was used to determine the Ct, the fractional cycle number at which the fluorescence intensity reached an arbitrary threshold, using the threshold determined by the software. Relative fold change was determined using the delta–delta Ct method as described by Dussault and Pouliot (2006) using the Cbf1B gene amplicon resulting from the primers described by Vagujfalvi et al. (2005) as an endogenous control. These Cbf1B primers result in amplification of fragments of multiple Cbf genes (Vagujfalvi et al. 2005). In the temperature treatments used in the current study, the result of that amplification was very uniform across treatments (see Supplementary Figure 1S) and was used as a constant-expression benchmark. Downregulation was expressed as the negative reciprocal of the fractional fold change as recommended (Jankowska et al. 2008; Turtinen et al. 2005).

Primers for quantification of CBF gene expression were those described by Vagujfalvi et al. (2005). Primers for other genes assayed with qPCR were designed using the online tool BatchPrimer3 (http://probes.pw.usda.gov/cgi-bin/batchprimer3/batchprimer3.cgi) and are shown in Table 1. An amplicon length of about 100 bp and primer melting temperatures of about 60°C were specified. The PCR amplification profile was 3 min at 95°C, then 55 cycles of 95°C for 30 s, 55°C for 25 s, and 72°C for 30 s. A dissociation curve was generated for each primer pair to confirm that a single PCR product was generated. Products of each primer pair also were assayed on a 1% agarose gel (Seakem LE, FMC Corp., Philadelphia, PA, USA) at least once to again confirm that a single product had been generated. Primer pairs that resulted in amplification of multiple products were discarded. Each qPCR assay was repeated three times.
Table 1

Genes and primers used in quantitative real-time PCR to assay expression levels in wheat plants exposed to three freezing conditions

Probe seta basis (GenBank accession)

Sequences of primers used for qPCR

Forward

Reverse

BQ172277

TCTAGCGGTCCTTTGCTTGT

CGGAGCTCAAGGTGAAAGAG

CA614891

GCGCGTCGTAGGTTTAGTTT

TTTTGGGACGGATGGAGTAG

CA623997

AAGAATCCGTGCAAAAGCAT

CCAGTGCACAAGTCGTTGTC

CA626272

TTCCCTCTTCCATCACCAAC

CTCGCATTTGATGTCCTCCT

CA666957

TTTAGTCCCCCTTGGAGCTT

GAACTTGCAGGCATGTATCG

CA674427

ACCCATGCACACATCCATAA

TGTAGTAAAAACGCGCCAAA

CA692019

CCTACGGGGAGAACCTCTTC

CCGTGGTCGTAGTACTGCTT

CK211276

ACCAAACAGCCTCACCAAAC

AACTCGAGGTGATCCACTGC

CK212505

ATGCGTTGTTGTTGACTGGA

TTCTCCATGTTCGGCTTCTT

CK216032

GAGAAAAGCTAGCGCAGGAA

AGACACAGCAACGCAACATC

aProbe set used in the Affymetrix GeneChip® Wheat Genome Array

Results

All of the plants that had been frozen in each of the temperature treatments and then allowed to recover produced robust leaf growth after 5 days, indicating that the RNA used in this study was extracted from crowns of plants that were still alive.

Global transcriptome changes in response to freezing treatments

The principal component analysis of the Affymetrix microarray data revealed that tremendous gene expression changes occurred in the crowns of the plants as they were cooled to −10°C, and more changes occurred in the plants as they were held at −10°C for 1.3 h. Somewhat different expression changes occurred as the plants were further cooled to −12°C (Fig. 2). Relative to the control (treatment 1, Fig. 1), a total of 423 genes changed expression level at least twofold (statistically significant at P < 0.05) during the three freezing treatments. Within each treatment, the numbers of genes that changed expression level were as follows. As the crowns were cooled from 0°C to −10°C at 1.5°C h−1 (Treatment 2, Fig. 1), 344 genes were upregulated and 39 were downregulated. In the crowns that were cooled to −10°C and then held at −10° for 1.3 h (treatment 3, Fig. 1), 298 genes were upregulated and 33 were downregulated, suggesting that at least 46 genes that were upregulated as the temperature declined to −10°C were reduced in expression as the plants were held at −10°C for 1.3 h and that three genes that had been downregulated as the temperature declined increased expression as the plants were held at −10°C. In the crowns that were cooled to −12°C (Treatment 4, Fig. 1), 258 genes were upregulated and 29 were downregulated, suggesting that at least 86 genes that were upregulated as the temperature declined to −10°C were reduced in expression as the plants were further cooled to −12°C over 1.3 h, and ten genes that had been downregulated as the temperature declined increased expression as the plants were cooled further. The relationships of these genes are illustrated in Fig. 3. The expression level fold changes and identifications of these 423 genes are provided in Supplementary Table S1.
Fig. 2

Principal component analysis plot of transcriptome expression in crown tissue of winter wheat cultivar Tiber plants exposed to the indicated freezing conditions

Fig. 3

Venn diagram of genes responding specifically or in common to three freezing conditions in crown tissue of winter wheat cultivar Tiber plants. Numbers indicate the total of genes responding significantly, including those that were upregulated and those that were downregulated

To better understand the nature of the genes responding to these freezing treatments, the most strongly responding were investigated further. A total of 68 genes were upregulated at least fivefold (significant at P < 0.01) in all three cold temperature treatments, relative to the control. A summary of these genes is provided in Table 2, and a full description is provided in Supplementary Table S2. The putative functions of these genes were established to the extent possible by identifying homology to genes of known function in GenBank. Of these 68 genes, 17 (25%) were C-repeat binding factor (Cbf), WRKY, or Zn-finger genes (Table 2). Zn-finger proteins function in binding various biomolecules, including DNA and RNA (Laity et al. 2001, Wolfe et al. 2000) and thereby can function as transcription factors. Cbf (Fowler and Thomashow 2002) and WRKY (Eulgem et al. 2000) proteins also function as transcription factors; thus, as much as 25% of the genes strongly upregulated in response to the three subfreezing treatments may have been involved in transcription regulation.
Table 2

Sixty-eight wheat (Triticum aestivum) genes that were indicated from Affymetrix microarray analysis as upregulated at least fivefold as cold-acclimated wheat plants were exposed to freezing treatmentsa

Number of genes

Probe set bases (GenBank accession)

Related to

4

AF181661.1, BJ272451.1, BQ162281.1, CA498188.1

Calcium trafficking

1

BE516383.1

dehydrogenase

1

BQ169503.1

F-box

6

CK192888.1, CK193135.1, CK194114.1, CK195062.1, CK200985.1, CK214385.1

glycosyltransferase

1

AL828817.1

Heat shock

2

CA730802.1, CK200303.1

Histone

2

CA731347.1, CA615595.1

Z. mays long-cell

2

BF199967.1, BJ230300.1

Lyase

3

CK214034.1, BQ172227.1, CD872545.1

Membrane protein

6

AL829285.1, BQ168712.1, BT008938.1, CA604824.1, CA639632.1, CK207520.1

Phosphatase, kinase

1

BJ321266.1

Ribosomal

3

BJ315637.1, CA666137.1, CA730299.1

Cold induced

1

BQ801759.1

tubulin

7

BJ278480.1, BQ483742.1, BQ802663.1, CA652153.1, CK211677.1, CK213889.1, D16416.1

Zn-finger protein

7

BQ801587.1, CD453611.1, CD492203.1, CK211510.1, CK211571.1, CK214542.1, CK214676.1

Cbf transcription factors

3

CA624333.1, CD935984.1, CK163938.1

WRKY transcription factors

18

AL828936, AL830288, BJ212029, BJ316004, BJ316053, BQ802439, CA484005, CA593923, CA604124, CA609153, CA621140, CA625729, CA652933, CA727379, CD937104, CD938201, CK212624, CK214945

Unknown

aIsolated crown tissue was exposed to temperature reduced from 0 to −10, reduced from 0 to −10°C, and held at −10°C for 1.3 h, or reduced from 0 to −12°C at 1.5°C h−1. All genes listed were upregulated fivefold or more (significant at P < 0.01) in each of these treatments

Six of the 68 genes (8.8%) encoded kinases or phosphatases, four (5.9%) were involved in calcium trafficking, and six of the genes (8.8%) encoded glycosyltransferases (Table 2). The upregulation of these 16 genes suggested activation of numerous genes with functions that are hallmarks of intracellular signaling. Considered together with the transcription factors, these results suggested that nearly half of the genes strongly upregulated by the freezing treatments were involved in signal transduction or transcription regulation (33 of 68 genes, 48.5%).

Eight of the 68 genes had significant homology to genes encoding dehydrogenases, heat shock proteins, cold-induced proteins, or membrane-associated proteins (Table 2). Upregulation of each of these kinds of proteins have been identified as stress-responsive in various systems, indicating that the wheat plants were actively responding to the decreasing temperature. Interestingly, two genes with homology to the Zea mays long cell protein were strongly upregulated in all freezing treatments (CA731347.1 and CA615595.1, Table 2). The long cell protein is associated with failure of Z. mays embryo development and cell death (Bastida et al. 2006).

Eighteen of the strongly upregulated genes did not have significant homology to other known genes and thus remain of unknown function (Table 2).

Transcriptomic differences between freezing treatments

Significant differences in expression levels of a total of 33 genes were found in comparisons of the three freezing treatments. A summary is shown in Table 3, and full descriptions are provided in Supplementary Table S3.
Table 3

Genes that were expressed to significantly different levels in crown tissue of Tiber winter wheat plants after three freezing treatments as indicated by Affymetrix microarray analysis

Probe set basisa (GenBank Accession)

Expression changeb in treatment

−10, 1.3 h vs. −10

−12 vs. −10

−12 vs. −10, 1.3 h

Description

Upregulated in −12 treatment

CK216367, CA722522, BQ172277, CK167182, CK212505

Unch.

Up

Unch.

Chlorophyll a/b binding

CA623997

Unch.

Unch.

Up

Chlorophyll a/b binding

CA692019

Unch.

Unch.

Up

Pathogenesis-related

CA666957

Down

Unch.

Up

Pathogenesis-related

CA674427, CA626272

Down

Unch.

Up

Unknown

Downregulated in -12 treatment

CD939794

Unch.

Unch.

Down

Subtilase

BJ317378

Unch.

Unch.

Down

Membrane protein

CK197465

Unch.

Unch.

Down

Glycosyltransferase

CA630268

Unch.

Down

Unch.

Phosphatase

CK206047

Unch.

Down

Unch.

DNA binding

CA730838

Unch.

Down

Unch.

RNA polymerase

CA630461, CA731241

Unch.

Down

Unch.

Unknown

CA631131

Unch.

Down

Unch.

Membrane protein

Downregulated in freezing treatment in excess of -10°C

BJ240857

Down

Down

Unch.

Ribosomal

BJ252851

Down

Down

Unch.

Unknown

CA739104, CA633933

Down

Down

Unch.

Acetyltransferase

AL830045

Down

Down

Unch.

Calcium binding

CA721628

Down

Down

Unch.

Tumor protein

CK153702

Down

Down

Unch.

Alpha tubulin

BE416292

Down

Down

Unch.

Kinase

CA614891

Down

Unch.

Unch.

WRKY

CK195532

Down

Unch.

Unch.

Glycosyltransferase

CA614315

Down

Unch.

Unch.

Calcium binding

BJ214711, BM134662, BJ251771

Down

Unch.

Unch.

Unknown

For freezing treatments, temperature reduced at 1.5°C h−1 from 0 to −10°C and then held at −10°C for 1.3 h or reduced from 0 to −12°C.All fold changes indicated were significant at P < 0.05

aProbe set refers to the oligonucleotide probes on the Affymetrix array

bThe direction of the fold changes indicate the expression level in the first treatment listed compared to the second

Unch unchanged

Treatment 2 vs. treatment 3

In comparing gene expression changes in Tiber crowns that had been cooled to −10°C to crowns that were cooled to −10°C and then held at that temperature for 1.3 h, 16 genes were downregulated at least twofold (P < 0.05) during 1.3 h, but none were upregulated (−10°C, 1.3 h vs. −10°C, Table 3). Six of these 16 had no significant similarity to genes of known function (Table 3). The remaining ten genes were of diverse function, including structural (alpha-tubulin, chloroplast ribosomal), biochemical process (glycosyltransferase, acetyltransferase, kinase, and Ca++ binding protein), transcription (WRKY45), and defense (translationally controlled tumor protein and a pathogenesis-related protein) (Table 3). The significant downregulation of this diverse set of genes and the observation that no genes were significantly upregulated in this comparison suggested that a general, orderly shutting down of the plants’ metabolism occurred as the plants were held at −10°C for 1.3 h.

Treatment 2 vs. treatment 4

In contrast, as the temperature was lowered from −10°C to -12°C, five genes were significantly upregulated (−12 vs. −10°C, Table 3). The five upregulated genes (BQ172277, CA722522, CK167182, CK212505, and CK216367, Table 3) were each upregulated essentially twofold, and each was identified as chlorophyll a/b binding proteins (Table 3).

In addition to the five upregulated genes, 13 genes were downregulated as the plants were cooled from −10°C to −12°C (Table 3). Eight of these 13 were the same genes that had been identified as downregulated as plants were held at −10°C for 1.3 h (Table 3). The additional six downregulated genes as well as the occurrence of eight genes downregulated as the plants were held at −10°C for 1.3 h but not downregulated as plants were cooled from −10°C to −12°C (Table 3) further suggested the plants adjusted the transcriptome differently in response to the two kinds of freezing stress.

Treatment 3 vs. treatment 4

In comparing crowns frozen to −12°C to crowns held at −10°C for 1.3 h, three genes were significantly downregulated and five genes were upregulated (−12 vs. −10°C, 1.3 h, Table 3). qPCR was used to further evaluate expression of the five upregulated genes. In each case, the qPCR results supported the microarray results (Table 4). Two of these five genes were significantly similar to pathogenesis-related protein genes, one apparently encoded another chlorophyll a/b binding protein, and two were of unknown function (Table 4). The two pathogenesis-related protein genes, present in GenBank as accessions M95500 and DQ167191.1, shared no significant similarity according to the BLAST alignment of the two nucleotide sequences (not shown). This observation clearly indicated that two unrelated stress-responsive genes were upregulated as the temperature declined from −10°C to −12°C but not when the temperature was maintained at −10°C for 1.3 h. The three downregulated genes were not significantly up- or downregulated in any of the other comparisons (Table 3).
Table 4

Fold changes measured by quantitative real-time PCR of five wheat genes of the cultivar Tiber that were indicated from microarray analysis as upregulated at least twofold as cold-acclimated crown tissue was cooled from −10 to −12°C at 1.5°C h−1

Probe set basisa (GenBank accession)

Expression fold change relative to control as plants

Maintained at −10°C for 1.3 h

Cooled from −10 to −12°C over 1.3 h

CA623997

−1.6 ± 0.11

2.8 ± 0.62

CA626272

1.6 ± 0.23

4.5 ± 0.68

CA666957

2.1 ± 0.02

3.6 ± 0.17

CA674427

−1.4 ± 0.12

1.5 ± 0.17

CA692019

−1.5 ± 0.40

3.2 ± 0.01

aPutative function assignments were as follows: CA623997, chlorophyll binding protein precursor; CA692019 and CA666957, pathogenesis-related proteins; all others, unknown function

Thus, in comparisons among the three freezing treatments, gene upregulation was evident only when the plants were frozen to −12°C (Table 3). A total of ten genes were significantly upregulated; six of those ten were identified as chlorophyll a/b binding protein genes, two were related to defense, and two were of unknown function (Table 3). This result showed that the plants responded differently to cooling from −10°C to −12°C, compared to remaining at −10°C for the same length of time required to cool to −12°C.

Cbf gene expression during freezing

Because Cbf genes were indicated as strongly upregulated in each of the freezing treatments in the microarray analysis, qPCR was used to evaluate expression of seven Cbf genes in the very freezing-tolerant Norstar and the moderately freezing-tolerant Tiber cultivar exposed to each of the four temperature treatments (Fig. 1). The seven Cbf genes were strongly upregulated in both cultivars in each of the temperature treatments, some many-fold, consistent with the microarray results (Table 5). Most of the Cbf genes were strongly upregulated in Norstar and Tiber as the temperature was decreased to −10°C, then expression declined as the temperature was held at −10°C or was further reduced to −12°C (Table 5). An example (Cbf7) is shown in Fig. 4a. However, Cbf2c1 behaved in an opposite fashion; it was moderately upregulated as the temperature was decreased to −10°C but then continued to increase in expression level as the temperature was held at −10°C or was further lowered to −12°C (Table 5, Fig. 4b). In comparing Norstar to Tiber, similar expression level increases were seen with Cbf2c1and Cbf4A, the Cbf7gene increased expression somewhat more in Norstar than Tiber, and the remaining four of the seven Cbf genes assayed increased expression much more in Tiber than in Norstar (Table 5).
Table 5

Expression level changes of C-repeat binding factor (Cbf) genes in wheat (Triticum aestivum) in response to three freezing treatments

 

Temperature Treatment; frozen to °C

Expression fold change relative to control in cultivar

Gene

Norstar

Tiber

Cbf1A

−10

224.0 ± 54.9

500.2 ± 137.9

−10 + a

90.2 ± 14.2

483.8 ± 154.3

−12

89.7 ± 8.3

256.1 ± 66

Cbf1C

−10

36.6 ± 8.4

103.1 ± 10.7

−10+

20.6 ± 2.5

94.1 ± 16.2

−12

9.8 ± 2.5

25.4 ± 4.5

Cbf2B

−10

15.0 ± 3.3

56.5 ± 27.4

−10+

6.0 ± 0.7

16.7 ± 1.2

−12

5.0 ± 0.8

7.5 ± 2.2

Cbf2C1

−10

1.6 ± 0.1

1.6 ± 0.3

−10+

2.4 ± 0.3

4.2 ± 0.3

−12

3.2 ± 0.1

4.4 ± 0.4

Cbf4A

−10

2.3 ± 0.5

2.6 ± 1

−10+

2.3 ± 0.8

1.9 ± 0.6

−12

−1.01 ± 0.01

−1.1 ± 0.3

Cbf5

−10

85.2 ± 48.1

382.3 ± 70.6

−10+

87.0 ± 22.9

407.0 ± 88.7

−12

50.3 ± 0.5

216.0 ± 38.1

Cbf7

−10

20.3 ± 4.6

13.5 ± 1.1

−10+

18.7 ± 2.7

12.1 ± 1.4

−12

9.7 ± 1

8.9 ± 1.4

a−10+ indicates plants frozen to −10° at 1.5°C h−1, then held at −10°C for 1.3 h

Fig. 4

Diagram of expression fold changes relative to the control of two C-repeat binding protein (Cbf) genes in crown tissue of winter wheat cultivar Norstar or Tiber plants exposed to three freezing conditions. a Cbf7 and b Cbf2c1

Transcriptomic response of selected genes to freezing treatments

The expression levels of five additional genes were examined with qPCR in Norstar and Tiber exposed to the three freezing treatments. Two of the genes, identified as chlorophyll a/b binding protein genes (GenBank accessions CK211276 and CK212505) responded in opposite fashion to the freezing treatments. While CK211276 was moderately downregulated in all freezing treatments in both cultivars, CK212505 was moderately upregulated (Table 6). A gene (GenBank accession CK216032) with significant similarity to several genes encoding light-inducible proteins was strongly upregulated in Norstar in response to the freezing treatments but was downregulated in Tiber (Table 6). The other two genes assayed, GenBank accessions BQ172277 and CA614891, were of unknown function. BQ172277 was upregulated in both cultivars after the three freezing treatments (Table 6). CA614891 was upregulated in Tiber after freezing to −10°C but then downregulated after further exposure to subfreezing temperatures (Table 6). In Norstar, CA614891 was downregulated after each of the freezing treatments (Table 6).
Table 6

Expression level changes of five genes in crown tissue of winter wheat cultivar Tiber in response to three freezing treatments

Gene

Putative function

Temperature treatment; frozen to °C

Expression fold change relative to control in cultivar

Norstar

Tiber

BQ172277

Unknown

−10

4.3 ± 1.6

2.6 ± 0.89

−10+a

14.0 ± 5.2

3.2 ± 0.71

−12

3.9 ± 1.4

2.0 ± 0.17

CA614891

Unknown

−10

−1.8 ± 0.2

4.7 ± 1.7

−10+a

−1.8 ± 0.2

−2.3 ± 0.1

−12

−4.2 ± 0.1

−1.4 ± 0.1

CK211276

Chlorophyll a/b binding protein

−10

−1.7 ± 0.2

−1.6 ± 0.1

−10+a

−1.2 ± 0.02

−1.5 ± 0.1

−12

−2.0 ± 0.2

−1.6 ± 0.2

CK212505

Chlorophyll a/b binding protein

−10

1.9 ± 0.4

2.7 ± 0.7

−10+a

3.4 ± 0.2

1.5 ± 0.2

−12

1.7 ± 0.1

5.5 ± 0.9

CK216032

Light-inducible protein

−10

30.4 ± 10.2

−4.5 ± 0.1

−10+a

58.1 ± 39.9

−1.5 ± 0.3

−12

9.9 ± 7.0

−4.6 ± 0.1

a−10+ indicates plants frozen from 0 to −10° at 1.5°C h−1, then held at −10°C for 1.3 h

Discussion

The results presented in this study demonstrated that cold-acclimated wheat plants effect large changes of the transcriptome in crown tissue during the process of freezing. The expression levels of 423 genes changed significantly; genes that were upregulated outnumbered genes that were downregulated by about a 9:1 ratio. This number of genes (423) is remarkably similar to the 443 genes Herman et al. (2006) found to respond uniquely to sub-zero acclimation at −3°C. Herman et al. (2006) used wheat RNA to interrogate the Affymetrix barley chip; so direct comparison of our results to theirs is not possible. Nonetheless, in view of the results reported by Herman et al. (2006), it is virtually certain that many of the genes identified in this study responded to the onset of cold and probably were up- or downregulated well before the temperature reached −10°C. However, we also found a number of genes whose expression levels changed significantly as the plants were incubated at −10°C or were further cooled to −12°C (Table 3), suggesting that a response mechanism exists that results in modulation of the transcriptome at temperatures well below freezing.

Eight of the 68 genes strongly upregulated in all freezing treatments encoded protein products typically upregulated in response to various stress factors. This result demonstrated that the wheat crown tissue actively mobilized stress response mechanisms while the temperature was declining. The upregulation of two genes with significant homology to the Z. mays long cell gene, a gene associated with embryo abortion and cell death, was suggestive of the initiation of apoptosis.

Nearly half of the most strongly upregulated genes identified in this study appeared to be involved in signal transduction or transcription regulation, including Cbf genes. Cbf genes encode transcription factors that influence the expression of many other genes (the Cbf regulon) and have long been known as crucial to cold acclimation of wheat at above freezing temperatures (Galiba et al. 2009). Typically, the expression of the Cbf genes (Kume et al. 2005) and the genes they regulate (Kobayashi et al. 2004; Ganeshan et al. 2008) rapidly increase expression in response to low, above-freezing temperature, and then decrease expression with time at constant low temperature. In this study, we demonstrated that expression of Cbf genes in cold acclimated plants greatly increased as the temperature declined to below freezing, potentially damaging levels. This result extends the influence of the Cbf regulon to include freezing stress response in addition to cold acclimation in wheat. Because the LT50 of Tiber is about −13°C and that of Norstar is about −19°C, freezing to −12°C constituted exposure of Tiber to about 90% of its LT50 temperature, but Norstar was exposed to only about 60% of its LT50 temperature. The greater increase in expression in Tiber than in Norstar of most of the Cbf genes (Table 5) and the differential expression of other genes (Table 6) between the two cultivars suggested that gene expression is modulated in accordance with the level of freezing stress, as may be estimated by the percentage of LT50 imposed.

The finding of increased expression of genes encoding chlorophyll a/b binding protein in crown tissue frozen to −12°C was unexpected. Chlorophyll a/b binding proteins are part of the light-harvesting complex within the chloroplasts, but we studied crown tissue, the meristematic region of the plant, where the plastids are largely undifferentiated (Mullet 1988) and not expected to be a site of photosynthesis. Therefore, it seems unlikely that freezing stress response in the crown tissue would involve upregulation of genes encoding structural parts of the light harvesting mechanism. Satoh et al. (2001) reviewed chlorophyll a/b binding-like proteins and concluded that, although certain of these proteins are capable of binding chlorophyll, their relatively low affinity for chlorophyll and characteristic stress inducibility “suggested little contribution to photosynthesis” but, rather, suggested a “protective role during stress conditions.” Some genes encoding chlorophyll a/b binding-like proteins contain motifs suggestive of a protease inhibitor function (Satoh et al. 2001). Although no proteases specifically inhibited by the chlorophyll a/b binding-like proteins have yet been identified, the occurrence of these motifs further suggests a protective role, rather than a role in photosynthesis (Satoh et al. 2001).

Overall, these results suggested that a significant part of the ability of wheat plants to survive freezing may be determined by their ability to adjust the transcriptome in crown tissue as the temperature is decreased to potentially damaging levels. Variation in numbers of copies of mRNA transcripts does not, by itself, confer greater freezing tolerance. Significant variation in activity of gene products is necessary to contribute to changes in freezing tolerance. How much metabolic activity is happening in a wheat crown as it cools to −10°C or −12°C is unknown. However, it was reported previously that significant changes in the levels of various carbohydrates occurred in crowns of barley (Hordeum vulgare L.) and oat (Avena sativa L.) plants incubated at −3°C (Livingston 1996), and Herman et al. (2006) reported that wheat crowns held at −3°C underwent numerous changes in physiology, cellular structure, and the proteome. It seems likely that at least some of these changes can also occur at temperatures less than −3°C and are a result of transcriptional regulation of key genes. Because about 25% of the responsive genes identified in this study were not significantly similar to any genes of known function and genes encoding chlorophyll binding-like proteins were upregulated in the nonphotosynthetic crown tissue, it may be that responses to subfreezing stresses involve processes that have not yet been described. Furthermore, certain of the responsive genes were differentially regulated in cultivars with differing cold tolerance, suggesting that it may be possible to identify specific genes and alleles related to a greater ability to survive freezing, thereby providing access to previously unknown genetic variation for cold tolerance in winter wheat.

Notes

Acknowledgements

The author thanks Brian Bellinger for technical assistance and Derek Pouchnik of the Washington State University Biotechnology Core Facility for conducting the microarray hybridizations and scans. This project was supported by USDA-ARS project 5348-21430-003-00D. Mention of product names does not represent an endorsement of any product or company but is given only to clarify the methodology; other products may be equally effective.

Supplementary material

10142_2009_126_MOESM1_ESM.xls (176 kb)
Table S1Fold-changes in gene expression in crown tissue of cold acclimated winter wheat plants exposed to three freezing treatments. (HTM 251 kb)
10142_2009_126_MOESM2_ESM.pdf (74 kb)
Table S2Sixty-nine wheat (Triticum aestivum) genes that were indicated from Affymetrix microarray analysis as upregulated at least fivefold as cold-acclimated wheat plants were exposed to freezing treatmentsa. (PDF 74 kb)
10142_2009_126_MOESM3_ESM.pdf (52 kb)
Table S3Genes that were expressed to significantly different levels in crown tissue of Tiber winter wheat plants after three freezing treatmentsa as indicated by Affymetrix microarray analysis. (PDF 51 kb)
10142_2009_126_Fig1_ESM.gif (74 kb)
Fig. S1

Relative fluorescence vs. cycle number of quantitative real-time PCR on cDNA from crown tissue of winter wheat Tiber plants exposed to four temperature treatments. The primers were designed by Vagujfalvi et al. (2005, Mol Genet Genom 274:506–514) for the Cbf1B gene but amplify several Cbf gene fragments. The result of that amplification was very uniform across treatments and was used as a constant-expression benchmark (GIF 107 kb).

10142_2009_126_Fig1_ESM.tif (6.3 mb)
High resulotion image (TIF 10.2 MB)

References

  1. Anonymous (2002) World wheat facts. Western Organization of Research Councils, Washington, DC, pp. 1–2Google Scholar
  2. Bastida M, Graziano E, Roca R, Lopez I, Sanchez-Pons N, Puigdomenech P, Vicient CM (2006) A maize defective-kernel mutant (longcell) characterized by tubular cells, severe morphological alterations and induction of cell death. Planta 223:755–768PubMedCrossRefGoogle Scholar
  3. Blazejczyk M, Miron M, Nadon R (2007) FlexArray: a statistical data analysis software for gene expression microarrays. Genome Quebec, Montreal, Canada. http://genomequebec.mcgill.ca/FlexArray
  4. Dussault A, Pouliot M (2006) Rapid and simple comparison of messenger RNA levels using real-time PCR. Biol Proced Online 8:1–10PubMedCrossRefGoogle Scholar
  5. Eulgem T, Rushton PJ, Robatzek S, Somssich I, Somssich IE (2000) The WRKY superfamily of plant transcription factors. Trends Plant Sci 5:199–206PubMedCrossRefGoogle Scholar
  6. Fowler DB (2002) Cultivar development and selection, Chapter 8. In:Winter wheat production manual. The University of Saskatchewan. http://www.usask.ca/agriculture/plantsci/winter_cereals/Winter_wheat/CHAPT08/cvchpt08.php. Accessed March 2, 2009
  7. Fowler S, Thomashow MF (2002) Arabidopsis transcriptome profiling indicates that multiple regulatory pathways are activated during cold acclimation in addition to the CBF cold response pathway. Plant Cell 14:1675–1690PubMedCrossRefGoogle Scholar
  8. Fowler S, Cook D, Thomashow MF (2005) The CBF cold-response pathway. In: Jenks MA, Hasegawa PM (eds) Plant abiotic stress. Blackwell, Oxford, UKGoogle Scholar
  9. Galiba G, Vágújfalvi A, Li C, Soltész A, Dubcovsky J (2009) Regulatory genes involved in the determination of frost tolerance in temperate cereals. Plant Sci 176:12–19CrossRefGoogle Scholar
  10. Ganeshan S, Vitamvas P, Fowler DB, Chibbar RN (2008) Quantitative expression analysis of selected COR genes reveals their differential expression in leaf and crown tissues of wheat (Triticum aestivum L.) during an extended low temperature acclimation regimen. J Exp Bot 59:2393–2402PubMedCrossRefGoogle Scholar
  11. Grant MN (1980) Registration of Norstar wheat. Crop Sci 20:552Google Scholar
  12. Herman EM, Rotter K, Premakumar R, Elwinger G, Bae R, Ehler-King L, Chen SX, Livingston DP (2006) Additional freeze hardiness in wheat acquired by exposure to −3°C is associated with extensive physiological, morphological, and molecular changes. J Exp Bot 57:3601–3618PubMedCrossRefGoogle Scholar
  13. Jankowska AM, Gondek LP, Szpurka H, Nearman ZP, Tiu RV, Maciejewski JP (2008) Base excision repair dysfunction in a subgroup of patients with myelodysplastic syndrome. Leukemia 22:551–558PubMedCrossRefGoogle Scholar
  14. Kisha TJ, Taylor GA, Bowman HR, Wiesner LE, Jackson GD, Carlson GR, Bergman JW, Kushnak GD, Stallknecht GF, Stewart VR, McGuire CF (1992) Registration of Tiber hard red winter wheat. Crop Sci 32:1292Google Scholar
  15. Kobayashi F, Takumi S, Nakata M, Ohno R, Nakamura T, Nakamura C (2004) Comparative study of the expression profiles of the Cor/Lea gene family in two wheat cultivars with contrasting levels of freezing tolerance. Physiol Plant 120:585–594PubMedCrossRefGoogle Scholar
  16. Kume S, Kobayashi F, Ishibashi M, Ohno R, Nakamura C, Takumi S (2005) Differential and coordinated expression of Cbf and Cor/Lea genes during long-term cold acclimation in two wheat cultivars showing distinct levels of freezing tolerance. Genes & Genet Syst 80:185–197CrossRefGoogle Scholar
  17. Laity JH, Lee BM, Wright PE (2001) Zinc finger proteins: new insights into structural and functional diversity. Curr Opin Struct Biol 11:39–46PubMedCrossRefGoogle Scholar
  18. Limin AE, Fowler DB (2006) Low-temperature tolerance and genetic potential in wheat (Triticum aestivum L.): response to photoperiod, vernalization, and plant development. Planta 224:360–366PubMedCrossRefGoogle Scholar
  19. Livingston DP III (1996) The second phase of cold hardening: freezing tolerance and fructan isomer changes in winter cereal crowns. Crop Sci 36:1568–1573CrossRefGoogle Scholar
  20. Monroy AF, Dryanova A, Malette B, Oren DH, Ridha Farajalla M, Liu W, Danyluk J, Ubayasena LWC, Kane K, Scoles GJ, Sarhan F, Gulick PJ (2007) Regulatory gene candidates and gene expression analysis of cold acclimation in winter and spring wheat. Plant Mol Biol 64:409–423PubMedCrossRefGoogle Scholar
  21. Mullet JE (1988) Chloroplast development and gene-expression. Annu Rev Plant Physiol Plant Molec Biol 39:475–502CrossRefGoogle Scholar
  22. Patterson FL, Shaner GE, Ohm HW, Foster JE (1990) A historical perspective for the establishment of research goals for wheat improvement. J Prod Agric 3:30–38Google Scholar
  23. Satoh H, Uchida A, Nakayama K, Okada M (2001) Water-soluble chlorophyll protein in Brassicaceae plants is a stress-induced chlorophyll-binding protein. Plant Cell Physiol 42:906–911PubMedCrossRefGoogle Scholar
  24. Skinner DZ, Bellinger BS, Halls S, Baek KH, Garland-Campbell K, Siems WF (2005) Phospholipid acyl chain and phospholipase dynamics during cold acclimation of winter wheat. Crop Sci 45:1858–1867CrossRefGoogle Scholar
  25. Thomashow MF (1999) Plant cold acclimation: freezing tolerance genes and regulatory mechanisms. Annu Rev Plant Physiol Plant Mol Biol 50:571–599PubMedCrossRefGoogle Scholar
  26. Turtinen LW, Bremer LA, Prall DN, Schwartzhoff J, Hartsel SC (2005) Distinct cytokine release profiles from human endothelial and THP-1 macrophage-like cells exposed to different amphotericin B formulations. Immunopharm Immunotox 27:85–93Google Scholar
  27. Vagujfalvi A, Aprile A, Miller A, Dubcovsky J, Delugu G, Galiba G, Cattivelli L (2005) The expression of several Cbf genes at the Fr-A2 locus is linked to frost resistance in wheat. Mol Genet Genom 274:506–514CrossRefGoogle Scholar
  28. Wolfe SA, Nekludova L, Pabo CO (2000) DNA recognition by Cys2His2 zinc finger proteins. Ann Rev Biophys Biomol Struct 29:183–212CrossRefGoogle Scholar

Copyright information

© Springer-Verlag 2009

Authors and Affiliations

  1. 1.USDA-ARS and Department of Crop and Soil SciencesWashington State UniversityPullmanUSA

Personalised recommendations