
Utility of oropharyngeal real-time PCR for S. pneumoniae and H. influenzae for diagnosis of pneumonia in adults

  • A. Bjarnason
  • M. Lindh
  • J. Westin
  • L.-M. Andersson
  • O. Baldursson
  • K. G. Kristinsson
  • M. Gottfredsson
Open Access
Original Article


A lack of sensitive tests and difficulties obtaining representative samples contribute to the challenge in identifying etiology in pneumonia. Upper respiratory tract swabs can be easily collected and analyzed with real-time PCR (rtPCR). Common pathogens such as S. pneumoniae and H. influenzae can both colonize and infect the respiratory tract, complicating the interpretation of positive results. Oropharyngeal swabs were collected (n = 239) prospectively from adults admitted to hospital with pneumonia. Analysis with rtPCR targeting S. pneumoniae and H. influenzae was performed and results compared with sputum cultures, blood cultures, and urine antigen testing for S. pneumoniae. Different Ct cutoff values were applied to positive tests to discern colonization from infection. Comparing rtPCR with conventional testing for S. pneumoniae in patients with all tests available (n = 57) resulted in: sensitivity 87 %, specificity 79 %, PPV 59 % and NPV 94 %, and for H. influenzae (n = 67): sensitivity 75 %, specificity 80 %, PPV 45 % and NPV 94 %. When patients with prior antimicrobial exposure were excluded sensitivity improved: 92 % for S. pneumoniae and 80 % for H. influenzae. Receiver operating characteristic curve analysis demonstrated for S. pneumoniae: AUC = 0.65 (95 % CI 0.51–0.80) and for H. influenzae: AUC = 0.86 (95 % CI 0.72–1.00). Analysis of oropharyngeal swabs using rtPCR proved both reasonably sensitive and specific for diagnosing pneumonia caused by S. pneumoniae and H. influenzae. This method may be a useful diagnostic adjunct to other methods and of special value in patients unable to provide representative lower airway samples.


Positive Predictive Value Negative Predictive Value Haemophilus Influenzae Sputum Culture Pneumonia Severity Index 
These keywords were added by machine and not by the authors. This process is experimental and the keywords may be updated as the learning algorithm improves.


The microbial etiology of pneumonia often remains undetected despite extensive diagnostic testing [1]. Blood cultures lack sensitivity and obtaining representative lower respiratory tract samples can be challenging [2]. An etiologic diagnosis allows targeted antimicrobial treatment, a matter of increasing importance as resistance rates increase [3].

Streptococcus pneumoniae (SP) and Haemophilus influenzae (HI) are common causes of pneumonia but also colonize the upper respiratory tract at rates ranging from 1 to 76 %, highest in young children [4, 5, 6]. Lower respiratory tract samples such as sputum are thus preferred for diagnostic purposes.

Multiplex real-time PCR (rtPCR) panels have become established in the diagnosis of respiratory tract infections but primarily used to identify viruses and “atypical” bacteria [7]. Due to easily collected samples and the high sensitivity of PCR-based methods, upper airway sampling is often used even when a lower respiratory tract infection is suspected. The likelihood of a causal association is high if an organism not known to colonize the respiratory tract is detected in the setting of pneumonia.

Sputum and nasopharyngeal samples have been examined with PCR targeting SP and HI applying quantitative thresholds to discern infection from carriage [8, 9, 10]. However, analyzing sputum does not avoid the problems associated with obtaining high quality samples [9, 11]. Despite closer anatomical proximity to the site of infection, and study results suggesting lower carriage rates in this area, studies examining oropharyngeal sampling in pneumonia are lacking [12, 13].

The authors are not aware of any previous studies examining the utility of rtPCR examining HI from the oropharynx or Spn9802 as a target for SP in the setting of pneumonia. Different PCR targets for SP have been proposed but problems with specificity can occur [13, 14].

The aim of this study was to examine the utility of rtPCR from oropharyngeal swabs for the etiologic diagnosis of pneumonia caused by SP and HI in adults by comparing rtPCR results with other, established etiological tests and applying different cycle threshold (Ct) cut-off values to quantitatively differentiate carriage from infection.

Materials and methods

Patient inclusion and etiological testing

Data was derived from patients admitted with pneumonia from December 2008 to November 2009 to Landspitali University Hospital, Reykjavik, Iceland [15]. All participants had a new chest X-ray infiltrate and clinical symptoms of pneumonia [16]. Patients with hospital-acquired pneumonia were excluded. Cultures were collected prior to antibiotic administration in hospital. Only high quality sputum was included [17]. Blood cultures were collected, incubated and cultured using standard methods at our center and susceptibility testing performed using the Clinical and Laboratory Standards Institute methods and criteria [18]. Urine antigen testing (UAT) for SP was performed using a commercially available kit (Binax NOW Streptococcus pneumoniae). An oropharyngeal swab sample (sterile rayon tipped swabs, COPAN Italia) was collected for rtPCR. Pneumonia Severity Index (PSI) and CURB-65 scores were calculated [19, 20]. Participant reported antimicrobial use during the 14 days prior to admission was recorded.

Real-time PCR

Nucleic acid from 200 μL specimens was extracted with QIAmp DNA Blood Mini Kit (QIAGEN) and the MagNa Pure Compact Nucleic Acid Isolation Kit I (Roche Diagnostics). The nucleic acids were eluted in 100 μL volume, and 5 μL used for rtPCR. RtPCR was performed with an ABI 7900 384-well system (Applied Biosystems, Foster City, CA, USA) in eight parallel 20 μL reactions containing Universal Mastermix (ABI), including oligonucleotides targeting the omp6 gene of HI and the Spn9802 fragment of SP. Abdeldaim et al. utilized the same targets [21, 22], but in order to obtain shorter amplicons and greater specificity new primers and probes were designed. For both bacteria primers were altered to decrease amplicon length compared with the referenced method to achieve a more effective PCR. For HI two mismatches for Haemophilus haemolyticus were introduced in the probe to increase specificity. The specificity of rtPCR for SP and HI was tested using reference samples containing Streptococcus mitis, Streptococcus oralis and Streptococcus sanguinis, and H. haemolyticus and Haemophilus parainfluenzae respectively. No cross reaction was noted with either comparison.

Thus, the omp6 gene of HI was amplified by forward primer CTAACAACGATGCTGCAGGCA, reverse primer GTGTTATAACGTTGTTGAAGATCAGC and probe, NED-ATGGTGCTGCTCAAA-MGB (MGB, minor groove binder); and the Spn9802 fragment of SP with forward primer TTTCTGGATAGAGGGAGTATCCGA, reverse primer TTACCAACCTACTCATCTTCTCACCA, and probe FAM-CAAAGTTAATACCGCCCTC-MGB. After a reverse transcription step at 46 °C for 30 min followed by 10 min of denaturation at 95 °C, 45 cycles of two-step PCR was performed (15 s at 95 °C, 60 s at 58 °C). A pUC57 plasmid carrying target sequences was used in each run parallel with patient specimens to verify the performance of PCR (master mix control). In addition, one positive control was processed with each set of samples, from extraction of nucleic acids through the detection of amplified products.

Comparison of different tests

Sensitivity, specificity, positive predictive value (PPV) and negative predictive value (NPV) of rtPCR for SP and HI were calculated using combined and separate results from sputum (SP and HI) and blood cultures (SP only), and urine antigen analysis (SP only) as a reference “gold standard”. For each comparison, only participants with both rtPCR results and the reference test in question available were included. Four different threshold cycle (Ct) cutoffs were applied. For these calculations we assumed that a positive culture or urinary antigen test indicated a definite etiologic diagnosis while cases with positive rtPCR but negative comparative tests indicated colonization.

Statistical analysis

Data for SP and HI were summarized using receiver operating characteristic (ROC) curves to determine diagnostic efficacy of the rtPCR for different Ct values. Positive rtPCR results were examined and true positives determined using culture or UAT. AUC with 95 % confidence intervals (CI) were determined and optimal Ct cut off determined.

Categorical data was compared using chi-square or Fisher’s exact test as appropriate. Statistical significance was set at two-tailed P = 0.05. Continuous data was compared using 95 % CI. Calculations were performed using IBM SPSS Statistics Version

The Landspitali University Hospital ethics committee approved this study which is in accord with the revised Helsinki Declaration. All patients or proxy provided written informed consent.


The study cohort is described in Table 1. In all 373 pneumonia cases were included but complete sample sets were not universally available. Differences in demographics, disease severity and outcomes between groups providing different samples were analyzed. Availability of PCR swabs was associated with a lower likelihood of ICU care (5.4 vs. 14.2 %, p < 0.01) and lower 30-day mortality (2.1 vs. 9.0 %, p < 0.01) (Table 1).
Table 1

Comparison of underlying characteristics, severity scores and selected blood tests on arrival and outcomes for patients by tests submitted


All patients

PCR swab available

Sputum available

Blood culture available

UAT available

S. pneumoniae PCR positive

H. influenzae PCR positive

No. (%)

373 (100)

239 (64)

116 (31)

280 (75)

273 (73)

61 (26)a

51 (21)a

Age, mean (95 % CI)

63.6 (61.6–65.6)

63.8 (61.2–66.4)

62.5 (58.8–66.2)

62.5 (60.1–64.8)

63.4 (61.1–65.7)

65.9 (60.3–69.4)

63.5 (57.6–69.4)

No. (%) male

180 (48)

112 (47)

59 (50)

140 (50)

133 (49)

33 (54)

21 (41)

No. (%) with antibiotics prior to admission

123 (33)

75 (31)

34 (29)

88 (31)

95 (35)

14 (23)

19 (37)

PSI points, mean (95 % CI)

79.9 (76.4–83.5)

79.3 (75.0–83.7)

77.8 (71.6–84.1)

79.9 (75.7–84.1)

78.8 (74.8–82.9)

80.0 (71.9–88.0)

82.1 (72.5–91.7)

CURB-65 points, mean (95 % CI)

1.3 (1.2–1.4)

1.4 (1.2–1.5)

1.3 (1.1–1.5)

1.3 (1.2–1.4)

1.3 (1.2–1.4)

1.4 (1.1–1.7)

1.4 (1.1–1.7)

APACHE II score, mean (95 % CI)

9.9 (9.4–10.5)

9.9 (9.2–10.5)

9.2 (8.3–10.2)

10.3 (9.6–10.9)

9.9 (9.3–10.6)

9.8 (8.5–11.2)

9.9 (8.5–11.3)

CRP, mean (95 % CI)

128 (118–138)

130 (117–143)

128 (110–146)

136 (124–147)

132 (121–135)

135 (109–160)

144 (112–176)

White count, mean (95 % CI)

12.3 (11.7–13.0)

12.5 (12.7–13.3)

13.0 (11.8–14.1)

12.3 (11.5–13.0)

12.3 (11.6–13.1)

14.2 (12.7–15.7)

12.6 (10.8–14.5)

Length of stay, mean (95 % CI) (days)

7.7 (7.2–8.2)

7.8 (7.2–8.4)

7.3 (6.5–8.1)

7.9 (7.3–8.5)

7.9 (7.3–8.4)

6.8 (5.7–7.8)

8.2 (6.5–9.8)

No. (%) who received ICU care

32 (9)

13 (5)

5 (4)

29 (10)

25 (9)

4 (7)

3 (6)

30 Day all cause mortality, No. (%)

17 (5)

5 (2)

3 (3)

13 (5)

12 (4)

1 (2)

1 (2)

UAT urinary antigen test for S. pneumoniae, PSI pneumonia severity index, CI confidence interval, CURB-65 confusion, urea, respiratory rate, blood pressure, PCR polymerase chain reaction

aPercentage calculated from those with PCR swabs available

Rates of SP and HI identification

SP was identified with conventional methods in 30 (12.6 %) and HI in 17 (7.1 %) of 239 patients with rtPCR results available, compared with 22 (16.4 %) and 4 (3.0 %) of 134 patients without rtPCR results, differences that were not statistically significant. Using rtPCR, SP was identified in 61 (25.5 %) cases and HI in 50 (20.9 %). Rates of positive rtPCR were similar in patients with sputum culture, blood culture or UAT results available (Table 2).
Table 2

Comparison of detection rates for S. pneumoniae and H. influenzae with real-time PCR and conventional testinga among patients with both tests available


No. with test available:

Sputum culture

Blood culture

Urinary antigen testb

(n = 83)

(n = 187)

(n = 168)

S. pneumoniae identified with:

 Conventional method, no. (%)

17 (20)

5 (3)

21 (13)

 Real-time PCRc, no. (%)

29 (35)

45 (24)

50 (29)

H. influenzae identified with:

 Conventional method, no. (%)

12 (16)

0 (0)


 Real-time PCRc, no. %

24 (29)

40 (21)


UAT urinary antigen test

aPatients with both real time PCR result and relevant alternative test examined for each type of test. Patients could be included in more than one group when multiple cases were available

bUAT is not available for detection of H. influenzae

cReal-time PCR considered positive at Ct of 45 or below

Sensitivity and specificity of real-time PCR

For SP overall sensitivity was 87 %, specificity 79 %, PPV 59 % and NPV 94 % amongst patients with all tests available. Results were similar when UAT results were excluded from the analysis. For HI sensitivity was 75 %, specificity 80 %, PPV 45 % and NPV 94 %. Excluding patients with recent antibiotic use increased the sensitivity of rtPCR for both SP and HI (Table 3).
Table 3

Sensitivity, specificity, positive predictive value and negative predictive value of PCR identification of S. pneumoniae and H. influenzae from upper airway swabs positive at varying Ct value cutoffs compared with different reference gold standards


S. pneumoniae

H. influenzae









Sputum culture (n = 83)


82 %

77 %

48 %

94 %

79 %

81 %

46 %

95 %


82 %

79 %

50 %

95 %

79 %

93 %

69 %

96 %


59 %

89 %

59 %

89 %

57 %

100 %

100 %

92 %


41 %

97 %

78 %

86 %

21 %

100 %

100 %

86 %

Blood culture (n = 187)


80 %

77 %

9 %

99 %


79 %

0 %

100 %


80 %

79 %

10 %

99 %

88 %

0 %

100 %


40 %

88 %

8 %

98 %

95 %

0 %

100 %


40 %

95 %

18 %

98 %

99 %

0 %

100 %

Urinary antigen testb (n = 168)


67 %

77 %

28 %

95 %


67 %

79 %

30 %

95 %


48 %

87 %

33 %

93 %


24 %

96 %

42 %

90 %

SC, BC and UAT, any availablec (SP n = 228; HI n = 214)


70 %

81 %

36 %

95 %

79 %

82 %

23 %

98 %


70 %

83 %

38 %

95 %

79 %

92 %

39 %

98 %


47 %

91 %

44 %

92 %

57 %

98 %

62 %

97 %


27 %

97 %

62 %

90 %

21 %

99 %

75 %

95 %

SC, BC and UAT, all availablec (SP n = 57 & HI n = 67)


87 %

79 %

59 %

94 %

75 %

80 %

45 %

94 %


87 %

81 %

62 %

94 %

75 %

91 %

64 %

94 %


53 %

86 %

57 %

84 %

25 %

100 %

100 %

86 %


40 %

95 %

75 %

82 %

17 %

100 %

100 %

85 %

SC, BC and UAT, all available, patients with prior antibiotics excludedc (SP n = 37 & HI n = 47)


92 %

80 %

69 %

95 %

80 %

84 %

57 %

94 %


92 %

84 %

73 %

95 %

80 %

92 %

73 %

94 %


58 %

92 %

78 %

82 %

60 %

100 %

100 %

90 %


42 %

96 %

83 %

77 %

20 %

100 %

100 %

82 %

Ct threshold cycle, PPV positive predictive value, NPV negative predictive value, SC sputum culture, BC blood culture, UAT urinary antigen test

aCt is a semi quantitative measurement which relates inversely to the samples’ initial DNA concentration

bNo patients were positive for H. influenzae in blood culture

cUAT not available for H. influenzae, thus not included in right columns

When single tests were compared with rtPCR, sensitivity and specificity for SP were similar for sputum and blood culture while sensitivity was decreased when compared with UAT. A similar comparison was not possible for HI due to lack of positive blood cultures (Table 3).

The ROC curves for SP and HI are shown in Fig. 1. The AUC for SP was 0.65 (95 % CI 0.51–0.80) with an estimated optimal cutoff Ct value of 35 cycles. ROC analysis for HI resulted in an AUC of 0.86 (95 % CI 0.72–1.00) with an estimated optimal Ct cutoff of 33.
Fig. 1

Receiver operating characteristic (ROC) curves comparing Ct results from real-time PCR to results from conventional microbiological testing for S. pneumoniae (left) (AUC = 0.653; 95 % CI 0.508–0.799) and H. influenzae (right) (AUC = 0.859; 95 % CI 0.722–0.997)


This study is the first to examine oropharyngeal rtPCR for HI and target SP with Spn9802 to diagnose pneumonia. Samples from a prospective cohort of consecutive patients requiring hospital admission for pneumonia with a high rate of patient inclusion (95 %) were examined. SP and HI were detected using conventional methods in 14 and 6 % of patients, similar to previous reports [1, 13]. Sensitivity of tests in increasing order were blood culture, UAT (SP only), and sputum culture (Table 2) [23]. The sensitivity of sputum culture is offset by decreased specificity due to risk of contamination from upper airway colonization.

Performance of real-time PCR

In cases with complete test panels, sensitivity and specificity of rtPCR for SP was 87 and 79 % (Table 3). In comparison, a recent meta-analysis estimated the sensitivity and specificity of UAT for SP to be 69 and 84 % [24]. Allowing incomplete test panels decreased sensitivity, possibly due to false negative results. For HI the sensitivity and specificity were 75 and 80 %. This comparison uses sputum culture for reference as HI was not isolated from blood in any of the included samples.

The PPV for SP was 59 % and NPV 94 % for complete sample sets, and the results for HI were 45 and 94 %. PPV was improved for both pathogens by excluding rtPCR positive at high Ct values, representing less DNA in the initial sample (Table 3). These results may be compared with 91–95 % PPV and 83–91 % NPV for UAT described previously [25, 26].

RtPCR provides quantitative information in the form of Ct values, which may assist in discerning colonization from infection [27]. ROC analysis indicated good accuracy for HI (AUC = 0.86) but relatively poor for SP (AUC = 0.65). Results for rtPCR were improved among patients without prior antibiotic use (Table 3) indicating use of antimicrobials prior to admission may have negatively affected the ROC result.

Potential impact of cross-reactivity and carriage on specificity

Cross-reactivity with other species may decrease PCR specificity. The pneumolysin gene (ply) target for SP may react with alpha-hemolytic streptococci [9, 28]. Targeting the autolysin gene (lytA) or Spn9082 may offer higher specificity but lytA is also present in other streptococci from the oral flora while the Spn9802 PCR may react to Streptococcus pseudopneumoniae [28]. The clinical significance and possible occurrence of S. pseudopneumoniae carriage is unclear. Targeting the Spn9802 region may lead to more specific results but has not been utilized in a clinical study of pneumonia etiology to the authors’ knowledge.

The P6 gene has been shown to be a sensitive and specific PCR target for identifying HI [21]. While possible cross-reactivity with related species has been demonstrated, the clinical significance is unclear, a problem compounded by difficulties in discriminating some of these species using conventional methods [29].

As this study did not include a control group background carriage in the population is difficult to assess. Two studies performed in a Nordic setting examined nasopharyngeal cultures from adults with non-infectious conditions at healthcare centers and hospitals and found low carriage rates, i.e. 1–3 % for both SP and HI [5, 8]. Carriage rates increased to 3 and 2 % with PCR analysis [8]. A more recent study examining oropharyngeal samples from community dwelling seniors detected SP in 5 % with culture but 18 % with PCR [30]. However, this study targeted ply which may have led to false positive test results due to cross-reactivity with alpha-hemolytic streptococci in the oropharynx [28].

Comparison with previous studies

In addition to alternative PCR targets, differences in setting and study populations hamper comparison with older studies. Yang et al. examined sputum samples in pneumonia and determined a sensitivity of 90 %, specificity of 80 % and an AUC of 0.87 for identifying SP [9]. It is perhaps not surprising that examining lower respiratory tract samples in a selected cohort of patients would result in a higher AUC. The selected PCR target (ply) may also partially explain the higher sensitivity and lower specificity of these results compared with the present study [14].

Strålin et al. compared PCR for SP (lytA) and HI (16sRNA with P6 verification) of sputum and nasopharyngeal samples with a composite of reference tests in pneumonia patients. Among patients without prior antibiotic use they found that sputum PCR had a sensitivity of 92 % and specificity of 42 % while nasopharyngeal swabs had a sensitivity of 61 % and specificity of 87 % for SP while the sensitivity for HI was 78 and 80 % [8]. Aside from a slightly higher sensitivity for SP from sputum it is of interest that utilizing sputum and nasopharyngeal samples were not necessarily superior to oropharyngeal swabs for diagnosing pneumonia.

Albrich et al. applied quantitative rtPCR (lytA) to examine nasopharyngeal swabs in adult HIV positive pneumonia patients with good results. The sensitivity was 82 % and specificity was 92 % for discerning infection from colonization and the AUC 0.78 for identifying SP. These results are similar to the present study but are difficult to compare due to differences in setting and population [31].

Abdeldaim et al. applied PCR targeting omP6 (HI) to nasopharyngeal aspirates from 166 pneumonia patients. Sensitivity was 97.5 %, specificity 84.1 % and AUC 0.974 when PCR was compared with culture. As these results were derived by comparing analyses on same samples they are difficult to compare with the present results. Of interest in this study confirmatory fucK PCR was performed to establish the specificity of the method [21].

Lack of a true gold standard

A weakness of this study and other comparable studies is the relatively low sensitivity of the reference methods used for comparison. This decreases sensitivity and specificity and in turn affects AUC [32]. In addition, antibiotic exposure may increase discrepancy between PCR and culture-based results. The improved performance of rtPCR among patients without recent antibiotic use supports this possibility.

Value of negative results

For both pathogens specificity and NPV were excellent. The application of rtPCR is not constrained to ascertaining etiology but may also be useful for decreasing the clinical likelihood of disease due to certain pathogens. Negative results may also have increased validity in the setting of multiplex-PCR when a clinically reasonable alternative pathogen has been identified. It is doubtful such an interpretation can be made in severely ill patients but might assist in avoiding antimicrobials in certain situations, such as in patients with less severe disease and a high probability of viral infection.


This study compares rtPCR analysis of oropharyngeal samples with conventional testing for diagnosis of bacterial pneumonia caused by SP or HI. Due to the high inclusion rate the results of this study may be more applicable to other settings than most studies of this nature. The results are comparable to previous studies analyzing high quality sputum. Utilizing different Ct values to quantify positive rtPCR results can assist in discerning colonization from infection caused by SP and HI in the setting of pneumonia. Further studies are required to test these findings and identify patient groups most likely to benefit from these tests.



We would like to thank our co-workers at Landspitali University Hospital who assisted in recruiting participants and collecting samples, and personnel of the Depts. of Microbiology and Virology at Landspitali University Hospital and the Dept. of Virology at the Sahlgrenska University Hospital for their work processing samples.

Compliance with ethical standards

Funding information

This work received grants from the Icelandic Center for Research; Rannís [grant number 100436021]; URL:; The Landspitali University Hospital Science Fund and the University of Iceland Research Fund.

Conflict of interest

The authors declare no competing interests.

Ethical approval

This study was approved by the Landspitali University Hospital ethics committee and was in accord with the revised Helsinki Declaration.

Informed consent

All patients or proxy provided written informed consent.


  1. 1.
    Jain S, Self WH, Wunderink RG, Fakhran S, Balk R, Bramley AM, Reed C, Grijalva CG, Anderson EJ, Courtney DM (2015) Community-acquired pneumonia requiring hospitalization among US adults. N Engl J Med 373(5):415–427CrossRefPubMedPubMedCentralGoogle Scholar
  2. 2.
    Garcia-Vazquez E, Marcos MA, Mensa J, de Roux A, Puig J, Font C, Francisco G, Torres A (2004) Assessment of the usefulness of sputum culture for diagnosis of community-acquired pneumonia using the PORT predictive scoring system. Arch Intern Med 164(16):1807–1811CrossRefPubMedGoogle Scholar
  3. 3.
    WHO (2014) Antimicrobial resistance: global report on surveillance. World Health Organization, GenevaGoogle Scholar
  4. 4.
    Musher DM, Thorner AR (2014) Community-acquired pneumonia. N Engl J Med 371(17):1619–1628CrossRefPubMedGoogle Scholar
  5. 5.
    Gunnarsson RK, Holm SE, Soderstrom M (1998) The prevalence of potential pathogenic bacteria in nasopharyngeal samples from healthy children and adults. Scand J Prim Health Care 16(1):13–17CrossRefPubMedGoogle Scholar
  6. 6.
    Greenberg D, Givon-Lavi N, Broides A, Blancovich I, Peled N, Dagan R (2006) The contribution of smoking and exposure to tobacco smoke to Streptococcus pneumoniae and Haemophilus influenzae carriage in children and their mothers. Clin Infect Dis 42(7):897–903CrossRefPubMedGoogle Scholar
  7. 7.
    Brittain-Long R, Nord S, Olofsson S, Westin J, Anderson LM, Lindh M (2008) Multiplex real-time PCR for detection of respiratory tract infections. J Clin Virol 41(1):53–56CrossRefPubMedGoogle Scholar
  8. 8.
    Strålin K, Tornqvist E, Kaltoft MS, Olcen P, Holmberg H (2006) Etiologic diagnosis of adult bacterial pneumonia by culture and PCR applied to respiratory tract samples. J Clin Microbiol 44(2):643–645CrossRefPubMedPubMedCentralGoogle Scholar
  9. 9.
    Yang S, Lin S, Khalil A, Gaydos C, Nuemberger E, Juan G, Hardick J, Bartlett JG, Auwaerter PG, Rothman RE (2005) Quantitative PCR assay using sputum samples for rapid diagnosis of pneumococcal pneumonia in adult emergency department patients. J Clin Microbiol 43(7):3221–3226CrossRefPubMedPubMedCentralGoogle Scholar
  10. 10.
    Stralin K, Herrmann B, Abdeldaim G, Olcen P, Holmberg H, Molling P (2014) Comparison of sputum and nasopharyngeal aspirate samples and of the PCR gene targets lytA and Spn9802 for quantitative PCR for rapid detection of pneumococcal pneumonia. J Clin Microbiol 52(1):83–89CrossRefPubMedPubMedCentralGoogle Scholar
  11. 11.
    Gadsby NJ, Russell CD, McHugh MP, Mark H, Conway Morris A, Laurenson IF, Hill AT, Templeton KE (2016) Comprehensive molecular testing for respiratory pathogens in community-acquired pneumonia. Clin Infect Dis 62(7):817–823CrossRefPubMedPubMedCentralGoogle Scholar
  12. 12.
    Lieberman D, Shleyfer E, Castel H, Terry A, Harman-Boehm I, Delgado J, Peled N, Lieberman D (2006) Nasopharyngeal versus oropharyngeal sampling for isolation of potential respiratory pathogens in adults. J Clin Microbiol 44(2):525–528CrossRefPubMedPubMedCentralGoogle Scholar
  13. 13.
    Holter JC, Müller F, Bjørang O, Samdal HH, Marthinsen JB, Jenum PA, Ueland T, Frøland SS, Aukrust P, Husebye E (2015) Etiology of community-acquired pneumonia and diagnostic yields of microbiological methods: a 3-year prospective study in Norway. BMC Infect Dis 15(1):64CrossRefPubMedPubMedCentralGoogle Scholar
  14. 14.
    Abdeldaim G, Herrmann B, Korsgaard J, Olcen P, Blomberg J, Stralin K (2009) Is quantitative PCR for the pneumolysin (ply) gene useful for detection of pneumococcal lower respiratory tract infection? Clin Microbiol Infect 15(6):565–570CrossRefPubMedGoogle Scholar
  15. 15.
    Bjarnason A, Asgeirsson H, Baldursson O, Kristinsson KG, Gottfredsson M (2015) Mortality in healthcare-associated pneumonia in a low resistance setting: a prospective observational study. Infect Dis 47(3):130–136CrossRefGoogle Scholar
  16. 16.
    Charles PG, Whitby M, Fuller AJ, Stirling R, Wright AA, Korman TM, Holmes PW, Christiansen KJ, Waterer GW, Pierce RJ, Mayall BC, Armstrong JG, Catton MG, Nimmo GR, Johnson B, Hooy M, Grayson ML (2008) The etiology of community-acquired pneumonia in Australia: why penicillin plus doxycycline or a macrolide is the most appropriate therapy. Clin Infect Dis 46(10):1513–1521CrossRefPubMedGoogle Scholar
  17. 17.
    Murray PR, Washington JA (1975) Microscopic and baceriologic analysis of expectorated sputum. Mayo Clin Proc 50(6):339–344PubMedGoogle Scholar
  18. 18.
    Clinical and Laboratory Standards Institute (2009) Performance standards for antimicrobial susceptibility testing: M100-S19. Clinical and Laboratory Standards Institute, WayneGoogle Scholar
  19. 19.
    Fine MJ, Auble TE, Yealy DM, Hanusa BH, Weissfeld LA, Singer DE, Coley CM, Marrie TJ, Kapoor WN (1997) A prediction rule to identify low-risk patients with community-acquired pneumonia. N Engl J Med 336(4):243–250CrossRefPubMedGoogle Scholar
  20. 20.
    Lim WS, van der Eerden MM, Laing R, Boersma WG, Karalus N, Town GI, Lewis SA, Macfarlane JT (2003) Defining community acquired pneumonia severity on presentation to hospital: an international derivation and validation study. Thorax 58(5):377–382CrossRefPubMedPubMedCentralGoogle Scholar
  21. 21.
    Abdeldaim GM, Stralin K, Kirsebom LA, Olcen P, Blomberg J, Herrmann B (2009) Detection of Haemophilus influenzae in respiratory secretions from pneumonia patients by quantitative real-time polymerase chain reaction. Diagn Microbiol Infect Dis 64(4):366–373CrossRefPubMedGoogle Scholar
  22. 22.
    Abdeldaim GM, Stralin K, Olcen P, Blomberg J, Herrmann B (2008) Toward a quantitative DNA-based definition of pneumococcal pneumonia: a comparison of Streptococcus pneumoniae target genes, with special reference to the Spn9802 fragment. Diagn Microbiol Infect Dis 60(2):143–150CrossRefPubMedGoogle Scholar
  23. 23.
    van der Eerden MM, Vlaspolder F, de Graaff CS, Groot T, Jansen HM, Boersma WG (2005) Value of intensive diagnostic microbiological investigation in low- and high-risk patients with community-acquired pneumonia. Eur J Clin Microbiol Infect Dis 24(4):241–249CrossRefPubMedGoogle Scholar
  24. 24.
    Sinclair A, Xie X, Teltscher M, Dendukuri N (2013) Systematic review and meta-analysis of a urine-based pneumococcal antigen test for diagnosis of community-acquired pneumonia caused by Streptococcus pneumoniae. J Clin Microbiol 51(7):2303–2310CrossRefPubMedPubMedCentralGoogle Scholar
  25. 25.
    Sorde R, Falco V, Lowak M, Domingo E, Ferrer A, Burgos J, Puig M, Cabral E, Len O, Pahissa A (2011) Current and potential usefulness of pneumococcal urinary antigen detection in hospitalized patients with community-acquired pneumonia to guide antimicrobial therapy. Arch Intern Med 171(2):166–172CrossRefPubMedGoogle Scholar
  26. 26.
    Ishida T, Hashimoto T, Arita M, Tojo Y, Tachibana H, Jinnai M (2004) A 3-year prospective study of a urinary antigen-detection test for Streptococcus pneumoniae in community-acquired pneumonia: utility and clinical impact on the reported etiology. J Infect Chemother 10(6):359–363CrossRefPubMedGoogle Scholar
  27. 27.
    Greiner O, Day PJ, Bosshard PP, Imeri F, Altwegg M, Nadal D (2001) Quantitative detection of Streptococcus pneumoniae in nasopharyngeal secretions by real-time PCR. J Clin Microbiol 39(9):3129–3134CrossRefPubMedPubMedCentralGoogle Scholar
  28. 28.
    Abdeldaim G, Herrmann B, Molling P, Holmberg H, Blomberg J, Olcen P, Stralin K (2010) Usefulness of real-time PCR for lytA, ply, and Spn9802 on plasma samples for the diagnosis of pneumococcal pneumonia. Clin Microbiol Infect 16(8):1135–1141CrossRefPubMedGoogle Scholar
  29. 29.
    Binks MJ, Temple B, Kirkham LA, Wiertsema SP, Dunne EM, Richmond PC, Marsh RL, Leach AJ, Smith-Vaughan HC (2012) Molecular surveillance of true nontypeable Haemophilus influenzae: an evaluation of PCR screening assays. PLoS ONE 7(3), e34083CrossRefPubMedPubMedCentralGoogle Scholar
  30. 30.
    van Deursen AM, van den Bergh MR, Sanders EA, Carriage Pilot Study G (2016) Carriage of Streptococcus pneumoniae in asymptomatic, community-dwelling elderly in the Netherlands. Vaccine 34(1):4–6CrossRefPubMedGoogle Scholar
  31. 31.
    Albrich W, Madhi S, Adrian P, Van Niekerk N, Mareletsi T, Cutland C, Wong M, Khoosal M, Karstaedt A, Zhao P (2012) Use of a rapid test of pneumococcal colonization density to diagnose pneumococcal pneumonia. Clin Infect Dis 54(5):601–609CrossRefPubMedGoogle Scholar
  32. 32.
    Waikar SS, Betensky RA, Emerson SC, Bonventre JV (2012) Imperfect gold standards for kidney injury biomarker evaluation. J Am Soc Nephrol 23(1):13–21CrossRefPubMedPubMedCentralGoogle Scholar

Copyright information

© The Author(s) 2016

Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (, which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.

Authors and Affiliations

  • A. Bjarnason
    • 1
    • 2
  • M. Lindh
    • 3
  • J. Westin
    • 3
  • L.-M. Andersson
    • 3
  • O. Baldursson
    • 2
  • K. G. Kristinsson
    • 1
    • 2
  • M. Gottfredsson
    • 1
    • 2
    • 4
  1. 1.Faculty of MedicineUniversity of Iceland, ReykjavikReykjavikIceland
  2. 2.Departments of Medicine, Microbiology and VirologyLandspitali University HospitalReykjavikIceland
  3. 3.Department of Infectious Diseases/Clinical VirologyUniversity of GothenburgGothenburgSweden
  4. 4.Division of Infectious DiseasesLandspitali University HospitalReykjavikIceland

Personalised recommendations