Advertisement

Gastric Cancer

, Volume 18, Issue 1, pp 84–92 | Cite as

Clinical significance of RacGAP1 expression at the invasive front of gastric cancer

  • Susumu SaigusaEmail author
  • Koji Tanaka
  • Yasuhiko Mohri
  • Masaki Ohi
  • Tadanobu Shimura
  • Takahito Kitajima
  • Satoru Kondo
  • Yoshinaga Okugawa
  • Yuji Toiyama
  • Yasuhiro Inoue
  • Masato Kusunoki
Original Article

Abstract

Background

Rac GTPase activating protein 1 (RacGAP1) plays a regulatory role in cell growth, transformation and metastasis. The aim of this study was to clarify the association between RacGAP1 expression and clinical outcome in patients with gastric cancer.

Methods

A total of 232 gastric cancer patients in our institute who underwent surgery without preoperative treatments were enrolled in this study. We investigated RacGAP1 expression using immunohistochemistry (IHC) and evaluated IHC scores calculated by the percentage of positive cells and intensity and its expression at the invasive front. RACGAP1 expression was also assessed.

Results

RacGAP1 expression was observed in the nuclei of gastric cancer cells. Evaluation by IHC score showed no significant correlations with clinicopathological variables except for histological differentiation. In transcriptional analyses, RACGAP1 expression was elevated in diffuse type gastric cancer than intestinal type without a significant difference. We observed significant correlations of RacGAP1 protein expression at the invasive front with older age, tumor size, lymph node metastasis, lymphatic invasion, vascular invasion and advanced stage. Patients with RacGAP1 protein expression at the invasive front had significantly poorer prognosis than those without it (P < 0.0001). In multivariate analysis, lymph node metastasis, distant metastasis and positive RacGAP1 expression at the invasive front were independent prognostic factors (lymph node metastasis: P = 0.0106; distant metastasis: P = 0.0012; RacGAP1: P = 0.0011).

Conclusions

RacGAP1 expression at the invasive front in gastric cancer was significantly correlated with factors reflecting tumor progression and poor prognosis. Our data suggest that RacGAP1 might play important roles in the progression of gastric cancer.

Keywords

RacGAP1 Gastric cancer Invasive front Poor prognosis 

Introduction

Gastric cancer is the second most common cancer-related cause of death worldwide despite a decline in its incidence [1, 2]. The diagnosis of gastric cancer is delayed by lack of early specific symptoms, and consequently, tumor invasion into the muscularis propria, so-called advanced gastric cancer, is found in many patients at the time of initial diagnosis. The prognosis of advanced gastric cancer remains poor. The identification of predictive markers for cancer progression and prognosis would aid in assessing the clinical outcome and potential treatment stratification for patients with gastric cancer.

Rac GTPase-activating protein 1 (RacGAP1) belongs to the family of GTPase activation proteins. RacGAP1 interacts with GTP-bound small G proteins of the Rho family and stimulates GTP hydrolysis [3, 4]. RacGAP1 regulates the activity of cdc42 and Rac1, known as Rho GTPases. RacGAP1 is essential for the induction of cytokinesis and leads to cell proliferation [5, 6]. Several authors reported a positive correlation between RacGAP1 expression and Ki67, a known proliferative marker [7, 8]. Moreover, RacGAP1 is involved in cell transformation, motility, migration, and metastasis [9, 10, 11, 12]. The clinical significance of RacGAP1 has been reported in several malignancies such as meningioma, breast cancer, and hepatocellular carcinoma [7, 8, 13, 14, 15]. The previous studies suggested that high RacGAP1 expression reflected increased aggressiveness of the tumor. Ke et al. reported that high RACGAP1 mRNA levels were significantly associated with tumor recurrence and poor prognosis in meningioma. They concluded that RacGAP1 might contribute to the following mechanisms of tumor recurrence. First, RACGAP1 could regulate the activation of Rac and cdc42 to trigger cytoskeletal reorganization and, consequently, influence cell morphology, cell migration, chemotaxis, and the establishment of cell polarity that might lead to tumor recurrence. Second, RacGAP1 could contribute to cancer recurrence and metastasis through polycomb repressive complex 1 by modulating cytoskeletal and transcriptional pathways to enhance cell motility [7]. However, little is known about the association of RacGAP1 with the progression and prognosis of gastric cancer.

The aim of this retrospective study was to clarify the association of RacGAP1 expression with clinicopathological variables in patients with gastric cancer.

Materials and methods

Patients and specimens

A total of 232 formalin-fixed, paraffin-embedded (FFPE) tissue samples were obtained from gastric cancer patients who underwent a gastrectomy from 2001 to 2011 at Mie University Hospital. Patients with preoperative treatment were excluded in this study. There were no perioperative mortalities among these patients. Table 1 shows patient characteristics. The median age of the study subjects was 68 years (range 31–81 years), and the ratio of men to women was 2.4:1. All patients were postoperatively classified according to UICC stage classifications. The pathological T stages were pT1 (n = 99), pT2 (n = 28), pT3 (n = 44), and pT4 (n = 61). Lymph node metastases were observed in 106 (45.6 %) patients. One hundred nineteen tumors (51.2 %) had intestinal type gastric cancer, and the remainders had diffuse type. There were 111 patients with stage I, 44 patients with stage II, 47 patients with stage III, and 30 patients with stage IV disease. The median follow-up period was 28 months (range 1–127 months). The study design was approved by the ethics review board at Mie University Hospital. All of the patients signed an informed consent for their tissues to be used in this study.
Table 1

Patient characteristics

Variable

n = 232 (%)

Median age: 68 years

Gender

 Male

163 (70.3)

 Female

69 (29.7)

T classification

 pT1

99 (42.7)

 pT2

28 (21.1)

 pT3

44 (19.0)

 pT4

61 (26.3)

Lymph node metastasis

 Negative

126 (54.3)

 Positive

106 (45.7)

Lymphatic invasion

 ly 0/1

116 (50.0)

 ly 2/3

116 (50.0)

Vascular invasion

 v 0/1

192 (82.8)

 v 2/3

40 (17.2)

Histology

 Intestinal

119 (51.3)

 Diffuse

113 (48.7)

Stage

 I

111 (47.8)

 II

44 (19.0)

 II

47 (20.3)

 IV

30 (12.9)

Immunohistochemistry

The FFPE specimens were sliced into 2-μm sections. After deparaffinization and dehydration, the sections were placed in 10 mM sodium citrate buffer (pH 6.0) and autoclaved at 121 °C for 10 min for antigen retrieval. The sections were incubated in 3 % hydrogen peroxide for ten min, blocked, and incubated with a primary antibody overnight at 4 °C. Anti-RacGAP1 mouse monoclonal antibody (EE-16, Santa Cruz Biotechnology, CA, USA; dilution 1:100), and anti-cdc42 mouse monoclonal antibody (B-8, Santa Cruz Biotechnology; dilution 1:100) were the primary antibodies used in a labeled streptavidin–biotin system (Envision™ + Dual Link System-HRP, Dako Cytomation, Denmark). Antibody binding was visualized using 3,3′-diaminobenzidine (Dako Cytomation, Denmark). All of the sections were counterstained with hematoxylin prior to being dehydrated and mounted. At least three sections per specimen were stained to confirm reproducibility. Negative controls were performed simultaneously with pre-immune immunoglobulin.

Immunohistochemical evaluation

Sections were observed under a light microscope. We defined the presence of RacGAP1 expression in the nuclei of cancer cells as positive expression. First, we calculated modified immunohistochemistry (IHC) scores, as described in our previous report [16], by multiplying the percentage of positive epithelial cells (0–100 %) by the staining intensity that was scored as follows: 0, negative; 1, weak; 2, strong. RacGAP1 IHC scores ranged from 0 to 200. The IHC scores per three fields at a magnification of 100× were calculated, and the median value of each IHC score was recorded. Second, RacGAP1 expression at the invasive front was evaluated. The invasive front is an area where tumor cells migrated into stromal cells, and where cells de-differentiated into ones with stem-like features [17]. We defined the invasive front as the front edge between the tumor and the stromal tissues. When the proportion of cancer cells positive for RacGAP1 at the invasive front was ≥10 %, the cancer was defined as being RacGAP1-positive, and the remainder of the tumor was defined as RacGAP1-negative at a magnification of 200× in reference to previous report [18]. Each sample was scored in a blinded manner by two investigators (T. S. and Y. O.) who did not have any clinical or pathological information regarding the origin of the samples.

Quantitative real-time polymerase chain reaction (qRT-PCR)

Tumor specimens were homogenized with a Mixer Mill MM 300 homogenizer (Qiagen, Chatsworth, CA). Total RNA was isolated with an RNeasy Mini Kit (Qiagen). cDNA synthesis and qRT-PCR were performed as previously described [19]. Primer for RACGAP1 was described in a previous report [7], and primers for GAPDH and ACTB (beta-actin) were designed with Primer3 software (Biology Workbench Version 3.2, San Diego Supercomputer Center, University of California, San Diego). The sequences were as follows: RACGAP1-specific primers (sense, 5′-TGATGGTGGAGCAAGAG-3′, and antisense, 5′-GGGAAGTAACAGGCAGAT-3′); GAPDH (sense, GGAAGGTGAAGGTCGGAGTC and antisense, AATGAAGGGGTCATTCATGG), and ACTB (sense, ACAGAGCCTCGCCTTTGC, and antisense, GCGGCGATATCATCATCC). Target gene expression was calculated using the standard curve, and quantitative normalization of cDNA in each sample was performed using the expression of the GAPDH gene as an internal control.

Statistical analyses

All statistical analyses were performed using Stat View 5.0 for Windows (SAS Institute Inc., Cary, NC, USA). The contingency tables were analyzed using Fisher’s exact probability test or the Chi square test with Yates’ correction. Correlation between the continuous and categorical variables was evaluated using the Mann–Whitney U test for two groups and the Kruskal–Wallis test for more than three groups. The overall survival (OS) times were calculated from the date of surgery to the date of a patient's death. OS probabilities were calculated using the Kaplan–Meier product limit method and intergroup differences were determined using a log-rank test. The influence of prognostic predictors identified via univariate analysis was assessed by multivariate analysis using Cox’s proportional hazards model. A P value <0.05 was considered statistically significant.

Results

Immunohistochemical findings of RacGAP1 in gastric cancer

RacGAP1 expression was observed in the nuclei of gastric cancer cells. Figure 1 shows the expression of RacGAP1 at the invasive front of gastric cancer. In normal mucosa, RacGAP1 expression was detected in several crypt and isthmus epithelial cells but not the surface epithelium. The immunoreactivity of RacGAP1 was higher in cancer cells compared to normal mucosa. Additionally, its expression was observed in lymphocytes at the germinal center of lymphoid follicles (Fig. 2).
Fig. 1

Immunohistochemical findings of RacGAP1 expression in gastric cancer. RacGAP1 expression was observed in the nuclei of gastric cancer cells. Negative (a) and positive (b) RacGAP1 expression at the invasive front in submucosal lesion. Positive (c, d) and negative (e, f) expression at the invasive front in lesions deeper than muscularis propria. Original magnification: a, b ×100; c, e ×40; d, f ×200

Fig. 2

RacGAP1 expression in normal mucosa. RacGAP1 expression was detected in several crypt and isthmus epithelial cells but not the surface epithelium (a–d) (white arrow: crypt cells). RacGAP1 immunoreactivity was higher in cancer cells compared to normal mucosa (e). Additionally, RacGAP1 expression was observed in lymphocytes at the germinal center of lymphoid follicles (f). Original magnification: a, b, c, and e ×100; b ×200; d, f ×400

Correlation of RacGAP1 IHC scores with clinicopathological variables

We observed a significant correlation of RacGAP1 IHC score with histological type, and its IHC score in patients with intestinal type was significantly higher than those with diffuse type (Mann–Whitney U test: P = 0.005). There was no correlation of the IHC scores with other clinicopathological variables (supplemental data 1). Therefore, we focused on RacGAP1 expression at the invasive front.

Significant correlation of RacGAP1 expression at the invasive front with factors reflecting tumor progression

We observed expression of RacGAP1 at the invasive front in 81 patients (34.9 %). The expression was significantly correlated with age (P = 0.0001), tumor size (P < 0.0001), tumor depth (P < 0.0001), lymph node metastasis (P < 0.0001), lymphatic invasion (P < 0.0001), vascular invasion (P < 0.0001), and disease stage (P = 0.0016) (Table 2). Figure 3 shows the survival curve for OS according to RacGAP1 expression at the invasive front using the Kaplan–Meier method. Patients with RacGAP1 expression at the invasive front showed a significantly poorer OS than did patients with expression levels below the cut-off values (P < 0.0001).
Table 2

Association of RacGAP1 expression at the invasive front with clinicopathological variables

Variable

RacGAP1-negative (n = 151)

RacGap1-positive (n = 81)

P value

Gender

 Male

102

61

0.2320

 Female

49

20

 

Age (years)

 <68

90

26

0.0001

 ≥68

55

61

 

Tumor size (mm)

 <50

111

37

<0.0001

 ≥50

37

44

 

T classification

 T1/2

106

22

<0.0001

 T3/4

46

60

 

Lymph node metastasis

 Negative

106

20

<0.0001

 Positive

56

60

 

Lymphatic invasion

 ly 0/1

97

19

<0.0001

 ly 2/3

54

62

 

Vascular invasion

 v 0/1

140

52

<0.0001

 v 2/3

11

29

 

Histology

 Intestinal

72

47

0.1330

 Diffuse

79

34

 

Stage

 I

94

17

<0.0001*

 II

29

15

 

 II

21

26

 

 IV

7

23

 

Patients with more than 10 % of cancer cells at the invasive front were defined as being RacGAP1-positive

Mann–Whitney U test. Kruskal–Wallis test*

Fig. 3

Overall survival curves according to RacGAP1 expression at the invasive front. Patients with RacGAP1 expression at the invasive front had significantly poorer prognosis.

RacGAP1 expression at the invasive front is an independent prognostic factor

Table 3 shows the results of univariate and multivariate analyses of factors influencing survival using Cox’s proportional hazards model. Univariate analysis showed that elderly age (≥68 years), tumor size (≥50 mm), advanced T stage, positive lymph node metastasis, lymphatic invasion, vascular invasion, distant metastases, and RacGAP1 expression at the invasive front were significantly associated with poor prognosis. Multivariate analysis revealed that lymph node metastasis, distant metastases, and RacGAP1 expression at the invasive front were independent predictive markers for poor prognosis (P = 0.0106, P = 0.0012, and P = 0.0011, respectively).
Table 3

Univariate and multivariate analyses for predictors of survival

Variables

HR

95 %CI

P value

Univariate

 Gender (male vs. female)

1.062

0.547–2.062

0.8584

 Age (<68 vs. ≥68 year)

2.426

1.264–4.655

0.0077

 Tumor size (<50 vs. ≥50 mm)

2.942

1.561–5.544

0.0008

 T classification (1, 2 vs. 3, 4)

4.917

2.335–10.353

<0.0001

 Lymph node metastasis (negative vs. positive)

12.839

4.551–36.219

<0.0001

 Lymphatic invasion (0, 1 vs. 2, 3)

6.331

2.652–15.114

<0.0001

 Vascular invasion (0, 1 vs. 2, 3)

6.358

3.407–11.864

<0.0001

 Histology (intestinal vs. diffuse)

0.974

0.523–1.815

0.9342

 Stage (1, 2, 3 vs. 4)

9.203

4.480–18.905

<0.0001

 RacGAP1 expression in invasive front (negative vs. positive)

8.438

4.109–17.328

<0.0001

Multivariate

 Age (<68 vs. ≥68 year)

1.639

0.802–3.352

0.1756

 Tumor size (<50 vs. ≥50 mm)

1.376

0.687–2.758

0.3680

 T classification (1, 2 vs. 3, 4)

0.741

0.293–1.873

0.5258

 Lymph node metastasis (negative vs. positive)

5.870

1.511–22.804

0.0106

 Lymphatic invasion (0, 1 vs. 2, 3)

0.955

0.296–3.084

0.9388

 Vascular invasion (0, 1 vs. 2, 3)

1.538

0.737–3.211

0.2517

 Stage (1, 2, 3 vs. 4)

4.068

1.744–9.404

0.0012

 RacGAP1 expression in invasive front (negative vs. positive)

3.639

1.674–7.908

0.0011

Patients with a10 % or higher proportion of cancer cells at the invasive front were defined as being RacGAP1-positive.

HR hazard ratio, CI confidence interval

Comparison between RacGAP1 and cdc42 expression

Figure 4 shows the expression of RacGAP1 and cdc42 (downstream signaling of RacGAP1) in gastric cancer cells. RacGAP1 expression was detected in the nuclei of several cancer cells. On the other hand, cdc42 expression was diffusely observed in the cytoplasm of cancer cells, and its expression pattern did not vary according to the location of cancer cells in a tumor.
Fig. 4

Comparison between RacGAP1 and cdc42 expression: RacGAP1 (ac) immunoreactivity wanes in accordance to depth, while cdc42 (d–f) expression was diffusely observed in cytoplasm of cancer cells (a and d show each expression in a submucosal lesion; b, c, e, and f show each expression at the invasive front of a tumor). Original magnification: a, b, d, e ×100; c, e ×200

Elevated RACGAP1 gene expression in diffuse type gastric cancer

To clarify whether there was a difference of RacGAP1 expression according to histological type, we investigated RACGAP1 gene expression in 154 patients with gastric cancer (intestinal type: n = 78 and diffuse type: n = 76). In contrast to the results using immunohistochemical analysis, RACGAP1 gene expression in diffuse type gastric cancer was higher compared to that in intestinal type despite the lack of significant difference (intestinal type: 0.215 vs. diffuse type: 0.279. P = 0.0861) (supplemental data2). There was no significant correlation of RACGAP1 expression with other clinicopathological variables (data not shown).

Discussion

In the present study, RacGAP1 expression at the invasive front was significantly associated with tumor progression and poor prognosis in gastric cancer. To the best of our knowledge, this is the first report of the association of RacGAP1 with gastric cancer.

Gastric cancer includes two major histological subtypes according to Lauren’s classification [20]: intestinal type (50 % differentiated) and diffuse type (33 % undifferentiated). Intestinal type gastric cancer is more associated with environmental factors such as intestinal metaplasia and Helicobacter pylori infection, and is frequently accompanied by liver metastasis [21, 22, 23]. Diffuse type gastric cancer has an increased propensity for intramural and transmural spread and is associated with peritoneal dissemination and poorer prognosis than intestinal type [23, 24]. In the present study, we observed that intestinal type gastric cancer had a significantly higher IHC score of RacGAP1 expression than the diffuse type, although there was no significant correlation of its expression with other clinical parameters. To determine whether RACGAP1 gene expression differed according to histological differentiation, we measured its expression in gastric cancer using qRT-PCR. Contrary to immunohistochemical examination, RACGAP1 expression was higher in diffuse type gastric cancer compared to intestinal type. In several malignancies, the association between RACGAP1 gene expression and histological grade has been reported, and high histological grade tumors were associated with high RACGAP1 gene expression [7, 14]. Although our transcriptional analysis was similar to previous reports, it is difficult to explain the reason for the different results obtained by immunohistochemical and transcriptional evaluations. We think a reason for the difference could be that the IHC score was calculated by evaluation of whole tumor, while the tissue samples for the evaluation of mRNA level were obtained from part of the tumor. O′Brien et al. [25] demonstrated that RacGAP1 was required for differentiation of embryos and hematopoietic stem cells and concluded that RACGAP1 was post-transcriptionally regulated during blastocyte development to enable embryonic stem cell self-renewal. These mechanisms may explain the apparent differences of RacGAP1 expression determined by immunohistochemical and transcriptional analyses. Additionally, we consider one of the reasons for this discrepancy is that RACGAP1 has twenty-nine splice variants, and the primer for RACGAP1 described by Ke HL et al. [7] used in the present study detects most splice variants.

RacGAP1 is reportedly associated with more aggressive cancer phenotypes of high-grade breast cancer [26], epithelial ovarian cancer [27], and hepatocellular carcinoma [15] in the transition from low invasive to high invasive disease. In subgroup analysis of 113 patients with diffuse type gastric cancer, we observed that RacGAP1 IHC scores in patients with lymph node metastasis and vascular invasion were significantly higher than scores in patients without them (cut-off: median value. P = 0.0468 and 0.002, respectively). Moreover, patients with high RacGAP1 IHC score had significantly poorer prognosis compared to patients with low IHC scores (P = 0.0103) (data not shown). On the other hand, there was no significant correlation between RacGAP1 IHC score and clinicopathological variables in patients with intestinal type gastric cancer. These data showed that diffuse type gastric cancer with high RacGAP1 expression had more aggressive features than those with low RacGAP1 expression.

The importance of evaluating the invasive front has been reported in several gastrointestinal malignancies [28, 29, 30, 31]. In the present study, we examined RacGAP1 expression at the invasive front in gastric cancer and observed the association of its expression with tumor progression and poor prognosis. Epithelial-mesenchymal transition (EMT) is known to be one potential mechanism of migration, invasion and metastasis of cancer cells including gastric cancer [32, 33]. RacGAP1 regulates the function of Rho proteins such as Rac and cdc42 to influence cell morphology, cell motility, and the establishment of cell polarity and consequently plays a key role in metastasis [9, 34]. Zondag et al. [35] showed that the interaction between Rho and Rac GTPases and the downregulation of Rac activity led to increased Rho activity and EMT. Whereas RacGAP1 contributes to the regulation of numerous biological processes, our future investigations will focus on the association between RacGAP1 and EMT in gastric cancer.

In conclusion, RacGAP1 expression at the invasive front in gastric cancer was significantly correlated with factors reflecting tumor progression and poor prognosis. Our data suggest that RacGAP1 might play important roles in the progression of gastric cancer. However, data in this study should be interpreted with some caution. A major limitation is the small number of patients studied and the retrospective nature of the study. A larger study population and a long-term follow-up are needed to validate these results.

Supplementary material

10120_2014_355_MOESM1_ESM.docx (19 kb)
Supplementary material 1 (DOCX 19 kb)
10120_2014_355_MOESM2_ESM.pdf (9 kb)
RACGAP1 gene expression according to Lauren’s classification: RACGAP1 gene expression was higher in diffuse type gastric cancer compared to that in intestinal type without significant difference (PDF 8 kb)

References

  1. 1.
    Ferlay J, Shin HR, Bray F, Forman D, Mathers C, Parkin DM. Estimates of worldwide burden of cancer in 2008: GLOBOCAN 2008. Int J Cancer. 2010;127:2893–917.PubMedCrossRefGoogle Scholar
  2. 2.
    Siegel R, Naishadham D, Jemal A. Cancer statistics, 2012. CA Cancer J Clin. 2012;62:10–29.PubMedCrossRefGoogle Scholar
  3. 3.
    Toure A, Dorseuil O, Morin L, Timmons P, Jegou B, Reibel L, et al. MgcRacGAP, a new human GTPase-activating protein for Rac and Cdc42 similar to Drosophila rotundRacGAP gene product, is expressed in male germ cells. J Biol Chem. 1998;273:6019–23.PubMedCrossRefGoogle Scholar
  4. 4.
    Jantsch-Plunger V, Gonczy P, Romano A, Schnabel H, Hamill D, Schnabel R, et al. CYK-4: a Rho family gtpase activating protein (GAP) required for central spindle formation and cytokinesis. J Cell Biol. 2000;149:1391–404.PubMedCentralPubMedCrossRefGoogle Scholar
  5. 5.
    Hirose K, Kawashima T, Iwamoto I, Nosaka T, Kitamura T. MgcRacGAP is involved in cytokinesis through associating with mitotic spindle and midbody. J Biol Chem. 2001;276:5821–8.PubMedCrossRefGoogle Scholar
  6. 6.
    Zhao WM, Fang G. MgcRacGAP controls the assembly of the contractile ring and the initiation of cytokinesis. Proc Natl Acad Sci USA. 2005;102:13158–63.PubMedCentralPubMedCrossRefGoogle Scholar
  7. 7.
    Ke HL, Ke RH, Li ST, Li B, Lu HT, Wang XQ. Expression of RACGAP1 in high grade meningiomas: a potential role in cancer progression. J Neurooncol. 2013;113:327–32.PubMedCrossRefGoogle Scholar
  8. 8.
    Kotoula V, Kalogeras KT, Kouvatseas G, Televantou D, Kronenwett R, Wirtz RM, et al. Sample parameters affecting the clinical relevance of RNA biomarkers in translational breast cancer research. Virchows Arch. 2013;462:141–54.PubMedCentralPubMedCrossRefGoogle Scholar
  9. 9.
    Sahai E. Mechanisms of cancer cell invasion. Curr Opin Genet Dev. 2005;15:87–96.PubMedCrossRefGoogle Scholar
  10. 10.
    Sanz-Moreno V, Gadea G, Ahn J, Paterson H, Marra P, Pinner S, et al. Rac activation and inactivation control plasticity of tumor cell movement. Cell. 2008;135:510–23.PubMedCrossRefGoogle Scholar
  11. 11.
    Vega FM, Ridley AJ. Rho GTPases in cancer cell biology. FEBS Lett. 2008;582:2093–101.PubMedCrossRefGoogle Scholar
  12. 12.
    Yamazaki D, Kurisu S, Takenawa T. Involvement of Rac and Rho signaling in cancer cell motility in 3D substrates. Oncogene. 2009;28:1570–83.PubMedCrossRefGoogle Scholar
  13. 13.
    Fritz G, Brachetti C, Bahlmann F, Schmidt M, Kaina B. Rho GTPases in human breast tumours: expression and mutation analyses and correlation with clinical parameters. Br J Cancer. 2002;87:635–44.PubMedCentralPubMedCrossRefGoogle Scholar
  14. 14.
    Pliarchopoulou K, Kalogeras KT, Kronenwett R, Wirtz RM, Eleftheraki AG, Batistatou A, et al. Prognostic significance of RACGAP1 mRNA expression in high-risk early breast cancer: a study in primary tumors of breast cancer patients participating in a randomized Hellenic Cooperative Oncology Group trial. Cancer Chemother Pharmacol. 2013;71:245–55.PubMedCrossRefGoogle Scholar
  15. 15.
    Wang SM, Ooi LL, Hui KM. Upregulation of Rac GTPase-activating protein 1 is significantly associated with the early recurrence of human hepatocellular carcinoma. Clin Cancer Res. 2011;17:6040–51.PubMedCrossRefGoogle Scholar
  16. 16.
    Wong SC, Lo SF, Lee KC, Yam JW, Chan JK, Wendy Hsiao WL. Expression of frizzled-related protein and Wnt-signalling molecules in invasive human breast tumours. J Pathol. 2002;196:145–53.PubMedCrossRefGoogle Scholar
  17. 17.
    Brabletz T, Jung A, Spaderna S, Hlubek F, Kirchner T. Opinion: migrating cancer stem cells—an integrated concept of malignant tumour progression. Nat Rev Cancer. 2005;5:744–9.PubMedCrossRefGoogle Scholar
  18. 18.
    Tsutsumi S, Morohashi S, Kudo Y, Akasaka H, Ogasawara H, Ono M, et al. L1 Cell adhesion molecule (L1CAM) expression at the cancer invasive front is a novel prognostic marker of pancreatic ductal adenocarcinoma. J Surg Oncol. 2011;103:669–73.PubMedCrossRefGoogle Scholar
  19. 19.
    Saigusa S, Inoue Y, Tanaka K, Toiyama Y, Okugawa Y, Shimura T, et al. Decreased expression of DUSP4 is associated with liver and lung metastases in colorectal cancer. Med Oncol. 2013;30:620.PubMedCrossRefGoogle Scholar
  20. 20.
    Lauren P. The two histological main types of gastric carcinoma: diffuse and so-called intestinal-type carcinoma. An attempt at a histo-clinical classification. Acta Pathol Microbiol Scand. 1965;64:31–49.PubMedGoogle Scholar
  21. 21.
    Kaneko S, Yoshimura T. Time trend analysis of gastric cancer incidence in Japan by histological types, 1975–1989. Br J Cancer. 2001;84:400–5.PubMedCentralPubMedCrossRefGoogle Scholar
  22. 22.
    Parsonnet J, Vandersteen D, Goates J, Sibley RK, Pritikin J, Chang Y. Helicobacter pylori infection in intestinal- and diffuse-type gastric adenocarcinomas. J Natl Cancer Inst. 1991;83:640–3.PubMedCrossRefGoogle Scholar
  23. 23.
    Gomceli I, Demiriz B, Tez M. Gastric carcinogenesis. World J Gastroenterol. 2012;18:5164–70.PubMedCentralPubMedGoogle Scholar
  24. 24.
    Yuasa Y. Control of gut differentiation and intestinal-type gastric carcinogenesis. Nat Rev Cancer. 2003;3:592–600.PubMedCrossRefGoogle Scholar
  25. 25.
    O’Brien RN, Shen Z, Tachikawa K, Lee PA, Briggs SP. Quantitative proteome analysis of pluripotent cells by iTRAQ mass tagging reveals post-transcriptional regulation of proteins required for ES cell self-renewal. Mol Cell Proteomics. 2010;9:2238–51.PubMedCentralPubMedCrossRefGoogle Scholar
  26. 26.
    Ma XJ, Salunga R, Tuggle JT, Gaudet J, Enright E, McQuary P, et al. Gene expression profiles of human breast cancer progression. Proc Natl Acad Sci USA. 2003;100:5974–9.PubMedCentralPubMedCrossRefGoogle Scholar
  27. 27.
    Lu KH, Patterson AP, Wang L, Marquez RT, Atkinson EN, Baggerly KA, et al. Selection of potential markers for epithelial ovarian cancer with gene expression arrays and recursive descent partition analysis. Clin Cancer Res. 2004;10:3291–300.PubMedCrossRefGoogle Scholar
  28. 28.
    Konishi K, Yamamoto H, Mimori K, Takemasa I, Mizushima T, Ikeda M, et al. Expression of C4.4A at the invasive front is a novel prognostic marker for disease recurrence of colorectal cancer. Cancer Sci. 2010;101:2269–77.PubMedCrossRefGoogle Scholar
  29. 29.
    Akishima-Fukasawa Y, Ishikawa Y, Akasaka Y, Uzuki M, Inomata N, Yokoo T, et al. Histopathological predictors of regional lymph node metastasis at the invasive front in early colorectal cancer. Histopathology. 2011;59:470–81.PubMedCrossRefGoogle Scholar
  30. 30.
    Kahlert C, Lahes S, Radhakrishnan P, Dutta S, Mogler C, Herpel E, et al. Overexpression of ZEB2 at the invasion front of colorectal cancer is an independent prognostic marker and regulates tumor invasion in vitro. Clin Cancer Res. 2011;17:7654–63.PubMedCrossRefGoogle Scholar
  31. 31.
    Cao C, Chen Y, Masood R, Sinha UK, Kobielak A. alpha-Catulin marks the invasion front of squamous cell carcinoma and is important for tumor cell metastasis. Mol Cancer Res. 2012;10:892–903.PubMedCentralPubMedCrossRefGoogle Scholar
  32. 32.
    Potenta S, Zeisberg E, Kalluri R. The role of endothelial-to-mesenchymal transition in cancer progression. Br J Cancer. 2008;99:1375–9.PubMedCentralPubMedCrossRefGoogle Scholar
  33. 33.
    Zhang ZY, Ge HY. Micrometastasis in gastric cancer. Cancer Lett. 2013;336:34–45.PubMedCrossRefGoogle Scholar
  34. 34.
    Grewal S, Carver JG, Ridley AJ, Mardon HJ. Implantation of the human embryo requires Rac1-dependent endometrial stromal cell migration. Proc Natl Acad Sci USA. 2008;105:16189–94.PubMedCentralPubMedCrossRefGoogle Scholar
  35. 35.
    Zondag GC, Evers EE, ten Klooster JP, Janssen L, van der Kammen RA, Collard JG. Oncogenic Ras downregulates Rac activity, which leads to increased Rho activity and epithelial-mesenchymal transition. J Cell Biol. 2000;149:775–82.PubMedCentralPubMedCrossRefGoogle Scholar

Copyright information

© The International Gastric Cancer Association and The Japanese Gastric Cancer Association 2014

Authors and Affiliations

  • Susumu Saigusa
    • 1
    Email author
  • Koji Tanaka
    • 1
  • Yasuhiko Mohri
    • 1
  • Masaki Ohi
    • 1
  • Tadanobu Shimura
    • 1
  • Takahito Kitajima
    • 1
  • Satoru Kondo
    • 1
  • Yoshinaga Okugawa
    • 1
  • Yuji Toiyama
    • 1
  • Yasuhiro Inoue
    • 1
  • Masato Kusunoki
    • 1
  1. 1.Department of Gastrointestinal and Pediatric SurgeryMie University Graduate School of MedicineTsuJapan

Personalised recommendations